ID: 1086278059

View in Genome Browser
Species Human (GRCh38)
Location 11:85155624-85155646
Sequence CTTTAGAAGGCCAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71271
Summary {0: 2, 1: 25, 2: 524, 3: 8118, 4: 62602}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086278054_1086278059 11 Left 1086278054 11:85155590-85155612 CCAGGCACAATGTCTCACACCTG 0: 7
1: 378
2: 7836
3: 30873
4: 79347
Right 1086278059 11:85155624-85155646 CTTTAGAAGGCCAAGGAGGATGG 0: 2
1: 25
2: 524
3: 8118
4: 62602
1086278053_1086278059 23 Left 1086278053 11:85155578-85155600 CCTCACTTTAGGCCAGGCACAAT 0: 1
1: 0
2: 3
3: 42
4: 240
Right 1086278059 11:85155624-85155646 CTTTAGAAGGCCAAGGAGGATGG 0: 2
1: 25
2: 524
3: 8118
4: 62602
1086278055_1086278059 -8 Left 1086278055 11:85155609-85155631 CCTGTAATCTCAGTACTTTAGAA 0: 7
1: 105
2: 3169
3: 48750
4: 355113
Right 1086278059 11:85155624-85155646 CTTTAGAAGGCCAAGGAGGATGG 0: 2
1: 25
2: 524
3: 8118
4: 62602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086278059 Original CRISPR CTTTAGAAGGCCAAGGAGGA TGG Intronic
Too many off-targets to display for this crispr