ID: 1086272213

View in Genome Browser
Species Human (GRCh38)
Location 11:85081233-85081255
Sequence AGACATGGGAATAGTGTGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086272208_1086272213 30 Left 1086272208 11:85081180-85081202 CCATTTATATAACCTGAAAGTCA 0: 1
1: 1
2: 25
3: 75
4: 334
Right 1086272213 11:85081233-85081255 AGACATGGGAATAGTGTGTCCGG 0: 1
1: 0
2: 2
3: 11
4: 160
1086272210_1086272213 5 Left 1086272210 11:85081205-85081227 CCTGCTGAAAAGAGCAATTGAGT 0: 1
1: 0
2: 1
3: 12
4: 159
Right 1086272213 11:85081233-85081255 AGACATGGGAATAGTGTGTCCGG 0: 1
1: 0
2: 2
3: 11
4: 160
1086272209_1086272213 18 Left 1086272209 11:85081192-85081214 CCTGAAAGTCAAACCTGCTGAAA 0: 2
1: 2
2: 18
3: 43
4: 284
Right 1086272213 11:85081233-85081255 AGACATGGGAATAGTGTGTCCGG 0: 1
1: 0
2: 2
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086272213 Original CRISPR AGACATGGGAATAGTGTGTC CGG Intronic
900694302 1:4000484-4000506 AGACATGGGAAGAGAGAGGCTGG - Intergenic
902466782 1:16623604-16623626 TGACATGGGAAAAGCGTGTAAGG - Intergenic
902725873 1:18335547-18335569 ACACATGGGAAAACTGAGTCTGG - Intronic
903227373 1:21901573-21901595 AGGCATGTGAACAATGTGTCTGG - Intronic
903270886 1:22187571-22187593 AGACATGGAAAGAGTGAGTGCGG - Intergenic
903861684 1:26368278-26368300 AGGCATGGGGAGAGGGTGTCTGG + Intronic
904445116 1:30565964-30565986 AGACACAGGAATAGTGTGTCCGG - Intergenic
905449949 1:38049608-38049630 AGACATGGGAAGACGGTTTCAGG - Intergenic
908256010 1:62304302-62304324 GGACATGGGAATGGAGTGCCAGG + Intronic
908511479 1:64853141-64853163 AGACATGAGAATATTGTGTTGGG - Intronic
909594968 1:77396564-77396586 AGACCTGGGAATAGTGAGTAAGG + Intronic
910583719 1:88856172-88856194 AGGCATGAGAATAGCTTGTCCGG + Intronic
912093410 1:106110401-106110423 AGAAATGGGAAAAGTATTTCAGG - Intergenic
914764385 1:150625278-150625300 AGCCTTGGGAATAGTTTGGCAGG - Intronic
915717035 1:157954513-157954535 AGAAATGGCAATAGTTTGTGTGG + Intergenic
917605818 1:176628085-176628107 AAACATGGAAATATGGTGTCTGG - Intronic
919134911 1:193495711-193495733 AGCCATAGGAATAACGTGTCTGG - Intergenic
920959755 1:210653884-210653906 TGACAGTGGAATAGTGTGACGGG + Intronic
920959761 1:210653944-210653966 TGACAGTGGAATAGTGTGACGGG + Intronic
920959765 1:210653972-210653994 TGTGATGGGAATAGTGTGACGGG + Intronic
1062797365 10:354603-354625 ACACATGGGAGCAGCGTGTCAGG + Intronic
1067189048 10:44054488-44054510 AGCTATGGGAAGAGTGGGTCAGG - Intergenic
1067805531 10:49390186-49390208 AGACATCTGGATAGTGTGTTTGG + Exonic
1067920703 10:50454123-50454145 AGAAAGGGGAATAGAGAGTCTGG + Intronic
1068747944 10:60556579-60556601 AGATATGGAAATAGTGGGACTGG - Intronic
1069565638 10:69461671-69461693 AGGCATGGGCACAGTGTGGCTGG + Intronic
1071520734 10:86330193-86330215 CGAGATGGGAATGGTGAGTCTGG - Intronic
1076077004 10:127541786-127541808 AGAAATGGGAACGGAGTGTCAGG - Intergenic
1077439497 11:2561457-2561479 GGGCATGGGAATAGTGTAGCAGG - Intronic
1077918359 11:6625487-6625509 ATACATGAGACTAGTGTGTTTGG + Intronic
1079190793 11:18275228-18275250 TGACTGGGTAATAGTGTGTCCGG + Intergenic
1085245312 11:75096537-75096559 AGAAATGGGAATAATTTGTGAGG - Intergenic
1086272213 11:85081233-85081255 AGACATGGGAATAGTGTGTCCGG + Intronic
1087015320 11:93549082-93549104 AGGCAGGGGAATAGAGTCTCAGG - Intergenic
1090728694 11:129551191-129551213 AGACACTGGAAGAGTGAGTCAGG - Intergenic
1091776010 12:3185455-3185477 AGCCATGGGGAAAGTGAGTCAGG - Intronic
1092500995 12:9047243-9047265 AGACATGTGAAAGGTGTGACAGG + Intergenic
1095226820 12:39687162-39687184 AGAAATTGGAAGAGTGTGGCAGG - Intronic
1097183117 12:57182213-57182235 AGACATGGGAAAACTGGGCCAGG + Intronic
1097758068 12:63428386-63428408 AGACGTGGGAATAGTTTGAAGGG - Intergenic
1098613133 12:72486114-72486136 AGACATGTCAATACTGTGCCTGG + Intronic
1098824106 12:75271329-75271351 AGAAAAGGGAAGAGTGTTTCTGG - Intergenic
1099885082 12:88519231-88519253 AGAGAAGGGACTAGTGTGACAGG + Intronic
1102330053 12:112021293-112021315 AGATTTGGGAAGAGTGTCTCAGG - Intronic
1103772623 12:123339836-123339858 AGAAGTGGGAATAGTAGGTCTGG - Intronic
1103878779 12:124149920-124149942 ACAGATGTGAATTGTGTGTCCGG + Intronic
1103889205 12:124225777-124225799 AGACATGGAAATAAACTGTCTGG + Intronic
1107296115 13:38909639-38909661 TTACATGGGTATATTGTGTCAGG - Intergenic
1107689609 13:42939548-42939570 AGACAGGGGAATAGCCAGTCAGG + Intronic
1108852335 13:54747492-54747514 AGAAATTGGATTAGTTTGTCAGG + Intergenic
1108975452 13:56438520-56438542 AGCCATGGGGATAGAGTTTCTGG - Intergenic
1111655922 13:91152982-91153004 AGACATGGGAACAGAGAGTCAGG + Intergenic
1112728965 13:102338063-102338085 AAACATGGTAATATTTTGTCTGG + Intronic
1114181546 14:20372245-20372267 AGAGAAGGGAACAGTGTTTCAGG - Intronic
1114750284 14:25196969-25196991 AGAAATAGGAATCTTGTGTCTGG - Intergenic
1116663254 14:47739908-47739930 TGACATGGGAAAAATGTGTGAGG - Intergenic
1117236955 14:53787981-53788003 AGACTTGGGACTGGTGTCTCAGG + Intergenic
1117783059 14:59254861-59254883 AGAGTTGGGCATAGTGTTTCTGG + Intronic
1118229435 14:63933973-63933995 AAACGTGAGAAAAGTGTGTCAGG + Intronic
1120361193 14:83505015-83505037 AGAAATGGAAATATTGTGCCTGG + Intergenic
1120470618 14:84919129-84919151 AGACATGGGATCACTGGGTCAGG - Intergenic
1122444273 14:101757884-101757906 AGACATGGAAAAAGTATGTTTGG + Intergenic
1132679424 16:1133647-1133669 AGACACGGGAACCGTGTGCCTGG - Intergenic
1133172864 16:3992619-3992641 AGACATGGGAAGAGTCGGTGCGG + Intronic
1133516616 16:6515507-6515529 AGACATGGGAACAATGTAACTGG - Intronic
1134239758 16:12496861-12496883 AGACAAGGGAAGAGCGTTTCAGG + Intronic
1134612633 16:15622163-15622185 ACACATGGGAAGAGTGTTTGGGG + Intronic
1138148124 16:54630319-54630341 ACACATGGGAAGACTGTGGCAGG - Intergenic
1138496160 16:57410638-57410660 AGACTTCAGAATAGTTTGTCTGG + Intronic
1140424705 16:74851188-74851210 AGAAATGGGAAATGGGTGTCGGG - Intergenic
1140811404 16:78582216-78582238 ATACATGGCCAAAGTGTGTCAGG + Intronic
1144643614 17:16953488-16953510 AGGCATGGGCATTGGGTGTCGGG - Intronic
1144743591 17:17598248-17598270 AGAGAAGGGAAGAGTGTGCCTGG - Intergenic
1151766435 17:76135703-76135725 AGGCATGGGAAATTTGTGTCTGG - Intergenic
1156397553 18:36712298-36712320 AGACATTGGAATTATGTGACGGG + Intronic
1157313403 18:46569271-46569293 ACACTTGGGAATAGTGAGTGAGG - Intronic
1161257272 19:3316385-3316407 AGAAATGGGAATAGAGTTCCAGG + Intergenic
1161946019 19:7437579-7437601 AGACAAGGCAATGGTGTATCGGG + Intronic
1162826385 19:13254928-13254950 AGTGGTGGGAACAGTGTGTCAGG + Intronic
1162963436 19:14142912-14142934 TGAAATGTGACTAGTGTGTCTGG - Intergenic
1164037630 19:21468175-21468197 AGACATGTGAATGGTGTATGTGG + Intronic
1165470830 19:36003578-36003600 AGAGATGGGACTAGGGTGTGGGG - Intronic
1165817032 19:38648553-38648575 AGACATGGGCTTAGGGTGTGAGG + Intronic
1168171296 19:54591658-54591680 GGACTTGGGAATGGTGTGTGGGG - Intronic
925575742 2:5358083-5358105 ATAGATGGGGATAGTGTGTTTGG - Intergenic
926732134 2:16043605-16043627 AGACATGGGAATATCCTGTGTGG + Intergenic
926781221 2:16473918-16473940 AGCCATGGGAATAGTGTGTATGG + Intergenic
927356504 2:22179301-22179323 ATGCTTGGGAAGAGTGTGTCTGG - Intergenic
932105587 2:68938244-68938266 AGACATGGAAAGAGAGTGTGTGG + Intergenic
933982220 2:87560122-87560144 AGGCATGGAAACAGTGAGTCTGG - Intergenic
935360549 2:102243215-102243237 AGACAGGGGACTAGTGGGGCTGG - Intergenic
936311618 2:111390688-111390710 AGGCATGGAAACAGTGAGTCTGG + Intergenic
937260906 2:120586414-120586436 AGTCAGGGGAACAGTGTCTCAGG - Intergenic
937821097 2:126312037-126312059 AGACAAAGGGATAGTATGTCTGG - Intergenic
939650030 2:144748379-144748401 ATTCATGGGAAGTGTGTGTCAGG + Intergenic
941447634 2:165622643-165622665 AGAAATGGGAACATGGTGTCAGG - Intronic
943029480 2:182669199-182669221 AGTCCTGTAAATAGTGTGTCTGG - Intergenic
944384666 2:199151170-199151192 AGACATGGGTATAGGCTGTGTGG - Intergenic
945968525 2:216213657-216213679 AGACACAAGAAGAGTGTGTCTGG + Intergenic
946344701 2:219099771-219099793 AGACATGGGAAAAGTCTTTAGGG + Intronic
1169061639 20:2664596-2664618 AGACATGGGAGGTGTGTGTCGGG + Intergenic
1170316292 20:15044481-15044503 AAAGATGGGAAGAGTGGGTCTGG - Intronic
1170637653 20:18122460-18122482 AGACATGGCAAAAGTGTGGCCGG - Intergenic
1174107454 20:48172680-48172702 AGACATGTGAAGAGTGGGGCTGG - Intergenic
1180138466 21:45876403-45876425 AGACATGAGACCAGTGTGGCTGG + Intronic
1184943029 22:47782664-47782686 GGACAGGGGAAGAGTGTGTGGGG + Intergenic
949807911 3:7975558-7975580 AGACATGAGAATGGTTTGGCAGG - Intergenic
952688636 3:36177666-36177688 AGAGATGTGAATAGTGTGACAGG - Intergenic
956145592 3:66187991-66188013 AGACATGGTAATAGTGAGGAGGG - Intronic
957452472 3:80397686-80397708 AGACCTGGGACTTGTGTGGCAGG - Intergenic
960433930 3:117602487-117602509 AGGCATGGGTGTTGTGTGTCGGG + Intergenic
962122274 3:132574421-132574443 ACACCTGGGAATAATTTGTCAGG - Intronic
962385440 3:134928882-134928904 AGCCAGGGGAAGAGTGTGTCAGG + Intronic
962697151 3:137961439-137961461 AGACATGACAATTGTGTGTGTGG - Intergenic
966035924 3:175414155-175414177 AGACACGGGAACAGTATGCCTGG + Intronic
969136620 4:5034399-5034421 AGGCAGGGGAACTGTGTGTCCGG - Intergenic
970371064 4:15407146-15407168 GGGCATGGAAAAAGTGTGTCAGG + Intronic
970660257 4:18277376-18277398 AGACATGGGCACAGTGTTGCTGG + Intergenic
971132638 4:23830053-23830075 AGACATGGGAGTGGAGTGTGGGG + Intronic
972173098 4:36371188-36371210 AGATATAGGAAGAGTGTATCTGG + Intergenic
972221939 4:36966090-36966112 AGTCAAGGGAATAGTGTTTCAGG - Intergenic
975069057 4:70110045-70110067 AGACATAGTAATAGTGTTTGTGG - Intergenic
976573495 4:86640050-86640072 AGACAGGGGAAGAGTGTTTGGGG + Intronic
977727685 4:100316190-100316212 AGTCAAGGGAATACTGTGTGTGG + Intergenic
978897158 4:113902957-113902979 AAACAAGGGAACAGTGTGTAAGG - Exonic
978903876 4:113983866-113983888 AGAAATGGGAATGGTGTGGCAGG - Intergenic
980451589 4:132980491-132980513 AATCATGGGAATAGCATGTCCGG + Intergenic
983899709 4:173120743-173120765 AGACATGGGAAATGTGACTCTGG + Intergenic
985031587 4:185795848-185795870 AGACATGGAAAAAGTGTTTTGGG - Intronic
990635785 5:57724727-57724749 AGATATGGGAATAATGTGGATGG - Intergenic
993532399 5:89040778-89040800 AGAGAAGGGAAGAGAGTGTCTGG + Intergenic
993647705 5:90479772-90479794 AGACATGACTATAGTGAGTCAGG + Intronic
995004935 5:107181037-107181059 AGACATGAGAATACTGGGCCAGG - Intergenic
995785942 5:115827743-115827765 AGACTTGGGAAAAGTGGGGCAGG + Intergenic
999534841 5:152504906-152504928 AGACATGGGAGTAGTTTTTGTGG + Intergenic
1001501949 5:172243929-172243951 AGACATGGGAAGAATGACTCCGG + Intronic
1003676035 6:8205189-8205211 AGACAGGGGAATAACGTGACTGG - Intergenic
1004165988 6:13256879-13256901 AGAGATTGGAAGAGTGTGTAGGG - Intronic
1005605649 6:27474192-27474214 AAACATGGGAATATTATCTCCGG - Intergenic
1012677288 6:102132652-102132674 GGATATGGCAATAGTGTGTTAGG - Intergenic
1014659094 6:124144986-124145008 TGACATCGGAATATTGTCTCTGG - Intronic
1015891097 6:137970425-137970447 AGACATGGGAACGGGGTGTGTGG + Intergenic
1017642183 6:156505105-156505127 AGACATGAGACCTGTGTGTCAGG - Intergenic
1018684947 6:166297062-166297084 AGACCTGGGAATAGGCTGGCTGG - Intergenic
1021093025 7:16505063-16505085 AGACACTGGAATGGAGTGTCTGG - Intronic
1022925513 7:35052546-35052568 AGACATTGGCAGTGTGTGTCAGG + Intergenic
1023361461 7:39420477-39420499 AGAAATGGGAATAGTATCTATGG + Intronic
1028127055 7:87125605-87125627 AGACATTGGAAAACTGGGTCTGG - Intergenic
1029823522 7:103167243-103167265 AGACATTGGCAGTGTGTGTCAGG + Intergenic
1030687606 7:112503094-112503116 AGAGGAGGGAATAGTGTTTCAGG + Intergenic
1031396472 7:121280283-121280305 AGACAGGGGAATTTAGTGTCTGG + Intronic
1032234942 7:130112662-130112684 AACCATGGGAATTGTCTGTCTGG - Intronic
1038680333 8:29661227-29661249 AGACATGGAAATTTTGTTTCAGG + Intergenic
1039045738 8:33447580-33447602 AAATATGCGAATACTGTGTCTGG - Intronic
1041913011 8:63109560-63109582 AGTCATGGTAACAGTGTATCAGG + Intergenic
1042111823 8:65389137-65389159 GGACTTGGGAATGGTGTGTGGGG + Intergenic
1042593193 8:70418126-70418148 AGACCTGTGAATAGTGGGTATGG + Intergenic
1043098858 8:76013765-76013787 AGAGATGGGAAAACAGTGTCTGG + Intergenic
1043342467 8:79256680-79256702 AGACAAGGGAATAAAGTCTCTGG + Intergenic
1044137721 8:88608684-88608706 ACACATGGGACTAAGGTGTCAGG - Intergenic
1044768917 8:95608581-95608603 TGAAATGTGGATAGTGTGTCTGG + Intergenic
1047325154 8:123828915-123828937 ATACATGGAAAAAGTGTGCCTGG + Intergenic
1048361181 8:133698211-133698233 AGAAATTGGAATGATGTGTCTGG - Intergenic
1053289757 9:36872159-36872181 AGACATGGGAGCAGTGTGTAAGG + Intronic
1056300233 9:85232735-85232757 AGATAAGGGAATAGAGTGTGAGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1058214124 9:102212007-102212029 AGACAAGGCAATAGTGTTTTTGG - Intergenic
1059286577 9:113177766-113177788 AGACATGGGACTAGTGGGCAGGG - Intronic
1059612286 9:115911554-115911576 AGAGATGGGAATACTGAGTGAGG - Intergenic
1186703420 X:12116196-12116218 AGAGCTGGGAATAGTGAGACTGG - Intergenic
1188398397 X:29714949-29714971 AGACATGTGGTCAGTGTGTCTGG - Intronic
1191592020 X:62896939-62896961 AGACATGGGCACAGTGTTTCAGG + Intergenic
1195993356 X:110706060-110706082 AGACCTGGGTACAGTCTGTCTGG + Intronic
1198835830 X:140804061-140804083 AGACATTGGGATAGTGTTTATGG - Intergenic