ID: 1086271667

View in Genome Browser
Species Human (GRCh38)
Location 11:85074697-85074719
Sequence AATGTCTTCAAGAATATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086271667 Original CRISPR AATGTCTTCAAGAATATAGG AGG Intronic
900119204 1:1041367-1041389 AATGTCTTCAAGAAGTTCGACGG + Exonic
905808683 1:40896143-40896165 AATGTCTTCAACAATAAAGTGGG - Intergenic
905963934 1:42073097-42073119 AATCTCTTCCAGAAAATAGAAGG - Intergenic
908158784 1:61385437-61385459 AATGTCCTCATCAATATAGTGGG + Intronic
908679712 1:66647086-66647108 AATGGCTTAAACAATATAGGTGG + Intronic
909459175 1:75889906-75889928 ATTTTCTTCAAGTAGATAGGTGG + Intronic
911375815 1:97049830-97049852 ACTGTCTCCAAGAATATAAAAGG - Intergenic
912621891 1:111168995-111169017 AATGACTTAAAGTATACAGGAGG - Intronic
913491583 1:119384818-119384840 AATGTCTTCAAGGCTACAGCTGG - Exonic
913998409 1:143671257-143671279 ACTGTCTTCAAGAAAATAAAGGG - Intergenic
916258505 1:162815721-162815743 AATATCTTCCAGAATATAGAAGG - Intergenic
916353627 1:163879921-163879943 AATTCCTTCAGGAATATGGGAGG - Intergenic
917560282 1:176144932-176144954 AATGTCTTCATGACCACAGGTGG + Intronic
918701245 1:187611045-187611067 ATTAACATCAAGAATATAGGAGG + Intergenic
918786174 1:188767688-188767710 AATGTATTCAAGAATATCAAGGG + Intergenic
918891960 1:190285475-190285497 AAAGTCATCAAGATTATGGGAGG + Intronic
918932656 1:190875773-190875795 AATATCGTCCAGAATATATGAGG + Intergenic
919134897 1:193495516-193495538 AATCTCTTCATGAAAGTAGGCGG - Intergenic
921267660 1:213438185-213438207 AATGTGTTCAAGAAAATGGATGG - Intergenic
923894436 1:238253476-238253498 AATCTCTCCAAGAATATAACAGG - Intergenic
1063902155 10:10745401-10745423 AATGTTTACATGAATCTAGGAGG - Intergenic
1064199810 10:13274751-13274773 AATGTCTTCACGAAGATATTAGG + Intergenic
1067404721 10:46011166-46011188 AATTTCTTCAATAATGTCGGGGG - Exonic
1068700560 10:60015233-60015255 AATGTCTTTAACAAAATGGGTGG - Intergenic
1068700765 10:60017371-60017393 AATGATTTAAAGTATATAGGAGG + Intergenic
1068737211 10:60427703-60427725 AATGTTTTTGAAAATATAGGTGG + Intronic
1069400424 10:68038990-68039012 AATGTTTTCAAGAAAAAAAGGGG + Intronic
1073026566 10:100491354-100491376 AATCTCTTCCAGAAAATAGAAGG + Intronic
1073952707 10:108829320-108829342 TATGTCTTCTAAAATCTAGGTGG + Intergenic
1074021134 10:109584792-109584814 AATGTATTCAAGAAAAAAGAAGG + Intergenic
1074235546 10:111581270-111581292 AATGGCTTCATGAATAAAGTTGG - Intergenic
1081032536 11:38103039-38103061 AATCTCTAAAGGAATATAGGAGG + Intergenic
1081340274 11:41918526-41918548 AAAGTTTTCAAGAATAAAGGGGG - Intergenic
1086000709 11:81981961-81981983 AATCTCTTCAAGAAAATAAAAGG - Intergenic
1086271667 11:85074697-85074719 AATGTCTTCAAGAATATAGGAGG + Intronic
1087624562 11:100581976-100581998 AATGTCTCCCAGGATATAGTGGG - Intergenic
1088157708 11:106828933-106828955 AATGTTTTCACGAATGTTGGAGG - Intronic
1088163489 11:106902830-106902852 AATGACTTAAAGTATACAGGAGG + Intronic
1088447848 11:109951504-109951526 AATCTCTTCAAGAAAAGAGGAGG + Intergenic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1090535586 11:127637766-127637788 AATGTTTTCAAGAGTAAAAGAGG + Intergenic
1090683493 11:129088049-129088071 AATCACTTCATGAATATATGAGG - Intronic
1093080048 12:14800010-14800032 AAGGTCTTCAAGAACATAAGGGG - Intronic
1093369595 12:18351857-18351879 ACTGTCTTGAAGACTGTAGGTGG - Intronic
1093444427 12:19240076-19240098 AATTTCTTCAAGAATAAAAAAGG - Intronic
1094158764 12:27367626-27367648 AATTTCTTTTACAATATAGGGGG + Intronic
1094389436 12:29933289-29933311 AATGATTTCAAGTATATGGGAGG - Intergenic
1094643605 12:32300054-32300076 ACTGTCTACACGAAAATAGGTGG + Intronic
1095452182 12:42343488-42343510 AATGTATTCAAAAACATAGATGG - Intronic
1096896301 12:54823536-54823558 AATCTCTTCCAGAATATAAGAGG - Intergenic
1097320913 12:58225289-58225311 AATGACTTCAAGGATAAAGCTGG - Intergenic
1097536807 12:60882298-60882320 AATAACTTAAAGAATATAGTTGG + Intergenic
1097570220 12:61322934-61322956 AATGTCAACCAGAATAAAGGTGG - Intergenic
1098009158 12:66031915-66031937 AATGTCAGCCAGAATAGAGGAGG - Intergenic
1098177610 12:67809099-67809121 AATGTCTTCAATATTAGAGGGGG - Intergenic
1098762838 12:74446776-74446798 AATCTCTTTAATATTATAGGTGG - Intergenic
1099186827 12:79524013-79524035 AATGTCTAAAAGAATATGAGAGG - Intergenic
1099240295 12:80130453-80130475 AATGTGTTGAAGAATATAAGAGG + Intergenic
1102289615 12:111688472-111688494 AATGGGTTAAAGCATATAGGAGG - Intronic
1105442627 13:20428120-20428142 AATCTCTTCCAGAAAATAGGAGG + Intronic
1105592106 13:21801963-21801985 AATAACTTAATGAATATAGGAGG - Intergenic
1107050205 13:36038838-36038860 AATGTGTTCAAATATCTAGGAGG + Intronic
1107597548 13:41978680-41978702 AATGGATTCCAGAATATAGTAGG - Intergenic
1108806784 13:54167536-54167558 AGTTTCTTCAAGTATATAAGGGG + Intergenic
1109463047 13:62689192-62689214 GATGACTTAAAGTATATAGGTGG + Intergenic
1110171096 13:72501483-72501505 AATGATTTGAAGAATACAGGAGG + Intergenic
1110736659 13:78944715-78944737 AATATATTCAAGAAAATAGATGG + Intergenic
1111124857 13:83901396-83901418 AATGATTTAAAGAATATGGGAGG - Intergenic
1111200759 13:84932845-84932867 AATGTTTGCAAGAATATAAGAGG - Intergenic
1113312474 13:109144593-109144615 AATGTCTTTAAGCATAAAGAAGG - Intronic
1114729751 14:24979580-24979602 AGTGTCATCAACATTATAGGTGG - Intronic
1114925194 14:27388272-27388294 AATATTTTCAAGAATTTAGCAGG + Intergenic
1116637842 14:47419887-47419909 AATTTCTTCAAGGAAATATGTGG + Intronic
1117564320 14:56977838-56977860 AATGTGTACAAAAATATTGGAGG + Intergenic
1118859434 14:69651042-69651064 AATGTCTTCTAGGGAATAGGAGG - Intronic
1118890796 14:69907012-69907034 AATGTCTTGAGGGAAATAGGAGG + Intronic
1119574222 14:75703723-75703745 ATTATATTCACGAATATAGGAGG - Intronic
1120385662 14:83842321-83842343 ACTGACTTCAAGAATATAGATGG + Intergenic
1120405055 14:84084102-84084124 TATGTCTTCTAAAATCTAGGTGG + Intergenic
1126653764 15:50954284-50954306 AAACTCTTCCAGAAAATAGGAGG - Intronic
1127111324 15:55674400-55674422 ACTTTCTTCAAGGATATAGAGGG + Intronic
1127315723 15:57792095-57792117 AATATCTTTAGGAATATAAGTGG + Intergenic
1127370800 15:58337984-58338006 AATGGCTTAAAGTATACAGGAGG - Intronic
1130005063 15:80088262-80088284 AAAGTCTTAAAGAATAGAGAAGG - Intronic
1130658261 15:85808623-85808645 AATTTCTTCCAGAAAATAGAAGG + Intergenic
1131336191 15:91551592-91551614 TGTGTCTTCAAGTATAGAGGTGG + Intergenic
1133539861 16:6739570-6739592 AATATCTTCTAGAAAATAGAAGG + Intronic
1133996438 16:10752066-10752088 AATGTATTAAAAAATATTGGGGG - Intronic
1134032743 16:11005500-11005522 AATGTGCTCAAGAAATTAGGAGG - Intronic
1137253155 16:46754816-46754838 AATGTCTTCAAAATTCTAAGGGG - Intronic
1137797413 16:51233726-51233748 AATGAATTCAAGAGTATGGGTGG + Intergenic
1137811662 16:51358548-51358570 TATATCTTAAAGTATATAGGGGG - Intergenic
1138086512 16:54138767-54138789 AATGTTTTAAAGCAAATAGGAGG - Intergenic
1138319102 16:56096026-56096048 AATTTCTTGAGGAATATAGCTGG - Intergenic
1139072961 16:63405428-63405450 AATGTCTTCATAAATATACTTGG + Intergenic
1140319144 16:73930940-73930962 AATGTATTCTAGAATGTAGGTGG + Intergenic
1140565984 16:76043058-76043080 AATTTTTTCATGAATGTAGGTGG - Intergenic
1143671455 17:8398902-8398924 AAAGTCATCAAGAATAATGGAGG + Intergenic
1143811472 17:9475244-9475266 ATTCTCTTCAAGAATAGAGTTGG + Intronic
1144889282 17:18484777-18484799 GAGGTCATCAAGAATCTAGGTGG - Intronic
1145142926 17:20459519-20459541 GAGGTCATCAAGAATCTAGGTGG + Intronic
1149099046 17:52882572-52882594 AAAGTCTTTAAGAAAATAGAAGG - Intronic
1150031649 17:61743287-61743309 AATGTCTTTAAGTAAATAAGGGG + Intronic
1153360606 18:4192075-4192097 AATGACTTCATCAATATAGTTGG + Intronic
1153894739 18:9548435-9548457 AATCTCTTCAAGATTAAAGGTGG - Intronic
1155621531 18:27785675-27785697 AATGATTTCAAGAATATACTTGG + Intergenic
1156563888 18:38161435-38161457 AATGTCTTGAAGAAAAAAAGAGG + Intergenic
1156836862 18:41565470-41565492 AATGTCTTCAGGATGAGAGGTGG - Intergenic
1157968010 18:52230925-52230947 AATGTCTTCACCAATGAAGGAGG + Intergenic
1158206988 18:55004379-55004401 GATGCCTGCAAGAATAAAGGAGG + Intergenic
1158636427 18:59162607-59162629 TATGTCTGCAACAATCTAGGCGG - Intergenic
1158921348 18:62194496-62194518 AATGTCTACATGTTTATAGGAGG - Intronic
1159139478 18:64375966-64375988 CATGTTTTCAAGAATATACTTGG + Intergenic
1159829628 18:73258982-73259004 AATGTGTTCCAGACTACAGGTGG + Intronic
1159834548 18:73322746-73322768 AATGTCTGCATCTATATAGGGGG + Intergenic
1162545458 19:11326455-11326477 AGTGGCTGCAAGAGTATAGGTGG + Intronic
1165543567 19:36513520-36513542 AATGTGTGCATGAATATATGGGG - Exonic
1166466466 19:43036111-43036133 AAAATCTGCAAGAATATAGTTGG - Intronic
925993272 2:9270675-9270697 AATGGGTACAAAAATATAGGTGG - Intronic
926566580 2:14482230-14482252 ATTATCTTAAAGAATACAGGGGG + Intergenic
927004184 2:18830600-18830622 GATGACTGAAAGAATATAGGAGG - Intergenic
927057171 2:19376074-19376096 ATTGTCTTCCCTAATATAGGTGG - Intergenic
928038123 2:27845378-27845400 AATGCCCTCAAGACTATAGGTGG - Intronic
928855522 2:35798398-35798420 AATGCCTTCAGGATTATATGAGG + Intergenic
929538574 2:42801418-42801440 AATGTCTTCATGGAGAAAGGAGG - Intergenic
931126322 2:59281721-59281743 AACGTCTTGAAGAATATACCTGG - Intergenic
931130934 2:59334893-59334915 AATGTATTAAAGAATATAAATGG + Intergenic
931288999 2:60856051-60856073 ACTGTCTCCAAGAATCAAGGAGG + Intergenic
932929052 2:76012030-76012052 AATGACTTAAAGTATACAGGAGG - Intergenic
933075400 2:77918774-77918796 ATTTTGTTCAAGAATTTAGGTGG - Intergenic
933454003 2:82498272-82498294 AATGTATTAATGAATATAGTGGG - Intergenic
935185493 2:100728454-100728476 AATCTCTTCCAGAAAAGAGGAGG + Intergenic
936277207 2:111109982-111110004 AATGTGTTCAAGAATTTACAAGG - Intronic
936436809 2:112515120-112515142 ATTATCTTCAAGAAAATATGAGG - Intronic
937831265 2:126426634-126426656 AAAGTCTTCAAGTATAAAGCTGG + Intergenic
939676129 2:145074049-145074071 AATGTTTTTAAGAATATCAGTGG - Intergenic
939828804 2:147048019-147048041 AGTGTAATCAACAATATAGGAGG + Intergenic
940185370 2:150978609-150978631 AATTTCTTCAAGAATATTATTGG - Intergenic
942170585 2:173285719-173285741 AAGGTCTTTAAGAATATGGGTGG - Intergenic
942854992 2:180534890-180534912 AAGGTCTGAAAGATTATAGGTGG - Intergenic
944157341 2:196621274-196621296 AATGTCCTAAAGAATCTAGGAGG + Intergenic
944362868 2:198879008-198879030 AATATCTTAAAGAATAAATGTGG - Intergenic
945086626 2:206138512-206138534 AATGTCTTGAAGAATTTTGGGGG + Exonic
945531732 2:210963256-210963278 AATGTTTAGAAAAATATAGGAGG - Intergenic
947164219 2:227245408-227245430 AATGACTTTAAGCATACAGGAGG + Intronic
947512344 2:230767886-230767908 AAAGACTTGAAAAATATAGGAGG - Intronic
1172299907 20:33842101-33842123 CATGGCATCAAGAATAGAGGGGG - Intronic
1173960335 20:47066452-47066474 AATGTCTTCAACAAGAAAGAAGG + Intronic
1174108255 20:48178642-48178664 ATTGTCTTAAAGATTTTAGGAGG - Intergenic
1175455783 20:59112629-59112651 AGTTTCTTTAAGAATATACGCGG - Intergenic
1175766556 20:61596532-61596554 AATGTCTGTAAGAAAAGAGGTGG + Intronic
1176345226 21:5737625-5737647 AATGTCTACAGCAAAATAGGAGG - Intergenic
1176352040 21:5858209-5858231 AATGTCTACAGCAAAATAGGAGG - Intergenic
1176499601 21:7586830-7586852 AATGTCTACAGCAAAATAGGAGG + Intergenic
1176539547 21:8135695-8135717 AATGTCTACAGCAAAATAGGAGG - Intergenic
1176558498 21:8318740-8318762 AATGTCTACAGCAAAATAGGAGG - Intergenic
1177491687 21:21833894-21833916 GATGATTTAAAGAATATAGGAGG + Intergenic
1177799613 21:25815269-25815291 AATGATTTAAAGTATATAGGAGG - Intergenic
1178559671 21:33626769-33626791 ACTGTATTTAATAATATAGGTGG - Intronic
1178578261 21:33814542-33814564 AATGTCTGAAAGGATAAAGGTGG + Intronic
1178751423 21:35307567-35307589 AATATCTTCCAGCATCTAGGAGG - Intronic
1179111925 21:38454525-38454547 AATTTCTTCAACTATAAAGGTGG + Intronic
1179841177 21:44074933-44074955 AATTTCTTCTAGAATTTAGCTGG + Intronic
1184055575 22:42045770-42045792 AATATGTTCCAGAAAATAGGAGG + Intronic
1185006927 22:48284662-48284684 AATGTGTTCAAGATTATGGAAGG + Intergenic
1203244497 22_KI270733v1_random:52050-52072 AATGTCTACAGCAAAATAGGAGG - Intergenic
950321430 3:12058299-12058321 AATGTCTTTAACAATACAGCTGG - Intronic
950625091 3:14239692-14239714 AATCTCTTCTAGAAAATAGGAGG - Intergenic
950835646 3:15916413-15916435 ACTGGCTTTAAAAATATAGGGGG + Intergenic
951352964 3:21629174-21629196 AAAGTCTTCAAGAAAAGAGAAGG - Intronic
953381295 3:42474588-42474610 AATTTCTTCAACAATATAATGGG + Intergenic
953600461 3:44358586-44358608 AATGACTTAAAGTATATGGGAGG + Intronic
954593792 3:51806755-51806777 AATGTGTTAAAGAAAATAGAAGG + Intergenic
955114057 3:55979463-55979485 TATGTCTTCAAAATTATGGGTGG + Intronic
956699159 3:71943603-71943625 CATGTATTGAAGCATATAGGTGG + Intergenic
957641249 3:82856178-82856200 TTTGTCTTCAGGGATATAGGTGG + Intergenic
957642799 3:82879822-82879844 AATGTCATCTAGAATTTATGAGG + Intergenic
958918654 3:100078213-100078235 AAAGTGTTGAAGTATATAGGAGG + Intronic
959385551 3:105701321-105701343 AGTGTTTTTAAGTATATAGGAGG + Intronic
959547565 3:107614628-107614650 AATGATTTCAAGAATATAGGAGG - Intronic
959775337 3:110153179-110153201 AATGTCTTCCAGAATAAACTGGG + Intergenic
960227373 3:115184214-115184236 ACTGACTTCAAGAATGAAGGCGG + Intergenic
961548287 3:127651564-127651586 ATTATCTTCAAGAATATGGCTGG - Intronic
962129115 3:132653655-132653677 AATGGGTTTAAGAAGATAGGAGG - Intronic
962948118 3:140191441-140191463 AATCTCTTCCAGAAAACAGGAGG - Intronic
963086970 3:141445992-141446014 AAAATCTTCAAAAATATAGTTGG + Exonic
964215445 3:154275230-154275252 GATGACTTAAAGAATATGGGAGG - Exonic
966519961 3:180862715-180862737 AATGTTTTCAAGAATAAAGAGGG + Intronic
966606722 3:181828331-181828353 AATTTCTTCCAAAATATAGAAGG - Intergenic
967390996 3:188954097-188954119 AATGATTTAAAGCATATAGGAGG - Intronic
968092161 3:195905687-195905709 AATGTCTACAAGAAAATACAGGG + Intronic
968179900 3:196586090-196586112 AATGTATTAGAGAATGTAGGTGG + Exonic
971709625 4:30093870-30093892 AATGACTTTAAGAATAAAGCCGG - Intergenic
972205729 4:36770293-36770315 AATTTAATCAAGAATATAGTGGG + Intergenic
972841736 4:42938604-42938626 AAATTCTACAAGAATATATGGGG - Intronic
972867652 4:43254624-43254646 AATGTCCTAAAGAATGTAGATGG + Intergenic
973325913 4:48862029-48862051 AATGACTTAAAGTATATAGGAGG + Intergenic
974220473 4:58962776-58962798 AATGTTTTCAAGAAAAAAGAAGG - Intergenic
975060214 4:69987922-69987944 AATGTCTTGTAGAATTTAGATGG + Intergenic
975062850 4:70024568-70024590 AACTTCTTTAAGAATAGAGGAGG - Intergenic
975064552 4:70044228-70044250 CATGTCTTAGAGAATTTAGGTGG + Intergenic
975069484 4:70116232-70116254 AATGTTTCCAAGAATTTTGGTGG + Intergenic
975363096 4:73494749-73494771 AAGGACTTCAAGAGCATAGGTGG - Intronic
975711017 4:77159228-77159250 TCAATCTTCAAGAATATAGGTGG - Intronic
975764196 4:77650000-77650022 ATTGTCTTCAATAATCTGGGTGG + Intergenic
976374813 4:84333396-84333418 AAACTCTTCAAGAAAATAGAAGG - Intergenic
980270376 4:130576588-130576610 AGTGTCTACAAGACTATAGCGGG - Intergenic
980797375 4:137701745-137701767 AAAGTCTTCAAGAATAATGAAGG + Intergenic
981320178 4:143382785-143382807 AATGTCTGCAAGTAAATACGTGG + Intronic
981838514 4:149083045-149083067 AATGTTTTCTAGAACACAGGTGG - Intergenic
983313377 4:166095068-166095090 ACTGTCTTCTAGAATATGGACGG + Intronic
983966488 4:173819207-173819229 GATGATTTAAAGAATATAGGAGG + Intergenic
984063236 4:175017990-175018012 GATGTCTTCAAGAATATAAAGGG + Intergenic
984337352 4:178409691-178409713 AATGTCTTCATCAAAATTGGGGG - Intergenic
986041760 5:4000553-4000575 AATCTCTTCCAAAAAATAGGTGG + Intergenic
988063779 5:26208024-26208046 AATGTCCTAAAAAATATAGCTGG - Intergenic
988183353 5:27827404-27827426 AATGCCATCAAGAAGGTAGGAGG - Intergenic
989025392 5:37061728-37061750 AATGACTTAAAGCATATGGGAGG - Intronic
993363729 5:87009479-87009501 AATATCTTCAAAAATAAATGGGG - Intergenic
994325285 5:98439551-98439573 AATGTCTTCAAGGAAATGAGAGG - Intergenic
994562201 5:101389267-101389289 AATGTCTTTATGAAAAGAGGAGG - Intergenic
994954903 5:106515826-106515848 AATGATTTAAAGTATATAGGAGG + Intergenic
995755758 5:115502356-115502378 ATTGCCTTCCATAATATAGGTGG + Intergenic
996008881 5:118458119-118458141 AATGACTTGAAGAAAACAGGAGG + Intergenic
996560844 5:124827319-124827341 AAGATCTTCATGAATATTGGTGG + Intergenic
996592151 5:125160290-125160312 AATGTCTTCCAGAAAATACAAGG + Intergenic
997405294 5:133641082-133641104 AATGACTTCATGACTCTAGGAGG - Intergenic
999870785 5:155748254-155748276 AAAATCTTTAAGAATTTAGGAGG - Intergenic
1000061587 5:157661887-157661909 AATCTTTTCAAGAATAGAAGGGG - Intronic
1000582664 5:163053099-163053121 AATGGCTCCAAGAATATACATGG + Intergenic
1002625389 5:180523787-180523809 AATGTCTGCCAGAATCTAGAGGG - Intronic
1004323291 6:14649958-14649980 AAAGTCTTCCATAATCTAGGGGG + Intergenic
1004757043 6:18621632-18621654 AATTTCTTCCATAATATAGAGGG - Intergenic
1005442983 6:25891275-25891297 AAGTTCTCCAAAAATATAGGAGG - Intergenic
1007343749 6:41210908-41210930 AATGTCTTCTATAATATTAGAGG - Intergenic
1008941656 6:57052298-57052320 AATGACCTCAAGTATAGAGGAGG + Intronic
1010621999 6:78088296-78088318 AATATCTTCAATATCATAGGAGG - Intergenic
1011881790 6:92037222-92037244 AATGTTTTGAAGATTAAAGGGGG + Intergenic
1012036631 6:94149879-94149901 AATGTCTATAGGAATATATGTGG + Intergenic
1012661830 6:101907861-101907883 AATGTCTTAAAGGATAAATGAGG - Intronic
1012957470 6:105586833-105586855 AATGTCTTCAGGGTTATAGGAGG - Intergenic
1013655086 6:112238168-112238190 AAACTCTTCAAGGATATAGAAGG - Intronic
1014142777 6:117963620-117963642 AAAATCTTCAAGAATTCAGGGGG - Intronic
1014586607 6:123204884-123204906 AAAGTCTTCCAGAAAATAGAAGG + Intergenic
1015964032 6:138680566-138680588 AATGTCTGCAACAACATAGTTGG - Intronic
1016549326 6:145259205-145259227 AATGCCTTCATGCATATAGTAGG + Intergenic
1017379015 6:153805752-153805774 TATTGCTTCAAGAAAATAGGTGG - Intergenic
1017523058 6:155219082-155219104 ACTAACTTCGAGAATATAGGTGG - Intronic
1018370935 6:163167820-163167842 AATGGCTTCAAGGAGATAGCAGG - Intronic
1019815717 7:3198289-3198311 AATCTCTCCCAGAAAATAGGAGG - Intergenic
1021054601 7:16032291-16032313 AATGCCTTAAAGAAATTAGGAGG + Intergenic
1021109985 7:16682545-16682567 AATTCATTCAAGAATATAGCAGG - Intronic
1021169659 7:17383560-17383582 GATGACTTAAAGAATACAGGAGG + Intergenic
1021272099 7:18602002-18602024 AATCTCTTCCAGAAAATAGGAGG - Intronic
1021399467 7:20193135-20193157 ATTTTCTTCAAGAAAATAAGAGG + Intronic
1022071442 7:26919322-26919344 AATGGCTTCAAGAAGAGAGGAGG + Intronic
1027850477 7:83445413-83445435 GATGTCATCAAGAGTATAGGTGG + Intronic
1028227755 7:88268829-88268851 AATGACTTAAAGGATAAAGGAGG + Intergenic
1029234924 7:99107257-99107279 AATAACTTAAAGAATATAAGTGG + Intronic
1030444119 7:109627304-109627326 AATGCTTTCTAGAATATAAGGGG + Intergenic
1031583929 7:123510519-123510541 TATCTGTTCATGAATATAGGAGG + Intronic
1034709924 7:153182441-153182463 GATGTCTCCAAGAAAAGAGGAGG + Intergenic
1035348292 7:158223274-158223296 AATATCTTCCAGAAAATAGAAGG + Intronic
1037658609 8:20908331-20908353 AATGTCTGAAAGGATAAAGGAGG - Intergenic
1037794323 8:21979038-21979060 AATGTCTTCAGGGATAAAGCTGG + Intronic
1038288798 8:26229974-26229996 AATTTCTTGAAGGATATATGGGG + Intergenic
1038937963 8:32273146-32273168 AATGTGTGCATGAATATATGAGG - Intronic
1039939498 8:42077414-42077436 AATGTCTTCAAGGATATATTTGG - Intergenic
1040299532 8:46180720-46180742 AATGTCTTCATGAATACCTGTGG + Intergenic
1041493933 8:58465463-58465485 AATGTCTTCAAAAATGTAAATGG + Intergenic
1041751327 8:61264237-61264259 AGCGTCTTCAAGCATATAGACGG - Intronic
1042137828 8:65649121-65649143 GATGACTTCAAGTATATGGGAGG + Intronic
1042570547 8:70159131-70159153 AATGATTTAAAGTATATAGGAGG - Intronic
1043587839 8:81790112-81790134 AATTTCTTTAAGAATATTTGTGG - Intergenic
1044398894 8:91746754-91746776 AATGTCTTTAAGACTGTAGGAGG - Intergenic
1045394120 8:101743720-101743742 AATCTCTTCATGAATTTATGAGG + Intronic
1046083662 8:109404176-109404198 AATGTGTTCAAGAAAATGGCAGG - Intronic
1046980010 8:120327055-120327077 AATTTGTTCAAGAACAAAGGTGG - Intronic
1048119278 8:131562100-131562122 AATGGTTTCAAAAATATAGTTGG + Intergenic
1048353296 8:133633245-133633267 ATTGTCTTAGAGAATAAAGGAGG - Intergenic
1048534034 8:135275918-135275940 ACTGTCTTCAACAAAATAGTAGG - Intergenic
1048678933 8:136816915-136816937 AATGTTTTCATTAAAATAGGTGG + Intergenic
1049871756 8:144984662-144984684 ATTGTATTAAAGTATATAGGAGG + Intergenic
1050213226 9:3289269-3289291 AATGTCTTCAAATATATATAAGG - Intronic
1050912939 9:11097518-11097540 AATGACTTAATGAATATAGCAGG - Intergenic
1054834950 9:69667579-69667601 TAAGTCTTCAAGAAGATGGGAGG - Intronic
1055516368 9:77037526-77037548 AATGGCTGCAAGAATTTGGGAGG - Intergenic
1055954024 9:81757253-81757275 AATTTGTTTAAGAATAAAGGAGG + Intergenic
1056666678 9:88586914-88586936 AGTGTCTTCAGGAAGATAGCAGG + Intergenic
1056724465 9:89101866-89101888 AATCTTTTCCAGAATATAGGAGG - Intronic
1057117369 9:92538715-92538737 CATGTCTGCAATAATAAAGGGGG - Intronic
1059216098 9:112564174-112564196 AATATTTTCAAAAATATAGGGGG - Intronic
1203460831 Un_GL000220v1:35135-35157 AATGTCTACAGCAAAATAGGAGG - Intergenic
1186586745 X:10883058-10883080 AATGTTAACAAGAATCTAGGGGG - Intergenic
1188618617 X:32191717-32191739 GATGTTTTAAAGTATATAGGAGG - Intronic
1188657996 X:32722391-32722413 GATGTTTTAAAGTATATAGGGGG + Intronic
1188665919 X:32820823-32820845 AATGTATTTAATAATAAAGGAGG + Intronic
1189005413 X:36988873-36988895 AAAGGGTCCAAGAATATAGGAGG - Intergenic
1189043614 X:37569069-37569091 AAAGGGTCCAAGAATATAGGAGG + Intronic
1189455542 X:41185368-41185390 AATCACTTCAAAAATATAGGGGG - Intronic
1190588645 X:51974346-51974368 AATCTCTTGAACAATATAAGAGG + Intergenic
1193429817 X:81388016-81388038 AATCTCTTCCAGAAGATAGAAGG - Intergenic
1193713319 X:84904917-84904939 AATTTCTTCAAGAATAAAAAAGG - Intergenic
1194993172 X:100567016-100567038 AATGTGTTCAAAAATATATGTGG + Intergenic
1195837436 X:109133133-109133155 AATGTATTCAAGAAAATCTGTGG + Intergenic
1196780517 X:119379617-119379639 AATGTCATCAAGAATAAAATGGG + Intergenic
1197672769 X:129296886-129296908 AATATCTTCCAGACAATAGGAGG + Intergenic
1198347624 X:135774268-135774290 TATGACTTCAAGAATGAAGGAGG + Intergenic
1198349529 X:135791529-135791551 TATGACTTCAAGAATGAAGGAGG + Intergenic
1198351434 X:135808802-135808824 TATGACTTCAAGAATGAAGGAGG + Intergenic
1198353343 X:135826068-135826090 TATGACTTCAAGAATGAAGGAGG + Intergenic
1198355250 X:135843322-135843344 TATGACTTCAAGAATGAAGGAGG + Intergenic
1198357160 X:135860605-135860627 TATGACTTCAAGAATGAAGGAGG + Intergenic
1198359074 X:135877884-135877906 TATGACTTCAAGAATGAAGGAGG + Intergenic
1198366185 X:135942145-135942167 TATGTCTTCAAGAATGAAAGAGG + Intergenic