ID: 1086273114

View in Genome Browser
Species Human (GRCh38)
Location 11:85092268-85092290
Sequence TTGGGATTATGACCAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086273114 Original CRISPR TTGGGATTATGACCAAAACC TGG (reversed) Intronic
903581442 1:24373742-24373764 TTGGGTTTTTGACATAAACCCGG + Exonic
904658394 1:32066578-32066600 TTGGGACTGTGGCCAAAAGCTGG - Intergenic
905447533 1:38036792-38036814 TTGGGATTAGGCCCAGAGCCAGG + Intergenic
905491610 1:38348663-38348685 CTTGGATTATCACCAAAACCAGG - Intergenic
909607563 1:77522334-77522356 ATGGGACTGTGACCAAATCCAGG - Intronic
912914232 1:113796185-113796207 TTGGCCTTATTACCACAACCAGG - Intronic
916347098 1:163805805-163805827 TTGGCATTATTACCTAAAGCAGG + Intergenic
920636158 1:207705753-207705775 TTGAGCTTATGACAAAAAACAGG + Intronic
1063026773 10:2186818-2186840 TTGGTATTAGGATGAAAACCAGG + Intergenic
1063744060 10:8859315-8859337 TGGGAATTATGTCCAAACCCAGG + Intergenic
1064072392 10:12241993-12242015 TTGAGATTATGAGAAAGACCGGG - Intronic
1065846824 10:29751389-29751411 ATAGTACTATGACCAAAACCAGG - Intergenic
1069030391 10:63589725-63589747 TTGGGATTTTGACCCATACTGGG + Intronic
1069293991 10:66820808-66820830 TTCTGATTATGACCAAAATAAGG + Intronic
1072079094 10:92010647-92010669 TTGGGAGCATGACCCAAACAAGG - Intronic
1072644711 10:97244211-97244233 TTGGGGTTCTTACAAAAACCTGG + Intronic
1077700509 11:4437119-4437141 ATGGGAGAATGACCAAAACTCGG - Intergenic
1080684356 11:34503131-34503153 TTGGGATAATGAACAAATTCTGG - Intronic
1080690575 11:34554408-34554430 ATGGGATTAGGACTAAAAGCAGG - Intergenic
1081534224 11:43985591-43985613 ATGGGGTTATGAGCAAAATCCGG + Intergenic
1086273114 11:85092268-85092290 TTGGGATTATGACCAAAACCTGG - Intronic
1087375242 11:97331691-97331713 TTGCGATAATGACCAAAACCAGG + Intergenic
1088974361 11:114802440-114802462 ATGGGCTTGTGACCCAAACCCGG - Intergenic
1089569173 11:119391416-119391438 CTGGGAGAATGACCAAAAGCGGG - Intergenic
1092478523 12:8839454-8839476 TGGGAACTATGACCAAATCCAGG + Intronic
1094387103 12:29907088-29907110 TTGGGATTATGCTCACTACCTGG + Intergenic
1098940837 12:76533277-76533299 TTATGATTATTATCAAAACCTGG - Intronic
1099143586 12:79011006-79011028 TTGGCATAATGACCTAAATCTGG - Intronic
1100429092 12:94514368-94514390 GTGGAATTATGACCAAGACTGGG + Intergenic
1107718606 13:43225306-43225328 TAGGGATTATGCCCATTACCAGG + Intronic
1110629830 13:77696163-77696185 TTTTGGTTATTACCAAAACCTGG - Intergenic
1111355660 13:87098748-87098770 TTGGGAAAATGACCAAAACAAGG + Intergenic
1111629208 13:90827414-90827436 TTGGGATGGTGATGAAAACCAGG - Intergenic
1117222908 14:53623906-53623928 TTGGAGTTAAGACCAAAACTGGG + Intergenic
1119087533 14:71751714-71751736 TTGGGATTATGGGCATGACCTGG + Intergenic
1120284206 14:82476953-82476975 TTGGGAGAATTACCAGAACCTGG - Intergenic
1120712776 14:87809988-87810010 TTGTGATTATGGCAAGAACCTGG - Intergenic
1121126690 14:91412075-91412097 TTTGGAATATGACCAAAAGTTGG - Intronic
1128615707 15:69107366-69107388 TTGGTATTCTGAACAAAACAGGG + Intergenic
1137540982 16:49361469-49361491 GTGGGATTATTACCTAATCCAGG + Intergenic
1155614572 18:27706373-27706395 TTGGGAGTATGCCCACCACCTGG - Intergenic
1156265351 18:35482961-35482983 TTGGGATTAGGAACAAATTCAGG + Intronic
1156783476 18:40880792-40880814 TTGGGCTTCTGTCCAAAAACAGG + Intergenic
1157999549 18:52600263-52600285 TTGGAATTGTGAGGAAAACCTGG - Intronic
1158195022 18:54875230-54875252 TTGGGAGGATCACCTAAACCAGG + Intronic
1158550505 18:58431579-58431601 TTGGGAGCATGACCAGAAGCAGG - Intergenic
1159105671 18:64000304-64000326 GCGGGATTATGACAATAACCCGG - Intronic
1159479186 18:68965893-68965915 TTTGGACTTTTACCAAAACCTGG - Intronic
1159670660 18:71216968-71216990 TTGGTTTTATGATTAAAACCAGG - Intergenic
1160080267 18:75719958-75719980 TTTGGATCATGACCAAATCCTGG + Intergenic
1160279861 18:77478867-77478889 TGGGGATTATTGCCAAAAGCGGG - Intergenic
1161282907 19:3455309-3455331 ATGGGATTATGCCCAGAGCCTGG + Intronic
1161282931 19:3455467-3455489 GTGGGATTATGCCCAGAGCCTGG + Intronic
1161282943 19:3455546-3455568 GTGGGATTATGCCCAGAGCCTGG + Intronic
1161282964 19:3455704-3455726 GTGGGATTATGCCCAGAGCCTGG + Intronic
1167278925 19:48554952-48554974 TAGGGATGATGAGCAAGACCAGG + Intronic
925373940 2:3368299-3368321 TTCGGTTTACCACCAAAACCAGG - Intronic
929375453 2:41281596-41281618 TTGGGATTATGATCCAAAACCGG + Intergenic
930895703 2:56443082-56443104 TTTGGATTCTGACAAAAACTGGG - Intergenic
936377631 2:111955638-111955660 ATGGTATAATGATCAAAACCAGG - Intronic
938999393 2:136716427-136716449 TAGGTATTATGCCCAATACCTGG + Intergenic
941322880 2:164077252-164077274 CTGGGATCATGAACAATACCTGG - Intergenic
942305623 2:174604834-174604856 TTGGGATTATGATCCAGATCTGG + Intronic
943803789 2:192095888-192095910 TAGGGATTATGTCAAAAACTAGG - Intronic
943916321 2:193638078-193638100 ATGGAATGATTACCAAAACCAGG + Intergenic
946181163 2:217949853-217949875 TTGGGGTAATGTCCAAAACAAGG + Intronic
1170447842 20:16448085-16448107 TTGGGATGATGACCTAGCCCAGG - Intronic
1172303165 20:33863683-33863705 TTGGCAGTATGACAAAAACATGG - Intergenic
1175483572 20:59328635-59328657 TATGGATTATGAGGAAAACCGGG + Intergenic
1178047144 21:28708450-28708472 CTGGGATTATAACCATACCCTGG - Intergenic
1178599284 21:33982120-33982142 TTGGGATGATGAGCAAATTCTGG - Intergenic
1181993107 22:26852767-26852789 GTGGGAATATGACCTAAAACTGG - Intergenic
1183664289 22:39238440-39238462 GTGGTATTATTACCAAATCCGGG - Intronic
949412768 3:3783849-3783871 TTGGGATCATCCCCTAAACCAGG - Intronic
952056769 3:29456569-29456591 GTGGGATTATGAACAATATCAGG + Intronic
952903290 3:38123396-38123418 TTGGGATTATGATCGATCCCTGG - Exonic
953629933 3:44605496-44605518 TTGGGCATATGCCCAAAACAAGG + Intronic
956002538 3:64744792-64744814 TTAGGATAAAGACCAAAACATGG + Intergenic
959103123 3:102036344-102036366 TTGGAATTATGACCAAATCAAGG - Intergenic
960507365 3:118510132-118510154 TTTTAATTATAACCAAAACCAGG + Intergenic
961068105 3:123893177-123893199 TTGGGATTATGACAAAAGTCTGG - Intergenic
962380953 3:134897778-134897800 TTGGGCTGATGTCCACAACCAGG - Intronic
966677015 3:182600529-182600551 ATGGTATCATGACTAAAACCAGG - Intergenic
969106546 4:4810968-4810990 TTGGGATTATGAGGAAGCCCAGG - Intergenic
969918911 4:10518569-10518591 TTTGGAATATAACCAAAACTGGG + Intronic
969948072 4:10805320-10805342 TTTGGATTTGGACCAAGACCAGG + Intergenic
974953781 4:68614583-68614605 TGGGGACTTTGACCAAAACTAGG + Intronic
975913898 4:79299758-79299780 TTAGGATTGTGACCTTAACCTGG + Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
978371899 4:108037326-108037348 TTGAGATTAAGAAGAAAACCAGG + Intergenic
981419596 4:144534181-144534203 TTGGGATTATGACCTAGACTAGG - Intergenic
984305180 4:177980128-177980150 TTGGGATAATGAAAAAGACCTGG - Intronic
986995837 5:13606189-13606211 TTGTGATTATGATAAAGACCAGG + Intergenic
987817290 5:22919188-22919210 TGGGAAGTATGGCCAAAACCTGG - Intergenic
988709397 5:33758407-33758429 TTGGCATAATGAACAAAAGCAGG + Intronic
992348652 5:75907057-75907079 TTGGGCACATGACCAAAACTTGG - Intergenic
992841924 5:80703880-80703902 CTGAGATTATGAACAAAATCAGG - Intronic
994308953 5:98243641-98243663 TTGGAATAATTATCAAAACCAGG - Intergenic
995594697 5:113735174-113735196 TTCTGTTTATGACCAAACCCAGG - Intergenic
1004337825 6:14780716-14780738 CTTTGATTATGAGCAAAACCAGG - Intergenic
1004683011 6:17915016-17915038 TTGGAAATAAAACCAAAACCAGG - Intronic
1006108746 6:31731792-31731814 TTGAGACTATGACAAAAACATGG + Intronic
1006819928 6:36885037-36885059 TTGAGAAAATGACCAAAACGGGG + Intronic
1008029811 6:46681941-46681963 TTGGGATGATGAAAAAAATCTGG + Intergenic
1008916704 6:56795660-56795682 TGGGGACTTTGACCAAATCCTGG - Intronic
1012607508 6:101176029-101176051 TTGGAATTAGGACCAAAACAAGG + Intergenic
1013086249 6:106860312-106860334 ATGGGACTCTGTCCAAAACCAGG + Intergenic
1013210271 6:107980722-107980744 TTGGGATTAAAACCAACAGCAGG + Intergenic
1015752568 6:136575116-136575138 TTGGCACTATTATCAAAACCAGG + Intronic
1025161217 7:56662882-56662904 TTGGGATTGTGACATATACCTGG + Intergenic
1025745883 7:64242391-64242413 TTGGGATTGTAACAAAAGCCTGG - Intronic
1027168854 7:75855591-75855613 TTGTGGTTATGACCAAATCAAGG - Intronic
1028768923 7:94593098-94593120 TTGTCATTGTGACCAAAAGCAGG + Intronic
1033962968 7:146936521-146936543 TTGAGAAAATGACCAAAAGCGGG + Intronic
1038204116 8:25448423-25448445 TTGGGATGATGACCAAGTACTGG + Intronic
1038851920 8:31287325-31287347 TTGTGACTATTACCAAGACCAGG + Intergenic
1040928679 8:52712742-52712764 TTGTGATTGTGTTCAAAACCTGG - Intronic
1042605911 8:70546478-70546500 TTGGGATTGTTACCAAAACTTGG - Intergenic
1043668497 8:82849230-82849252 TTGGGATTATGAAAAAATTCTGG + Intergenic
1046946585 8:119979723-119979745 CTGCCAATATGACCAAAACCTGG - Intronic
1047531301 8:125679360-125679382 TTAGGATGATGAGCAAAAGCTGG + Intergenic
1049225609 8:141449169-141449191 CTGGGCTTATGAGGAAAACCAGG + Intergenic
1052157018 9:25204482-25204504 TTGAGAAAATGACCAAAAGCTGG + Intergenic
1054801760 9:69356823-69356845 TTAGGAATATGACCAAGACCAGG - Intronic
1056481830 9:87013552-87013574 TTGGTATTGAGCCCAAAACCAGG + Intergenic
1057384973 9:94598965-94598987 TTGGGATTATGACTATAATTGGG - Intergenic
1061342158 9:129991197-129991219 TAGGGTTTTTGACCTAAACCAGG + Intronic
1186093724 X:6077785-6077807 TTTGGCTTATGACCAAAACCAGG + Intronic
1188803166 X:34556532-34556554 TTGAGAAGATGACCAAAAGCGGG + Intergenic
1191086027 X:56568239-56568261 TTGTGATTATGTCAAATACCTGG - Intergenic
1191961450 X:66707293-66707315 TAGGGATTAAGACTAAAAACTGG - Intergenic
1192433173 X:71126121-71126143 TTCACATTATGACCAACACCAGG + Exonic
1192627886 X:72749218-72749240 TTGGGAGTATGACTATAACTTGG + Intergenic
1192653822 X:72971591-72971613 TTGGGAGTATGACTATAACTTGG - Intergenic
1193131013 X:77919870-77919892 TTGGGATGATGAAAAAAATCTGG - Intronic
1193312567 X:80025084-80025106 TTGGGAATAAGAGCAAAACTGGG + Intronic
1193539113 X:82749403-82749425 TTAGGATTAAGATAAAAACCAGG + Intergenic
1201504485 Y:14682505-14682527 TTTGGCTTATGGCCAACACCAGG - Intronic
1201675819 Y:16583070-16583092 ATGGGATCATGTCCAAATCCAGG + Intergenic