ID: 1086278698

View in Genome Browser
Species Human (GRCh38)
Location 11:85161084-85161106
Sequence CTGGGGAAGGGGTATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1262
Summary {0: 1, 1: 23, 2: 131, 3: 275, 4: 832}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086278698 Original CRISPR CTGGGGAAGGGGTATGTGGA TGG Intronic
900662302 1:3790798-3790820 CTGGGGAATGGCTGTGGGGATGG + Intronic
900915620 1:5636133-5636155 CGGGGGAGGGGAGATGTGGAGGG - Intergenic
901207985 1:7508239-7508261 CTGTGACAGGGGTCTGTGGAGGG - Intronic
901244171 1:7715590-7715612 CTGTGAAAGGGGGATGTGGCTGG - Intronic
901727516 1:11253629-11253651 ATGGGGAGGGGGTGAGTGGAGGG - Intronic
901903831 1:12391018-12391040 TTTGGGAATAGGTATGTGGATGG - Intronic
902044881 1:13516798-13516820 CTGGGGGTGGGGGATGGGGAAGG - Intergenic
902253379 1:15171109-15171131 CTGGGGGTGGGGGATGTGGCGGG - Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902570208 1:17342273-17342295 CAGGGGAGGGGGTAAGGGGAAGG - Intronic
902630210 1:17700381-17700403 CTGGAGAAGGGGGATGGGAAGGG + Intergenic
902654784 1:17859723-17859745 CTGGGGAGTGGGGATTTGGAGGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902813722 1:18904210-18904232 TTGGGGGAGGGGTAGGAGGACGG - Intronic
903768011 1:25747133-25747155 GTGGGGAATGGCTTTGTGGAGGG + Intronic
903829210 1:26164658-26164680 CTGGGAAAGGGGTCTGGGGTGGG + Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904043877 1:27599160-27599182 CTGTGGTAGGGCTGTGTGGAGGG - Intronic
904179400 1:28655314-28655336 TTGGGAAAGAGGTATGTGGATGG - Intergenic
904336024 1:29798644-29798666 TTGGGGAAGAGATATGTGGATGG + Intergenic
904433475 1:30479603-30479625 CTGGGGAAGGGGTGGAGGGAAGG - Intergenic
904710062 1:32423528-32423550 GTGGGGAAGGGGTATAAGGCTGG + Intergenic
904749314 1:32731155-32731177 GTGGGAAAGGGGTATGTGATGGG + Intergenic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905256528 1:36688710-36688732 AAGGGGAAGGGGTATGGGAAGGG + Intergenic
905256651 1:36689044-36689066 AAGGGGAAGGGGTATGGGAAGGG + Intergenic
905343567 1:37295797-37295819 CTGGGGAAGTAGTAAGTGGGAGG + Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905354162 1:37369438-37369460 CTGAGGAAGAGGTATATGGATGG + Intergenic
905465315 1:38148759-38148781 TTGGGGACGAGGTATGTGGATGG + Intergenic
905743251 1:40390548-40390570 TTGAGGAAGGGGAGTGTGGATGG + Intronic
905786542 1:40762495-40762517 CTGGGGCAGGTGAATTTGGAGGG - Intronic
905818222 1:40968530-40968552 TTGGGGAAGTGGTAATTGGAAGG + Intergenic
905914996 1:41678544-41678566 CTGGGGAAGAGGTGTGTGGGTGG - Intronic
906012999 1:42547158-42547180 ATGGGGAAGGGGTATGATAATGG + Intronic
906130216 1:43451374-43451396 CTGGGGAAGGGAGCTCTGGAGGG - Exonic
906515100 1:46434200-46434222 TAAGAGAAGGGGTATGTGGATGG - Intergenic
906643972 1:47459641-47459663 CTGGGGAGGGGGTATGCGATGGG + Intergenic
906702462 1:47869878-47869900 CTATGGAAGGGGTATGAGGGTGG + Intronic
906792150 1:48668483-48668505 CTGGGGCTGGGGCCTGTGGAAGG - Intronic
906879752 1:49577110-49577132 TTGGGGACAAGGTATGTGGATGG + Intronic
906930831 1:50167853-50167875 TTTGGGGAGAGGTATGTGGATGG - Intronic
907239765 1:53074924-53074946 CTGGGGAAGGCATACCTGGAGGG + Intronic
907467862 1:54651441-54651463 CTGGGGAAGGGGAGTGGAGATGG + Intronic
907597435 1:55732779-55732801 TTGGGGAAGAGGTATGTGGATGG + Intergenic
908077436 1:60535819-60535841 CTGGAATAGGGGCATGTGGATGG + Intergenic
908192679 1:61719454-61719476 CTGGGTAAAGGGTATATGGATGG + Intronic
908737472 1:67291469-67291491 TTGGGGAAGAGGTATGTGGATGG + Intergenic
908870091 1:68600292-68600314 TTGGGAAAGGGGTCTGTGTAGGG + Intergenic
909048929 1:70745413-70745435 CTGGGGTTGGGGGAGGTGGAGGG + Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
909548859 1:76876527-76876549 TTAAGGAAGAGGTATGTGGATGG - Intronic
909577018 1:77186514-77186536 TTGGGGAAGAGGTATGTGGATGG + Intronic
909899020 1:81109589-81109611 CTGGGGAAGGGGTGAATGAAGGG - Intergenic
910355094 1:86344176-86344198 CTGGGAAAGGGTTGTGGGGAGGG - Intergenic
910370724 1:86512787-86512809 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910478536 1:87634228-87634250 CTGGGGAATGGGTGGGGGGAGGG + Intergenic
910561984 1:88600626-88600648 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
910588302 1:88902380-88902402 TTGGGGAAGAGGTATGTTGATGG + Intergenic
910630307 1:89346922-89346944 TGGGGGAACAGGTATGTGGATGG + Intergenic
910638896 1:89439318-89439340 ATGGGGAAGAGGTATATGGATGG - Intergenic
910673424 1:89795602-89795624 GTGGGGTAGGGGTATGGGGGAGG - Intronic
910790422 1:91044399-91044421 TTGGGGAAGAGGCATGTGGATGG + Intergenic
910831010 1:91462765-91462787 TTGGGGAAGAGGCATGTGGATGG - Intergenic
910948303 1:92617366-92617388 TTGGAGAAGAGGTATGTGGATGG + Intronic
911109082 1:94164048-94164070 TTGAGGAAGAGGAATGTGGATGG - Intronic
911257247 1:95646706-95646728 TTGGGGAAGAGGTATGTGGATGG - Intergenic
911728481 1:101267127-101267149 TGGGGGAAGGGGTGTATGGACGG - Intergenic
911738306 1:101361275-101361297 CTGGGGAAGAGGTATGTGGCTGG - Intergenic
911883663 1:103271119-103271141 TTGAGGAAGAGGCATGTGGATGG + Intergenic
911980513 1:104560074-104560096 CTGGGGAAGAGGTATGCAGATGG + Intergenic
912067108 1:105757612-105757634 TTGGGGAAGAAGTATGTGGTTGG + Intergenic
912129823 1:106587400-106587422 GTAGGGAAGAGGTATGTGGATGG - Intergenic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912251940 1:108020730-108020752 CTGGGAAAGAGGTATGTGGATGG - Intergenic
912385384 1:109268782-109268804 GTTGGGGAGGGGTTTGTGGAGGG + Intronic
913039356 1:115007742-115007764 TTGGGGAAGAGGTATATGGATGG - Intergenic
913169188 1:116216969-116216991 GTGGGAATGGGGTATGTGCAAGG + Intergenic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
914801956 1:150968513-150968535 CTGGGGAAGGGATATGAGTAAGG + Intronic
914900595 1:151709192-151709214 GTGGGGAAGGGGGAAGTGGGTGG + Intronic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915004416 1:152623246-152623268 CTGGGGAAGGGGAATGCAAACGG + Intergenic
915551060 1:156634676-156634698 CCAGGGAAGAGGTATATGGATGG - Intergenic
915603500 1:156937059-156937081 CTGGGGAAGGGGTCTGTGCTGGG + Intronic
915667589 1:157459015-157459037 GTGGGGAAAGGGTATATGGATGG - Intergenic
915740982 1:158118223-158118245 CTGGGGGTGGGGGATATGGAAGG - Intergenic
916285417 1:163100176-163100198 ATGGGGAAGAGGTGTGTGGATGG + Intergenic
917217132 1:172690255-172690277 TTGGGGAAGAGGTATGTGGATGG - Intergenic
917462790 1:175246813-175246835 GTGGGGAAGAGGTATATGGATGG + Intergenic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
917794037 1:178520187-178520209 TTGGGGAAGGGGGATGAGGAAGG + Intronic
917817341 1:178724925-178724947 GGGGGGAAGGGGTAGGAGGATGG - Intergenic
918755618 1:188337151-188337173 TTGGGCAAGAGGTATGTGGATGG - Intergenic
918918141 1:190671222-190671244 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
918958321 1:191238589-191238611 CTGGGCAAGAGGTATGTGGATGG + Intergenic
919090748 1:192976685-192976707 CTGGGGAAGGGGAATGTCAAAGG - Intergenic
919241860 1:194924860-194924882 TTGGAGAAGAGGTATGTGGATGG + Intergenic
919318061 1:195999986-196000008 TTGGGGAAGAGATATGTGGATGG + Intergenic
920050511 1:203162083-203162105 ATGGGGTAAGGGTGTGTGGAAGG - Intronic
920197524 1:204239024-204239046 TTGGGGAAGAGGTATGTGGATGG + Intronic
920255059 1:204649045-204649067 CAGGTGAAGGGATTTGTGGAAGG + Intronic
921193489 1:212730296-212730318 CTGGTGAAGAGTTGTGTGGAGGG + Intronic
921447399 1:215262796-215262818 CTGGGAAAGGGGTTTGCAGATGG - Intergenic
922586257 1:226736914-226736936 CTGCGGAAGGGGCACGGGGAGGG + Exonic
922770839 1:228182334-228182356 GTGGGGACGGGGTGTGTGGTGGG + Intergenic
922770974 1:228182730-228182752 GTGGGGACGGGGTGTGTGGTGGG + Intergenic
922780959 1:228251940-228251962 TTGAGGAAGAGGTGTGTGGATGG - Intronic
922883064 1:228997150-228997172 CTGGGGAAGTGGCATGGGGTAGG + Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923226739 1:231944656-231944678 CTGCGTTAAGGGTATGTGGAAGG - Intronic
923253487 1:232198794-232198816 TTGGGGAAGAAGTATGTGGATGG - Intergenic
923482474 1:234397506-234397528 AGGGGGAAGGGGGATGGGGAAGG + Intronic
923482499 1:234397558-234397580 GGGGGGAAGGGGGATGGGGATGG + Intronic
924829598 1:247579052-247579074 CTGGGGAAGAATTATGTGGATGG + Intergenic
924840684 1:247707178-247707200 CTGGGGAGGAGGCATGTGGGTGG - Intergenic
1062947375 10:1471888-1471910 CATAGGAAGGGGGATGTGGAGGG - Intronic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063249958 10:4263795-4263817 CTGGTTAAGGGGTCTGTGGGAGG - Intergenic
1063943234 10:11152121-11152143 CTTGGGTAGGAGTAAGTGGATGG + Intronic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1065232441 10:23612230-23612252 CTGGGGAAGGGGCATGACCATGG + Intergenic
1066166936 10:32798572-32798594 TTGGGGAAGAGGTATGTGGATGG - Intronic
1066169522 10:32826977-32826999 TTGGGGAAGAGGTATGTGGGTGG + Intronic
1066393299 10:34996119-34996141 CTGGTGGTGGGGAATGTGGAGGG + Intergenic
1067125461 10:43511890-43511912 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
1067333228 10:45340875-45340897 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1067469942 10:46528788-46528810 GTGGGGAGGGGGTTTGTGGGGGG - Intergenic
1067687638 10:48476711-48476733 CTGGGGAAGGGGTCAGTCTAGGG + Intronic
1067803577 10:49377245-49377267 CTGGGGCAGAGGTAGGTGGAAGG + Intronic
1068007581 10:51408924-51408946 CTGGGGAAGAGGTGTGTGGATGG - Intronic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1068837127 10:61567724-61567746 TTGGGGAAGAGATATATGGATGG - Intergenic
1069192218 10:65505714-65505736 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1069790742 10:71018926-71018948 TTTGGGAAGAGGTATGTGGATGG - Intergenic
1070126430 10:73625855-73625877 CTGGGGAGGGGGTGCGGGGAAGG - Intronic
1070688805 10:78509679-78509701 CTGGGGCTGGGGGATGAGGAGGG - Intergenic
1071032837 10:81205371-81205393 TCGGGGAAGAGGTATGTGGATGG + Intergenic
1071266988 10:83973348-83973370 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1071546127 10:86531098-86531120 CTGGGGAAGGGGGTTGGGGAGGG + Intergenic
1071673828 10:87636771-87636793 CTTGGGAAGAGGTATGTGTGTGG - Intergenic
1071937776 10:90549934-90549956 TTGGGGACGAGGTATGTGGACGG + Intergenic
1073077708 10:100835113-100835135 TTGGAGAAGGGAGATGTGGATGG - Intergenic
1073111193 10:101063868-101063890 AAGGGGAAGGGGGATCTGGAAGG + Intronic
1073399184 10:103242860-103242882 CTGGGGAAGGGGGTTGGGGTGGG + Intergenic
1073412979 10:103357703-103357725 CTGGGGAAGGGATAATGGGAGGG + Intergenic
1073557440 10:104466549-104466571 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1073656596 10:105423836-105423858 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1073918387 10:108431672-108431694 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1074286981 10:112107204-112107226 CTTGGGAAGGTGTATGTGTTGGG - Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074689953 10:115995275-115995297 CTGGTGGAGGGGTAAGTGGACGG + Intergenic
1074755332 10:116620485-116620507 TTGGGGGTGGGGTAGGTGGAGGG - Intergenic
1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG + Intergenic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1075606240 10:123812821-123812843 GTGGGGATGGGGGATGGGGAAGG - Intronic
1075606879 10:123818061-123818083 TTCGGGAGGAGGTATGTGGATGG + Intronic
1076117178 10:127908440-127908462 GTGGGGAGGGGGGGTGTGGAGGG + Intronic
1076212950 10:128664949-128664971 CTGGGGGATGGGAATGGGGAAGG + Intergenic
1076685751 10:132197772-132197794 CTCGGGCAGGGGCATGTGGGGGG + Intronic
1076846447 10:133071731-133071753 CTGGGGAAGGAGTGTGTGGCTGG - Intronic
1076859414 10:133133568-133133590 CAGGGGACGGGGTAGGGGGAGGG + Intergenic
1076927313 10:133498559-133498581 GTGGGGAAGAGGTATGTGGATGG - Intergenic
1077364096 11:2154610-2154632 CAGGGGCAGGGGTGAGTGGAAGG - Intronic
1077437337 11:2549269-2549291 CTGGGGTGGGGCTATGGGGAAGG + Intronic
1077454051 11:2667362-2667384 CTGGGGCAGGGTGATTTGGATGG - Intronic
1077555481 11:3224021-3224043 GAGGGGAGGGGGAATGTGGATGG + Intergenic
1077791832 11:5449434-5449456 CTGGGCAAGGGGTATGGTGAGGG + Intronic
1077852367 11:6085450-6085472 CTGGGGAAGGGGTGAGTGAGGGG - Intergenic
1078929291 11:15901133-15901155 CTGGGGCAGGGGCCTGGGGAAGG - Intergenic
1079162624 11:18009068-18009090 TTGGGGAAGGGATTTGAGGAGGG - Intronic
1079657047 11:22997334-22997356 CTGGAGAAGGCATATGTGCAAGG + Intergenic
1079709797 11:23666771-23666793 CTGGGGTAGGGGTAAGTGAAAGG - Intergenic
1080076690 11:28158148-28158170 TTGGGGAACAGGTATGTGGATGG + Intronic
1080783794 11:35455932-35455954 CTGGGGAATAAGTAAGTGGAAGG - Intronic
1081072878 11:38631827-38631849 TTGGGGATGAGTTATGTGGATGG + Intergenic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1081937642 11:46916625-46916647 CTAGGGAAGGGGGAGCTGGAAGG - Intronic
1082017269 11:47499682-47499704 CTGGGGAAGGGGTAGGGAAAGGG + Intronic
1082093663 11:48109607-48109629 CTGGGAAATGGGTCTGGGGAAGG + Intronic
1082196800 11:49316257-49316279 AAGGGGAAGGGGTAAGGGGAAGG + Intergenic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1082999749 11:59280497-59280519 TTGGGGAAGAGGTGTGTGGATGG + Intergenic
1083093231 11:60221758-60221780 TTTGGGAAGAGGTATGTGAATGG + Intronic
1083178164 11:60965939-60965961 CTGGGGTAGAGGCATGTGGATGG + Intergenic
1083436968 11:62649247-62649269 CCAGGGAAGGGGTCTGTAGAGGG + Exonic
1083507887 11:63177541-63177563 CTGGGGAAAGGGTATTAAGAAGG - Intronic
1083618405 11:64037216-64037238 CCTGGGGAGGGGGATGTGGAGGG - Intronic
1083663980 11:64265008-64265030 CTGGGGGTGGGGTTTGAGGACGG - Exonic
1083877968 11:65534600-65534622 CTGGGCTAGGGGTATGTGCCTGG + Intronic
1083887277 11:65579055-65579077 CTGGGGGAGGGGGAAGGGGAGGG - Intronic
1084295501 11:68211245-68211267 GTGGGGAAGGTGGAGGTGGATGG - Intronic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084779626 11:71399775-71399797 CTGGGGGAGGGCAGTGTGGAGGG + Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1085481342 11:76825221-76825243 CTGGGTGTGGGCTATGTGGAAGG + Intergenic
1085686047 11:78622822-78622844 CTGGGGGAGAGGTATGTGGATGG + Intergenic
1085742933 11:79092360-79092382 CTGGGAAAGGTGCATGAGGAGGG - Intronic
1085942281 11:81219548-81219570 ATGGGGAAAGGGCATGTAGAAGG - Intergenic
1086141547 11:83505571-83505593 TTGGGGAAGAGGTATATGGATGG - Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086491447 11:87360886-87360908 CTGGGAAATGGGTATGCGGCAGG + Intergenic
1086644187 11:89198902-89198924 ATGGGGTAGGGGTAAGGGGAAGG - Intronic
1086834208 11:91601024-91601046 TTTGGGAAGACGTATGTGGATGG + Intergenic
1087048788 11:93866370-93866392 CTGGAGGAGGGATATGTGGTCGG + Intergenic
1087783679 11:102329785-102329807 GTGGGGTAGGGGGATGTGGGAGG + Intronic
1087830207 11:102811252-102811274 ATGTGGAAGGGGGATGTGTAGGG + Intergenic
1088097297 11:106115789-106115811 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1088449441 11:109966000-109966022 TTGGGGAAGAGGTATATGGATGG + Intergenic
1088836748 11:113584021-113584043 TTGAGAAAGAGGTATGTGGACGG + Intergenic
1088899978 11:114108548-114108570 GCAGGGAAGGGGAATGTGGAGGG - Intronic
1089667980 11:120032411-120032433 CTGCTGAAGGGGTAGGTGGCAGG - Intergenic
1089785232 11:120902850-120902872 CTGAGGACGGCGTGTGTGGAAGG + Intronic
1090033791 11:123230655-123230677 CTGGGGGAGGAGTATTTAGATGG + Intergenic
1090119112 11:124005762-124005784 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090209404 11:124907423-124907445 TTTGGGAAGAGGTATGTGGATGG - Intergenic
1090221524 11:125030968-125030990 CTGGGGAAGAGTTATGTGGACGG - Intronic
1090383781 11:126344817-126344839 CTGTGGAAGGGGTATGGGAGGGG - Intronic
1090611630 11:128476286-128476308 GTGGGTTAGGGGTATGTGGGAGG - Intronic
1090687678 11:129141471-129141493 ATGGGGTAGGGGGATGGGGAAGG + Intronic
1090722496 11:129489340-129489362 CTGAGGAAGGGCGCTGTGGAAGG + Intergenic
1091051830 11:132379388-132379410 TTGGGGAAAAGGTATGTGGAAGG + Intergenic
1091073550 11:132592312-132592334 CTGAGGGAGGGGCATATGGAGGG + Intronic
1091348878 11:134876870-134876892 GTGGAGAGGGGGCATGTGGAGGG - Intergenic
1091556997 12:1581342-1581364 CTGGGGAGAGGGTTTGGGGAAGG + Intronic
1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG + Intronic
1091753814 12:3038987-3039009 CTGGGGAAGGGGTGAGGAGAGGG - Intronic
1091840517 12:3617151-3617173 GTGGGGAAGGATTATGAGGAAGG - Intronic
1092010488 12:5106560-5106582 CGGGGGAAGGGTCATGGGGAGGG + Intergenic
1092093370 12:5822282-5822304 CTGGGGAAGAGGTATGTAGATGG + Intronic
1092261787 12:6956796-6956818 GTGGGGCAGGGGTAGGAGGAAGG - Intronic
1092380980 12:7996904-7996926 CTGGAGAAGAGGTATGGGAACGG + Intergenic
1093031776 12:14295303-14295325 CTGGGGAAGAGGTATGTGGGTGG - Intergenic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093387369 12:18574534-18574556 TTGGGGCAGTGGTATGGGGAGGG - Intronic
1093645809 12:21584303-21584325 TTGGGGAAGAGGTATGTGGATGG + Intronic
1094102619 12:26779895-26779917 TTGGGGAAGAGGTATGTAGACGG + Intronic
1094389706 12:29935591-29935613 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1094427073 12:30327169-30327191 CTGAAGAAAAGGTATGTGGAAGG - Intergenic
1095121426 12:38424207-38424229 TTAGGGAAGAGATATGTGGATGG - Intergenic
1095442907 12:42255794-42255816 CTAAGGAAGAGGTATGTGGGTGG - Intronic
1095603940 12:44044967-44044989 TTGGGGAAGAGATATGTGGATGG + Intronic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1095856158 12:46863044-46863066 TTGGGGAAGAAATATGTGGATGG - Intergenic
1095862070 12:46928537-46928559 CTGGGGTTGGGGTCTGGGGATGG + Intergenic
1096183939 12:49566278-49566300 CAGGGGAAGGGGGCTGGGGAGGG - Intronic
1096220476 12:49825847-49825869 CAGGTGAAGGGGAATGTTGAAGG - Intronic
1096288854 12:50323882-50323904 TTGGGGAAGAGATATGTGGATGG + Intergenic
1096457374 12:51798816-51798838 TTGGGGAAGAGGTATGTGGATGG - Intronic
1096618449 12:52847759-52847781 CTGGGGAATGGGGACGCGGAGGG + Intronic
1096795892 12:54077349-54077371 CGTGGGCAGGGGTGTGTGGAGGG + Intergenic
1096863193 12:54545096-54545118 ATGGGGAAGGGGGTTGTGGGAGG - Exonic
1096884007 12:54698894-54698916 GTGGGGAAGGGGGAGGGGGAGGG - Intergenic
1097564562 12:61251811-61251833 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1097774233 12:63627753-63627775 CTAGGGAAGTGGTGTATGGAGGG - Intronic
1097821263 12:64131276-64131298 TTGTGGAAGAGGTATGTGGATGG - Intronic
1097843265 12:64342120-64342142 TTGGGGAAGAGGTATGTGGATGG - Intronic
1098716185 12:73830441-73830463 TTGGGGAAGAGGTATGTGGCTGG + Intergenic
1098733375 12:74066263-74066285 TTGAGGAAAAGGTATGTGGATGG + Intergenic
1098749929 12:74280228-74280250 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1098831817 12:75373397-75373419 TTGGAGAAGAGGTATGTGGATGG - Intronic
1099183297 12:79491971-79491993 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1099238637 12:80112979-80113001 CTTGGGAAGGTGTATGTGTCAGG + Intergenic
1099366019 12:81766016-81766038 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1099380521 12:81946796-81946818 GTGGGGTAGGGGTAGGGGGAAGG - Intergenic
1099508652 12:83507820-83507842 CTGGGAAAGAGGTATGTGGAGGG + Intergenic
1099578151 12:84406024-84406046 ATGGTGAAGAGATATGTGGATGG + Intergenic
1099689864 12:85938653-85938675 TTAGGGAAGAAGTATGTGGATGG + Intergenic
1099735871 12:86565669-86565691 TTGGGGAAGAGGGATGTGGATGG + Intronic
1100177796 12:92050649-92050671 CTGGGGAAGGGTTGGGGGGATGG + Intronic
1100471080 12:94893695-94893717 CTAGGGTAGAGGTATGTGGAAGG - Intergenic
1101484054 12:105133123-105133145 ATGGGGAAGGGATTTGTGGAAGG - Intronic
1101534578 12:105605474-105605496 TTGGGGAAAAGGTATGTGGGTGG - Intergenic
1102171060 12:110842800-110842822 CTGAGGAAGGGCTTTGTGCACGG + Intergenic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102543322 12:113637954-113637976 CTGGGGAAGGGGTGGGGGTAGGG - Intergenic
1102598843 12:114013161-114013183 GTGGGGGAGGGGGATGGGGAGGG + Intergenic
1102976251 12:117209049-117209071 CGGGGGAGGGGGCATGGGGAGGG - Exonic
1103035709 12:117654704-117654726 TTGGGGAAGAGGTATGTGGATGG + Intronic
1103225668 12:119285227-119285249 TTGGGGAAGGGGTTTGTGGTTGG - Intergenic
1103396623 12:120612080-120612102 TTGGGGAAGAAGTATGTAGATGG + Intergenic
1105260100 13:18772712-18772734 TTGAGGAAGGGGTGTGTGTAAGG - Intergenic
1105688677 13:22813848-22813870 CTCGGAAAGGGGAATGTGGCAGG + Intergenic
1105728359 13:23187301-23187323 CTGAGGAAGAGGCTTGTGGATGG - Intronic
1105740207 13:23315813-23315835 TTGGGGAAGAGATATGTGGATGG + Intronic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106291235 13:28364589-28364611 TTTGGGGAGGGGTATGTGTATGG + Intronic
1106767866 13:32933372-32933394 CTGAGGAAGAGGTGTGGGGAAGG + Intergenic
1107070275 13:36261019-36261041 CTGGGAAAGAGGTATGTGGATGG + Intronic
1107534989 13:41320521-41320543 CTGGGGGAGGGGAATGGTGAGGG - Intronic
1107955412 13:45506570-45506592 CTGGGGTAGGGGTGTGAGGATGG + Intronic
1107983490 13:45755330-45755352 TTGGTAAAGAGGTATGTGGATGG - Intergenic
1108286540 13:48914778-48914800 CTGGGGAAGAAATGTGTGGAAGG + Intergenic
1108944923 13:56010240-56010262 CTGGGGAAGAGTTATGTGTATGG - Intergenic
1109293310 13:60500747-60500769 TTGGGAAAGAGGTATGTTGATGG + Intronic
1109483322 13:62985534-62985556 CTGGGGAAGAGGCTTGTGGATGG - Intergenic
1109519114 13:63485433-63485455 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1110369681 13:74726064-74726086 CAGAGGAGGGGGTATCTGGAAGG - Intergenic
1110377253 13:74807102-74807124 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1110418828 13:75281434-75281456 CTTGGGAAAGGGTAGGAGGAGGG - Intergenic
1110788358 13:79560185-79560207 AGGGGGAAGGGGGAAGTGGAGGG - Intergenic
1110834051 13:80063997-80064019 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1111057711 13:82972392-82972414 TTGGGGAAGGGGTATGTGGATGG - Intergenic
1111198623 13:84905514-84905536 TTGGGGAAGAGGTATTTGGATGG + Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1111535285 13:89595805-89595827 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1112249841 13:97769647-97769669 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1112542315 13:100327221-100327243 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1112915181 13:104539487-104539509 GTGGAGGAGAGGTATGTGGAAGG + Intergenic
1113264186 13:108598995-108599017 CTGGGGATGGGGTGGGGGGAGGG - Intronic
1113319613 13:109221040-109221062 TTGGGGAAGAAGTATGTGGATGG - Intergenic
1113396225 13:109950165-109950187 TTGGGGAAGAGGTATGTAGATGG + Intergenic
1113770336 13:112904174-112904196 CTGGGGTAGGGGTAGGTGTTAGG + Intronic
1113794525 13:113049336-113049358 GTGGGGAAGGGGTGGGTGGTGGG + Intronic
1114042210 14:18689414-18689436 CTGGGGAAAGGGAGTGTGGGAGG + Intergenic
1114182353 14:20377526-20377548 CTTGGGAAGGGGTAGGGGGCAGG + Intronic
1114193693 14:20459605-20459627 GTGAGGAAGGGGTATTGGGAAGG - Intronic
1114205951 14:20571402-20571424 TTGGGGAAGATGTATGTGGATGG + Intergenic
1114250649 14:20957295-20957317 GTCGGGAAGGGGTCAGTGGATGG - Intergenic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114648419 14:24268421-24268443 CTGGGGAAAGAGTAGGTGGTTGG + Intronic
1114758166 14:25283247-25283269 TTGGGGAATAGGTATGTGGATGG - Intergenic
1114890050 14:26908736-26908758 CTGGAGAAGGGGTTTGAGGTAGG + Intergenic
1115130780 14:30049892-30049914 TTGGGGAAGAGCTATGTGGATGG + Intronic
1115328273 14:32166411-32166433 CTGGGGCAGAGACATGTGGATGG + Intergenic
1115542461 14:34434720-34434742 TTCGGGTAGGGGTATGGGGAGGG - Exonic
1115776797 14:36724329-36724351 CTCAGGCAGGGGTATGGGGAAGG - Intronic
1115804279 14:37033754-37033776 CTGGGAAGAGGGTACGTGGATGG + Intronic
1116058989 14:39897558-39897580 TTGGGTAAGAGGTATGTGGATGG + Intergenic
1116068179 14:40009800-40009822 TTGGGGAAGAGGTATGTCGATGG + Intergenic
1116249136 14:42458266-42458288 TTGGGGAAGAGATATGTGGAAGG + Intergenic
1116531374 14:45977607-45977629 TTGGAGAAGAGGCATGTGGATGG - Intergenic
1116885228 14:50214203-50214225 TTGGGGAATGGGGAAGTGGAAGG + Intronic
1116983437 14:51194953-51194975 CTGGGAAGGAGGTATGTGAATGG + Intergenic
1117216935 14:53560806-53560828 TTGGGGAAGGGTTATGTGGATGG + Intergenic
1117596187 14:57329252-57329274 TTGGGGAAGAGTTATGTGGATGG - Intergenic
1117634218 14:57725006-57725028 CTGGGGAAGAGATAAGTGGATGG + Intronic
1117697870 14:58384601-58384623 CTTGGAGTGGGGTATGTGGAGGG + Intergenic
1117951375 14:61085315-61085337 CTGGGGAATGCATATGTAGAGGG + Intergenic
1118073460 14:62271431-62271453 CTGGGGAAGAGGTTTGTGGGAGG - Intergenic
1118122348 14:62859537-62859559 TTGGGGAAGAGGTATGTGGATGG - Intronic
1118607053 14:67512247-67512269 CTAGGGAAGGGGTAGGAGGGGGG - Intronic
1118880689 14:69823388-69823410 TTGGGAAAGAGGTATGTGGACGG - Intergenic
1118942125 14:70347775-70347797 CTGGAGGAGGGATATGTGGTCGG - Intronic
1119158537 14:72433333-72433355 CGGGGGTTGGGGTATGGGGAGGG + Intronic
1119326827 14:73764823-73764845 CTGGGGAGGGGGCAGGTGGGAGG - Intronic
1120081936 14:80226897-80226919 GTGGGGAAGACGTATGTGGATGG - Intronic
1120148653 14:81007131-81007153 CTGGAGATGGGGTCTTTGGAGGG + Intronic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1120555906 14:85929805-85929827 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1120575599 14:86176709-86176731 CTGGAGAGGGTGTATGTGGGCGG + Intergenic
1120702277 14:87711333-87711355 CTGGGGAAGAGATATCTGAATGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121226037 14:92322796-92322818 GTGGGGAGGGGGTGTGTGGCGGG + Intronic
1121956928 14:98222872-98222894 ATGGGGCTGGGGGATGTGGATGG - Intergenic
1122782659 14:104150182-104150204 GTGGGGGAGGGGGATGAGGAGGG - Intronic
1122879354 14:104683154-104683176 CTGGGGGAGGGGTCTGCGGGTGG + Intergenic
1122971721 14:105154963-105154985 ATGGGGAGGGGGTCAGTGGAAGG - Intronic
1122982554 14:105198210-105198232 CTGAGGGAGGGGTCTGTGGCTGG - Intergenic
1122987000 14:105217109-105217131 CTGAGGAAGGAGGATGTGGGTGG - Intronic
1123000731 14:105292836-105292858 CTGGGGAAGGGGTGTGGGCCTGG - Intronic
1124516016 15:30367941-30367963 CTGAGGAAGGGGTCAGTGGCAGG + Intronic
1124726904 15:32162790-32162812 CTGAGGAAGGGGTCAGTGGCAGG - Intronic
1125190496 15:36986955-36986977 CAGGCCAAGGGGTGTGTGGAAGG + Intronic
1125539341 15:40460758-40460780 CAGGGGAAGGGAGATCTGGAAGG - Intronic
1125590926 15:40854100-40854122 GTGGGGATGGGGGATGGGGAGGG - Intronic
1125616473 15:41018502-41018524 GTGGGGAAGGGAGAAGTGGATGG + Intronic
1125713662 15:41806533-41806555 GTAGGGAAGGGGGATGTTGAAGG + Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126283692 15:46986910-46986932 TTGGGGAAGAGATATGTGGATGG + Intergenic
1128114192 15:65095074-65095096 CTGGAGAAGGGGTGTGGGGTAGG + Intronic
1128212720 15:65913681-65913703 CTGGGGTATGTGTGTGTGGAGGG + Intronic
1128253539 15:66180408-66180430 CTCAGGATGGGGTATGGGGAGGG - Intronic
1128325261 15:66719906-66719928 CTGGGGAGGGGGGTGGTGGAGGG + Intronic
1128642893 15:69352857-69352879 TTGGGGAAGAGGTATGTGGATGG + Intronic
1128778828 15:70344655-70344677 CTGGGGATGGGCAATGGGGAAGG - Intergenic
1128995311 15:72290418-72290440 CTGGGGAAGGGATCTGGAGAAGG + Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1130109650 15:80953982-80954004 CTGGGGATTGGGGATGAGGAAGG - Intronic
1130365510 15:83234638-83234660 CTAGGGAAGAGATATGGGGATGG + Intergenic
1130525627 15:84703772-84703794 CTGAGGAAGAGATATGTGGATGG + Intronic
1130573916 15:85073846-85073868 CTGGGGAAGAGCTATGGGAAAGG - Intronic
1130661368 15:85833756-85833778 ATGGGGAAGGGGCAGGTGGGCGG + Intergenic
1130766614 15:86877534-86877556 CTGGGGAAGGGATAAGTAGAAGG + Intronic
1130972674 15:88746242-88746264 ATGGGCAAAGGGTATGTGAAAGG + Intergenic
1131117857 15:89805540-89805562 CAGGGAAAGGGGTACATGGAAGG + Intronic
1131157574 15:90084578-90084600 CTGGGAAAGGGGTGTGGGCAGGG + Intronic
1131724101 15:95203431-95203453 TTAGGGAACAGGTATGTGGACGG + Intergenic
1132296176 15:100736387-100736409 CTGGGGACGGGGAATGGGGATGG - Intergenic
1132345732 15:101107685-101107707 CGGGGGTGGGGGTATGTGGGGGG - Intergenic
1132752886 16:1466978-1467000 TTGGGGAAGGGGTCCCTGGAGGG - Intronic
1132868272 16:2104349-2104371 TTGGGGGAGGGGGATGAGGATGG + Intronic
1132941907 16:2512733-2512755 CTGGGGAAGGGGCTTGAGGGAGG + Intronic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133749384 16:8712947-8712969 ATGGGGAGGGGGTATGGGGTTGG - Exonic
1134064808 16:11221245-11221267 CTGGGTATAGGGTATGTGTATGG - Intergenic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1134523463 16:14928670-14928692 TTGGGGGAGGGGGATGAGGATGG - Intronic
1134663818 16:16003851-16003873 TTGGTGAATGGGTAGGTGGATGG + Intronic
1134711057 16:16327154-16327176 TTGGGGGAGGGGGATGAGGATGG - Intergenic
1134948497 16:18341377-18341399 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1134948526 16:18341455-18341477 TTGGGGGAGGGGGATGAGGATGG + Intergenic
1135289357 16:21221986-21222008 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135924341 16:26679412-26679434 CTGGGGATGGGGTATGTCCAAGG - Intergenic
1137384727 16:48030733-48030755 GTGGGGAAGGTGTATGTGGGTGG + Intergenic
1137817391 16:51411439-51411461 CTGGAGGAGGGGTATTTGCATGG + Intergenic
1137899115 16:52245966-52245988 CTGGGGAAGGGTTGAGTGAAGGG + Intergenic
1138047121 16:53736890-53736912 CTGGGGGAGGGGAATGAGTATGG - Intronic
1138567159 16:57841883-57841905 GTGGGGATGGGGTGTGTGGGGGG - Intronic
1138868466 16:60851415-60851437 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1139427795 16:66894028-66894050 CTGGGAGAGTGGTCTGTGGAGGG + Intronic
1140246206 16:73252343-73252365 CTGGGGTAGTGGCATGGGGACGG + Intergenic
1140327360 16:74017829-74017851 CTGGGGTAGAGATATGGGGAAGG - Intergenic
1140411766 16:74745402-74745424 CTGGGGCAGGGGGTTGGGGAGGG - Intronic
1140476108 16:75239952-75239974 CGGGGGAAGGCGTCTGTGGGAGG - Intronic
1140619596 16:76713193-76713215 CTTGGGAAGGGGTAGGTTGCTGG - Intergenic
1141432474 16:83977567-83977589 CTGTGGAGGGGCTCTGTGGAGGG - Intronic
1141535384 16:84676248-84676270 CTGGAGAAGAGACATGTGGATGG + Intergenic
1141559451 16:84857406-84857428 TTGGGAAAGAGGGATGTGGATGG - Intronic
1141692947 16:85606798-85606820 CAGGGCAAGGGGTATGTGTGGGG + Intergenic
1141729910 16:85815188-85815210 CTGGGGAGGGGAAATGGGGAGGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1141909680 16:87050196-87050218 CTTAGGAAGGGGTCGGTGGACGG - Intergenic
1141926241 16:87171660-87171682 CTGGGGAAGGGGGGTCAGGAAGG + Intronic
1142004733 16:87684297-87684319 GTGGGGAGGGGGTGCGTGGATGG + Intronic
1142267747 16:89072279-89072301 CTGGGGAGGGGGTACAAGGATGG + Intergenic
1142342680 16:89534156-89534178 CTGGGGATGGAGAATGGGGAGGG - Intronic
1142558181 17:793750-793772 CTGGGGGAGGGGTGTTTGCAGGG + Intergenic
1143134547 17:4704174-4704196 CTGGGGAGGGGGCGTGGGGAGGG + Exonic
1143583866 17:7841888-7841910 CTGGGGGAGGGGGAGGCGGAGGG - Intronic
1143591827 17:7889585-7889607 GTGGGGAAGGGGCAAGTTGAGGG + Intronic
1145042876 17:19589900-19589922 CGGGGGAAGGGGCATGTGCAGGG - Intergenic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1147250391 17:39149750-39149772 CTGGGGAAGGGGGAATTGGGAGG - Intronic
1147532304 17:41290854-41290876 CCTGGGGAGGGGGATGTGGATGG + Intergenic
1147605911 17:41773620-41773642 CTGGGGAAGGGGTGTGGGGAAGG - Intronic
1147904234 17:43812721-43812743 CTGGAGAAGAGGTACCTGGATGG - Intronic
1148628663 17:49089889-49089911 CTGGAGAAGACATATGTGGATGG + Intergenic
1148853790 17:50567621-50567643 CTGGGGAATGGGGATGGGGGAGG - Intronic
1148875459 17:50684351-50684373 CGGGGGAAGGGGTTCTTGGAGGG - Intronic
1148889642 17:50798616-50798638 CTAGGGAAGGGGTCAGGGGAGGG + Intergenic
1149291812 17:55225061-55225083 CTGGGAAGGTGGTATGTGGATGG - Intergenic
1149621906 17:58051697-58051719 CTGGGGAACCAGTGTGTGGAAGG - Intergenic
1149849795 17:60027542-60027564 CTGGGGCTGGGGTGTGGGGAGGG + Intergenic
1149860373 17:60118982-60119004 CTGGGGCTGGGGTGTGGGGAGGG - Intergenic
1151037716 17:70820967-70820989 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1151278048 17:73050790-73050812 CTGGGGATGGGGGAGGTGAAAGG + Intronic
1151343476 17:73486807-73486829 CTGGGGAAGGGGGCAGTGAAGGG + Intronic
1151446715 17:74170969-74170991 CTGGGAAGGAGGAATGTGGATGG + Intergenic
1151585460 17:75005631-75005653 CTGGGGGAGAGGAGTGTGGAAGG + Exonic
1152240285 17:79157355-79157377 CTGTGGAAGGGGTGCATGGACGG - Intronic
1152962898 18:90412-90434 CTCGGCAAGGGGGATGTGGCAGG + Intergenic
1153089802 18:1330790-1330812 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1153131184 18:1857070-1857092 ATGGGGAACGGGTATGTGGATGG - Intergenic
1153217603 18:2834974-2834996 TCGGGGAAGAGGTATGTGGATGG - Intergenic
1154068551 18:11131727-11131749 TTGGGGAAGAGGTTTGTGGATGG + Intronic
1154365945 18:13709285-13709307 CATGGGTAGGGGTGTGTGGAGGG - Intronic
1154420920 18:14225589-14225611 CTCGGAGAGGGGTATGTGGCAGG - Intergenic
1154433613 18:14327329-14327351 TTGAGGAAGGGGTGTGTGTAAGG + Intergenic
1155492255 18:26410671-26410693 CTGGGGAGGTGGTAGGGGGAGGG + Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1155960839 18:31993501-31993523 AAGGGGAAGGGGCATGTGTAAGG + Intergenic
1156998664 18:43498358-43498380 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1157034496 18:43954643-43954665 CAGGGGAAGGAGTATGTACAAGG - Intergenic
1157053526 18:44198147-44198169 CCTGGGAAGGGGTAAGTGAAGGG + Intergenic
1157341295 18:46780653-46780675 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1157468830 18:47971895-47971917 CAGGGGATGGGGTAGGGGGAAGG - Intergenic
1157870846 18:51228968-51228990 GTGGGGAAGAGGTATGTTAATGG - Intergenic
1157919477 18:51699825-51699847 CTGGAGGAGGGATATGTGGTCGG - Intergenic
1157998414 18:52587496-52587518 TTGGGGAAGAGGTTTGTGGATGG - Intronic
1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG + Intergenic
1158721952 18:59933009-59933031 CTGGGGATGGGGACTGGGGAGGG - Intergenic
1158736695 18:60090679-60090701 TTGGAGAAGGGGGATGTGGTTGG + Intergenic
1159088290 18:63818882-63818904 CTAGGGAAGGGGTGAGTGTAGGG - Intergenic
1159559016 18:69974735-69974757 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1160563889 18:79775052-79775074 CTGGGGAGAGGGTTGGTGGAAGG + Intergenic
1160584874 18:79907708-79907730 CTTGGGCAGGGGTGTGAGGATGG - Intronic
1161433238 19:4246526-4246548 CTGGGGAAGGAGGCTGGGGAAGG + Intergenic
1161698194 19:5782015-5782037 CTGGGGAAGGGGTAGGCTGAAGG + Intergenic
1161716726 19:5880512-5880534 GTGGGGAAGGGGCAGGGGGAGGG - Intronic
1161821512 19:6533484-6533506 AGGGGGAAGGGGTTTCTGGAGGG - Intronic
1161821525 19:6533515-6533537 AGGGGGAAGGGGTCTCTGGAGGG - Intronic
1161821533 19:6533534-6533556 AGGGGGAAGGGGTCTTTGGAGGG - Intronic
1161821559 19:6533594-6533616 AGGGGGAAGGGGTCTCTGGAAGG - Intronic
1161821593 19:6533680-6533702 AGGGGGAAGGGGTCTCTGGAGGG - Intronic
1161821639 19:6533789-6533811 AGGGGGAAGGGGTCTCTGGAGGG - Intronic
1161989717 19:7677761-7677783 CTTGGGAAGGGGCAGGTGGGCGG + Intronic
1162291489 19:9784259-9784281 CTGGGCAAGGGGGATGTGGCAGG + Intronic
1162372884 19:10289669-10289691 CTGGGGTAGGGGTTTGGGAAGGG + Intergenic
1162529840 19:11229432-11229454 GAGGTGAAGGGGTATGTGGTTGG + Intronic
1162850030 19:13423964-13423986 CAGGGCAAGGGGGCTGTGGAGGG - Intronic
1162860945 19:13505711-13505733 CTTGGGAATGGGTTTGTGGGGGG - Intronic
1163035770 19:14567974-14567996 CTGGGGAGGAGGGATGTGGGAGG - Intronic
1163137647 19:15324202-15324224 CTGGGGAGGGGGGAAGGGGAAGG + Intronic
1163939135 19:20476874-20476896 CTGGAGGAGGGATATGTGGTTGG + Intergenic
1164117171 19:22233943-22233965 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1164676375 19:30104304-30104326 CTGTGGAGAGGGTGTGTGGAGGG - Intergenic
1165140428 19:33696644-33696666 CTGGGGAAGGGAGATGGGGGTGG - Intronic
1165159671 19:33808628-33808650 CAGTGGAAGGGGTGTGTGCAGGG + Intronic
1165350838 19:35274493-35274515 CTCAGGAAGGGGTGTGTGGCTGG + Intronic
1165974758 19:39665982-39666004 ATGTGGAAGGGAAATGTGGAAGG - Intergenic
1166198076 19:41219522-41219544 CTGGGGCAGGGGTAGGAGGTGGG + Intronic
1166279370 19:41780774-41780796 CTGGTGATGGGGGAGGTGGAAGG + Intergenic
1166325399 19:42047176-42047198 CTGGGGAAGGGGGCTGAGCATGG - Intronic
1166379820 19:42350125-42350147 CTGGGGAAGGGGTCACAGGAAGG - Intronic
1166557317 19:43709271-43709293 TTGGGGAAGGGGTTTGGGGAAGG - Intergenic
1166596323 19:44053308-44053330 CTTGGTGAGGGGGATGTGGAAGG + Intronic
1166790330 19:45395478-45395500 CTGGGGTAGGGGTTTGGGGTTGG + Exonic
1166929049 19:46290191-46290213 GTGGGGAAGGGGTAGGGAGAGGG - Intergenic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167266706 19:48486405-48486427 TTGGGGAAGGACTCTGTGGAGGG - Intronic
1167432088 19:49461005-49461027 CTGTGGAAGGAGTCTGTGGGAGG + Intronic
1167577349 19:50324155-50324177 CTGGGGAAGGGGGCACTGGAAGG - Intronic
1167687889 19:50968042-50968064 GTGGGGAAAGGGCATTTGGATGG - Intronic
1167940865 19:52944781-52944803 CTCGGAGAGGGGGATGTGGAAGG + Intronic
1168467445 19:56614883-56614905 CTGGGGATGGGGGTTGAGGAAGG - Intronic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168638393 19:58013744-58013766 CTTGGCAAGGGGGATGTGGCAGG + Intergenic
925280044 2:2677493-2677515 TTTGGGAAGAGGTATGTAGATGG + Intergenic
925460808 2:4061075-4061097 TTGGGGAAGAGGTATGTGGATGG + Intergenic
925499327 2:4486302-4486324 GTGGGGGAGAGGTATGTGGATGG - Intergenic
925738586 2:6985552-6985574 CTTAGGAAGGTGGATGTGGAAGG + Intronic
925772653 2:7298386-7298408 CTGGGGAAGACGTATGTGGATGG - Intergenic
925874264 2:8298584-8298606 CTGGGGCAGGGGCCTGTGGATGG - Intergenic
926215161 2:10901808-10901830 GTGGGGAAGGGGGATGATGAGGG + Intergenic
926515057 2:13832974-13832996 CTGGGGCAGGGGTGGGGGGAGGG + Intergenic
926826854 2:16914297-16914319 TTGGGGAAGAAGTATGTGGATGG + Intergenic
927008798 2:18880353-18880375 TTGGGGAAGAAGTATGTGGATGG + Intergenic
927660514 2:24989267-24989289 TTGGGGAAGAGGTATGTAGGTGG + Intergenic
927932334 2:27053050-27053072 ATGGGGAAGGGGTAGGAGGTGGG + Exonic
928406382 2:31018186-31018208 CTGGGCCAGGGGTACCTGGAGGG - Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929542240 2:42831280-42831302 CTGGGGAAGGGGCTGGTGGTGGG + Intergenic
929665664 2:43831999-43832021 CTGGGGGAGGTGTATGTGAACGG - Exonic
929904923 2:46037144-46037166 CTGGGGAGGGTGTCTGTGGCTGG - Intronic
930295130 2:49544753-49544775 TTGGGCAATAGGTATGTGGATGG - Intergenic
930536525 2:52651635-52651657 CTGGGGAAGAGGTATGTAGATGG - Intergenic
930545369 2:52760672-52760694 GTGGGGTAGGGGTAGGGGGAGGG + Intergenic
931224917 2:60321367-60321389 CTGGGGAAGTGCTGGGTGGAAGG - Intergenic
931255673 2:60569964-60569986 TTGGGGCAGGGTTAGGTGGAGGG - Intergenic
932427012 2:71644341-71644363 CTTGGGAAGGGGTAGGGGGCTGG - Intronic
932751320 2:74373492-74373514 CTGGGGAAGGGGGTTGGGGGAGG - Intronic
932804188 2:74768834-74768856 CTGGGGTCGGGGTATGAGGGTGG - Intergenic
932805323 2:74778195-74778217 GTGGGGCAGGGGGATTTGGAAGG + Intergenic
932921648 2:75921541-75921563 CTGGGGAAGGGAAAAGGGGAGGG + Intergenic
933265602 2:80177747-80177769 TTGGGGAAGAGGTATATAGATGG - Intronic
933394386 2:81712725-81712747 TTGGGGAAGAGGTATGTGGATGG - Intergenic
933906792 2:86902048-86902070 CTGGGGAAAGGTGATGTGGAAGG + Intergenic
934024684 2:87991586-87991608 CTGGGGAAAGGTGATGTGGAAGG - Intergenic
934534715 2:95123275-95123297 CTAGGAAACAGGTATGTGGATGG - Intronic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
935180497 2:100685616-100685638 CTTGGAAAGGGGGATGTGGCAGG - Intergenic
935184030 2:100715526-100715548 CTAGGGAAGAAGTATGTGGATGG + Intergenic
935438838 2:103067904-103067926 AGGGGCAAGAGGTATGTGGATGG + Intergenic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
935755960 2:106276298-106276320 CTGGGGATGGGGCCTGTGAATGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
936430470 2:112458209-112458231 CTGGGGAAGAGGTATATTGTTGG + Intergenic
936467470 2:112766036-112766058 CTGGAGAAGTCGTGTGTGGAGGG + Intergenic
936641313 2:114315318-114315340 TTGGGGAAGAGGTATATGGATGG + Intergenic
936933267 2:117812270-117812292 CTTGGGAAGGGGTCTGGGGATGG - Intergenic
936946338 2:117934333-117934355 CTGGGGTATGAGTAGGTGGAGGG - Intronic
937288689 2:120768879-120768901 CTGGGGATGGGCTCTCTGGAAGG + Intronic
937785115 2:125887097-125887119 TTGGGGAAGAGGTATGTGGATGG - Intergenic
937800460 2:126075754-126075776 TTGGAGAAGAGGTATGTGGATGG + Intergenic
937826544 2:126373314-126373336 CTGGGAGATGGGTATGTGGCAGG - Intergenic
937852481 2:126648107-126648129 TTGGGGAAGAGGTATGTGGATGG - Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938268005 2:129943117-129943139 CTGGGGAAAGGGAGTGTGGGAGG - Intergenic
938960001 2:136332211-136332233 GTGGGAAAGGTGCATGTGGAAGG + Intergenic
939069167 2:137518515-137518537 TTGGCGATGAGGTATGTGGATGG + Intronic
939213953 2:139212868-139212890 TTGGGGAAGAGTTACGTGGATGG + Intergenic
939788593 2:146545480-146545502 TTGGGGAAAAGGTATGTGGATGG - Intergenic
939857853 2:147382047-147382069 TTGGGGAGGCTGTATGTGGAGGG + Intergenic
940171227 2:150832081-150832103 CTGGGGAATAGTTATGTGGCTGG - Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940472005 2:154112496-154112518 TTGGGGAAGAGGGATGTGGATGG - Intronic
941668107 2:168261759-168261781 TTGGGGAAAAGTTATGTGGATGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942239454 2:173946227-173946249 CTGGGAAAGGGGTACATGGAAGG + Intronic
943317840 2:186411689-186411711 TTGGGGAAGAGGTATGTGGGTGG - Intergenic
943358204 2:186885320-186885342 CTGAGGAAGGGGTGTGTGCCTGG + Intergenic
943361032 2:186919608-186919630 CTTGGAAAGGAGTATGTGGATGG - Intergenic
943383983 2:187180462-187180484 TTGGGGAAGAGGTATGTGGATGG - Intergenic
943517510 2:188906627-188906649 TTGGGGAAGAGGTATGTGGATGG - Intergenic
943833528 2:192490516-192490538 TTGGGGAAGAGGTATGTGGATGG - Intergenic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944498190 2:200329696-200329718 GTGGGGAAGGGGGATGTGGGTGG - Intronic
944851205 2:203721460-203721482 CTGGGCAAGGGAGATGAGGAGGG - Intronic
945148935 2:206767676-206767698 CTGGGGATGGTAAATGTGGAAGG - Intronic
945293462 2:208147597-208147619 CTGGGGTAGAGGAATGTGCAGGG - Intergenic
945544950 2:211138774-211138796 TTGGGAAAGAGGTATGTGGATGG + Intergenic
945642264 2:212444466-212444488 CTGGGGAAGAGGTATGTGGGTGG + Intronic
945725765 2:213470872-213470894 TTGGGGCAGAGATATGTGGATGG - Intronic
946238454 2:218339961-218339983 CAGGGGCTGGGGTATGTGAAGGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946332873 2:219020151-219020173 CTGGGGAGGGTGAATGGGGAGGG - Intronic
946401836 2:219472359-219472381 GTGGGGAAGGGGTGTGGAGAAGG + Intronic
946441979 2:219704387-219704409 CTGGGGGAGGGCAGTGTGGAGGG - Intergenic
946703676 2:222437165-222437187 TTGGGGAAGAGGTATGTGGATGG - Intronic
947212467 2:227720685-227720707 CTTGGGATGGGGTATATAGAGGG + Intergenic
947440930 2:230120879-230120901 TTAGGGAAGAGGTATGTGGATGG + Intergenic
948258945 2:236588954-236588976 CCGGGGATGAGGTATGGGGATGG + Intergenic
948348791 2:237321511-237321533 CTTGGGGAGGGTCATGTGGAGGG + Intergenic
948910989 2:241002547-241002569 CTGGGGAAGTGGAATGGGGCTGG + Intronic
948914431 2:241025287-241025309 CTGGGGTGGGGGTGTGGGGATGG - Intronic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
1168732938 20:103293-103315 CTGGGGAAGGGGTAAGTAAGGGG + Intergenic
1168838092 20:891169-891191 CTGGTGAAGGGGCATGTGATTGG - Intronic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169596376 20:7204266-7204288 CTGGGGAAGGGAGAAGTGGAAGG - Intergenic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1171127844 20:22620010-22620032 TTGGGGGAGGGGAATGGGGAAGG + Intergenic
1171183911 20:23111387-23111409 CAGGGGAAGGGAGATGGGGAAGG + Intergenic
1171257010 20:23696964-23696986 CTGGGGTGGGGGTATGGGGGAGG + Intergenic
1171313544 20:24166287-24166309 CAGGGGGAGGGGTCAGTGGATGG - Intergenic
1171452411 20:25245518-25245540 CTGGGGGAGGGGTCAGTGGATGG + Intergenic
1172053773 20:32139897-32139919 CTGAGGAAGGGGTACTTGAAAGG - Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172940336 20:38649679-38649701 CTGGTGAAGGGCTCTGTGCAGGG + Intronic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173670429 20:44795044-44795066 CAGGGAAAGGGGTATGTTGTTGG - Intronic
1174137956 20:48393419-48393441 GTGGTGATGGGGTCTGTGGACGG + Intergenic
1174200245 20:48802122-48802144 GTGGGGATGGGGTGTGTGCAGGG - Intronic
1174819646 20:53715418-53715440 CTAGACAAGGAGTATGTGGAAGG + Intergenic
1175258299 20:57659858-57659880 CTGGGGCTGGGGTACGTGCAGGG + Intronic
1175503632 20:59467188-59467210 CCAGGGAAGGGGAATGGGGAGGG + Intergenic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176383195 21:6123972-6123994 CTGGGGAAGGGTCCTGAGGAGGG - Intergenic
1176554026 21:8245313-8245335 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176572948 21:8428337-8428359 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176998245 21:15580809-15580831 TTGGGGAAGAGATATGTGGATGG + Intergenic
1176998257 21:15580897-15580919 TTGGGGAAGAGATATGTGGATGG + Intergenic
1177139327 21:17341634-17341656 TTGGGGAAGATGTATGTGGATGG - Intergenic
1177329310 21:19635656-19635678 CAGGGGAAGGGGTACGAGGTGGG + Intergenic
1177913262 21:27056839-27056861 TTGGGAAAGAGGTATGTGGATGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178436942 21:32567929-32567951 CTGAGGAAAGGGTAAGTGAAGGG - Intergenic
1178486237 21:33021423-33021445 CTGGGGTGGGGGTGTGGGGAAGG + Intergenic
1178924328 21:36762350-36762372 CAGGGGTAGGGGTGTGTGGGTGG + Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179257061 21:39726371-39726393 CTGGGATAGTGGCATGTGGATGG + Intergenic
1179415062 21:41191908-41191930 TTGGGGAAGAGGGATGTGGATGG - Intronic
1179628376 21:42661382-42661404 CTGGGGGAGGGGGATGGGGAGGG - Intronic
1179740272 21:43414267-43414289 CTGGGGAAGGGTCCTGAGGAGGG + Intergenic
1180004284 21:45012906-45012928 CTGGGGAAGAGGTGTCTGGATGG + Intergenic
1180174754 21:46082192-46082214 CGGTGGACGGGGTCTGTGGAGGG - Intergenic
1180333660 22:11556101-11556123 CTTGGAGAGGGGTATGTGGCAGG + Intergenic
1180790705 22:18574094-18574116 CTGGGGGAGGGCTCTGAGGAGGG - Intergenic
1181231032 22:21421220-21421242 CTGGGGGAGGGCTCTGAGGAGGG + Intronic
1181247616 22:21513648-21513670 CTGGGGGAGGGCTCTGAGGAGGG - Intergenic
1181267753 22:21640918-21640940 CTGGGGGAGGGGTAGTTTGAGGG + Intergenic
1181367307 22:22387902-22387924 TTGGGGAAAAGATATGTGGATGG - Intergenic
1181420802 22:22797039-22797061 TTGGGGAAGAGCTATGTGGATGG - Intronic
1181982407 22:26774690-26774712 TTAGGGAAAGGGTAAGTGGATGG + Intergenic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183253062 22:36743980-36744002 AAGGGGAAGGGGTTTGGGGAGGG - Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183715500 22:39530956-39530978 CGGGGGGAGGGGCATGTGGAAGG + Intronic
1183720455 22:39558799-39558821 CTGGGGGAGGGGGCTGTGGTGGG + Intergenic
1184421342 22:44384499-44384521 GTGGGAAAGGGGTGTGGGGAGGG + Intergenic
1184455427 22:44607265-44607287 GTGGGGAAGGAGGATGGGGATGG + Intergenic
1184995032 22:48199239-48199261 CTGGGGAAGGGGGTGGGGGAAGG + Intergenic
1185000514 22:48242680-48242702 GTGGGGATGGGGCATGTGGAGGG - Intergenic
1185127337 22:49018441-49018463 CAGGGGAGGAGGTCTGTGGAAGG + Intergenic
1203259031 22_KI270733v1_random:162351-162373 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
949125577 3:442483-442505 TTGGGGAAGAGTTATGTGGATGG - Intergenic
949169950 3:985970-985992 TTGGGGACGAGGTATGTGGATGG - Intergenic
949217131 3:1583526-1583548 CTGGGAAAGGGGCCTGTGGCTGG - Intergenic
949245961 3:1925554-1925576 TTGGGGAAGAGGTATGTGGATGG + Intergenic
949465457 3:4339061-4339083 CTGAGGAAGTAGTTTGTGGAAGG - Intronic
949638992 3:6014145-6014167 TTGGGGAAGAGGTAGGTGGATGG + Intergenic
949949624 3:9218418-9218440 CTGGGCATGGTGTATATGGACGG - Intronic
950092077 3:10303025-10303047 CTGGGGAGGGGCAATGGGGAAGG + Intronic
950557675 3:13705171-13705193 TTGGGGTTGGGGCATGTGGAGGG + Intergenic
950890850 3:16402418-16402440 CTGGGGAGGGGGGTTGTTGAGGG - Intronic
950891748 3:16410369-16410391 ATGGGGAAGGCTTATGTGGATGG + Intronic
951204273 3:19909548-19909570 CTGGGGGTGGGGTAGGTGGTGGG + Intronic
951291434 3:20876114-20876136 TTGGGGAAGAGGTATGTGGATGG - Intergenic
951384609 3:22028148-22028170 TTGGGGAAGAGGTATGTGGATGG + Intronic
951758303 3:26117494-26117516 TTGGGGAAGGGGTGAGTGAAGGG + Intergenic
951970677 3:28441259-28441281 TTGGGGAAGAGGTATGTGGATGG - Intronic
952636956 3:35544554-35544576 CTTGGGAAGGTGTCTTTGGAGGG + Intergenic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953381769 3:42477619-42477641 CTAGGGGAGGTGAATGTGGAGGG - Intergenic
953578738 3:44134486-44134508 GTGGGAAAGTGGGATGTGGAAGG + Intergenic
953922336 3:46960821-46960843 CTGCTGAAGGTGTATGTGTAGGG + Intronic
953927937 3:46991830-46991852 ATGGGGATGGCGTCTGTGGAAGG - Exonic
954054247 3:48008587-48008609 TTGGGGAAGAGGTATGTGGATGG + Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954539661 3:51385187-51385209 ATGGGGAAGTGGCATGTGGGAGG + Exonic
954849149 3:53585720-53585742 CTGGGGAGGGGCTATTGGGAGGG + Intronic
956051848 3:65256665-65256687 CTGGGGAAGGGGGGTGGGGTGGG - Intergenic
956376844 3:68622243-68622265 CTGAAGAAGGAGTATGTGAATGG - Intergenic
956509749 3:69981002-69981024 TTGGGGAGGAGGTATGTGGATGG + Intergenic
956728880 3:72178370-72178392 CTGGGGAAGGGGTAGGGTGGGGG + Intergenic
957247482 3:77733266-77733288 TTGGGGAAGAGGTATGTGGATGG - Intergenic
957383615 3:79467407-79467429 ATGGGAGAGGGGTTTGTGGAGGG - Intronic
957385810 3:79495588-79495610 AGGGGGAAGTGTTATGTGGAAGG + Intronic
958258924 3:91356103-91356125 TTGGGGAAGAGGTATGTTGATGG - Intergenic
958470901 3:94517743-94517765 CTAGGGAAGGACTATGTAGAGGG + Intergenic
958487591 3:94731845-94731867 TTGGGGAAGAGGTATGAGAATGG - Intergenic
958893884 3:99809045-99809067 CTGAGGAAGAGGCATGTGGAGGG - Intergenic
958934393 3:100241242-100241264 TTGGGGAAGAGATATGTGGATGG + Intergenic
959203567 3:103278618-103278640 TTAGGGTAGAGGTATGTGGAGGG - Intergenic
959237768 3:103746503-103746525 TTGGAGAAGAGGTATGTAGATGG - Intergenic
959745930 3:109776643-109776665 TTGAGGAAGAAGTATGTGGATGG - Intergenic
959997950 3:112698950-112698972 TTGGGGAAGAAGTATGTGAATGG + Intergenic
960349610 3:116576331-116576353 TTGGGGAAGAAGTATGTGGATGG + Intronic
960494657 3:118360124-118360146 TTGGGGAAGAGGTAAGTGGGTGG - Intergenic
960510140 3:118540048-118540070 CTCGGGGAGGGGAATGTGGCAGG + Intergenic
960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG + Intronic
961411678 3:126726804-126726826 CTGAGGACTGGGTGTGTGGAGGG + Intronic
961472253 3:127122915-127122937 CTGGGGAGGAGATATGTGGGCGG + Intergenic
961584793 3:127913519-127913541 TTGGGGGAGGGGGATGGGGACGG - Intergenic
961602680 3:128073336-128073358 CTGGGGGCGGGGTATGGGGTAGG - Intronic
961710888 3:128827402-128827424 TGGGGAAAGAGGTATGTGGATGG - Intergenic
962368968 3:134805109-134805131 CTGGGGATGGGGGATTGGGAAGG + Intronic
962611593 3:137081748-137081770 CTGGGGAATGAGAATGTGGTGGG + Intergenic
963021860 3:140879438-140879460 CTGAGGAAGAGGCATGTGGCTGG + Intergenic
963331726 3:143922744-143922766 TTGGGGAACAGGTATGTGGATGG - Intergenic
963582714 3:147147170-147147192 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
963630393 3:147723852-147723874 TTGCGGAAGAGTTATGTGGATGG + Intergenic
963792237 3:149595557-149595579 CTAGGCAAGGGGTATATGGTGGG + Intronic
963970229 3:151421325-151421347 TTGGGGAAGAGGTATGTGGCTGG - Intronic
964432403 3:156621145-156621167 CTGGGAGATGGGTATGTGGCAGG + Intergenic
964505614 3:157395663-157395685 TTTGGGAAGAGATATGTGGATGG - Intronic
964679148 3:159318285-159318307 TTGGGGAAGAGGTATGTGGATGG - Intronic
965226677 3:166000143-166000165 TTGGGGAAGAAGTATGTGGCTGG - Intergenic
965291662 3:166888962-166888984 TTGGGTAAGAGGTATGTGGATGG - Intergenic
965872433 3:173278173-173278195 CTGGAGGAGGGATATGTGGTTGG - Intergenic
966243024 3:177775505-177775527 CTGGAGAAAGGGTATGGGGGAGG + Intergenic
966445776 3:179999189-179999211 TTGGGGAAAAGGTATGTGGATGG + Intronic
967864530 3:194179454-194179476 CGGGTGAAGGGATATGGGGAAGG - Intergenic
967911555 3:194546393-194546415 CTGGGGCCTGGGTATGGGGAGGG - Intergenic
968072010 3:195789925-195789947 CTGTGGGAGGAGTATGTGGTGGG + Exonic
968647983 4:1749410-1749432 GTGGGGAAGGGGGAGGTGGGGGG - Intergenic
968662873 4:1806028-1806050 CTGGGGAAGGGGTGGGAGGCAGG - Intronic
968800275 4:2738762-2738784 TTGAGGAAGAGGTATGTGGATGG + Intergenic
968907094 4:3459042-3459064 TTGGGGAAGAGGTATGTGGATGG + Intergenic
969343402 4:6556613-6556635 CTGGGGAAGAGGTGTGTGGATGG - Intronic
969352019 4:6603530-6603552 GTGGGGAAGGGGTGTGTGTGGGG - Intronic
969543221 4:7806965-7806987 CGGGGGAAGGGATAAGGGGAAGG + Intronic
969579270 4:8054574-8054596 CTGAGGAGGGGGTATTTGAAGGG + Intronic
969940367 4:10725542-10725564 CTGGGGAGGGGAAATGGGGATGG - Intergenic
970701794 4:18750142-18750164 CAGGCGAAAGGGTATGTGCAGGG + Intergenic
971100928 4:23465792-23465814 CTGGGGAAGAGGTATGTGAATGG - Intergenic
971611288 4:28730359-28730381 CTAGGGAGGGTGTAGGTGGAAGG - Intergenic
971687302 4:29786458-29786480 TTGGGGAAGACGTATGTGGATGG - Intergenic
971817312 4:31505702-31505724 TTGGGGAAGAGGTATGTGAATGG + Intergenic
971979216 4:33732244-33732266 TTGAGGAAGAGGTATGTAGATGG - Intergenic
972085306 4:35207726-35207748 TTAGGGAAGAAGTATGTGGATGG + Intergenic
972109552 4:35541135-35541157 CTGGGGAAGGGGTGAGTGAAGGG + Intergenic
972190825 4:36588527-36588549 CAGGGAAAGGGGTAGGTGTAGGG - Intergenic
972201219 4:36716554-36716576 TTAGGGAAGAGGTATGTAGATGG - Intergenic
972464066 4:39335781-39335803 GTGGGGAAGATGTATGTGAATGG - Intronic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
972828666 4:42788957-42788979 ATGGGGAAGAGGCATATGGATGG + Intergenic
972882882 4:43447548-43447570 TTGAGGAAGAAGTATGTGGATGG - Intergenic
973052291 4:45610778-45610800 CTGGTGGAGGGATATGTGGTTGG - Intergenic
973102999 4:46295371-46295393 TTGAGGAAGAAGTATGTGGATGG + Intronic
973118525 4:46489673-46489695 TTGGGGAAAAGGTATGTGGTTGG + Intergenic
973120911 4:46520275-46520297 TTGGGGAAGAGGTACGTGGATGG - Intergenic
973130101 4:46639068-46639090 TTGGGGAAGAGGTATGTGGATGG - Intergenic
973926881 4:55747877-55747899 CTGGGGATGGGGAGTATGGAAGG + Intergenic
974043434 4:56877599-56877621 CTGGGGAAGGGGGATAGGAAGGG - Intergenic
974289650 4:59913372-59913394 TTGGGGAAGAGGTATGTGGATGG + Intergenic
974564876 4:63568939-63568961 TTGGGAAAGAGGTATGTGGATGG + Intergenic
974746825 4:66088275-66088297 TTGGGGAAGAGGTATGTGGATGG - Intergenic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975131025 4:70833117-70833139 ATGGGCCAGCGGTATGTGGAAGG - Exonic
975629289 4:76383353-76383375 ATGGTGAGGGGGTCTGTGGATGG - Intronic
975664146 4:76717632-76717654 GTGGGGCAGGGGTATGGGCAAGG + Intronic
975982519 4:80176650-80176672 TTGGGGAAGAGGTACATGGAAGG - Intergenic
976034124 4:80795192-80795214 TTGGAGAATAGGTATGTGGATGG - Intronic
976609126 4:87011149-87011171 CTGGGGCAGGGGTGTATGCATGG + Intronic
977031734 4:91892438-91892460 TTGGGAAAGAGGTATGTGGACGG + Intergenic
977466091 4:97384004-97384026 TTGGGGAAGAGGTTTGTGGTTGG + Intronic
977489996 4:97699445-97699467 TTATGGAAGAGGTATGTGGATGG - Intronic
977833143 4:101617208-101617230 TTGGGGAAGAGGTATGTGGATGG - Intronic
977929340 4:102734473-102734495 CTTGGGAATGGGTATGATGATGG - Intronic
977930320 4:102743190-102743212 TTGGGGAAGAGGTACGTGGGTGG - Intronic
978088367 4:104683661-104683683 CTGGTCAAGGGCTGTGTGGAAGG + Intergenic
978341495 4:107724919-107724941 TTGGGGAAGAGGTATGTGGATGG - Intergenic
978772071 4:112467158-112467180 TTGGGGAAGAGGTACATGGATGG - Intergenic
978898982 4:113926183-113926205 TTGGGGAATAGGTATGTGGATGG - Intronic
978966939 4:114751552-114751574 TTGGGGAAGAGGTATGCAGATGG + Intergenic
979562957 4:122120609-122120631 CTGGGATAGAGGCATGTGGATGG + Intergenic
979898329 4:126188438-126188460 TTGGGGAAGAGGTATGTGGATGG - Intergenic
980385700 4:132086407-132086429 TTGAGGAAGAGGTATGTGGATGG - Intergenic
980387860 4:132110551-132110573 TTGGGGAAGAGCTATGTGCATGG - Intergenic
980405806 4:132353160-132353182 TTGGGGAAGAGGTATGTGCATGG - Intergenic
980629605 4:135414921-135414943 TTGGGGAAGAGTTATGAGGATGG + Intergenic
981251401 4:142606254-142606276 GTGGGGAAGGGATATATGAAGGG + Intronic
981422784 4:144570560-144570582 CTGGGGAAGGGGTGCATGGATGG + Intergenic
981462900 4:145032423-145032445 TTAGGGAAGAGGTATGTGGATGG + Intronic
981835089 4:149044569-149044591 TTGAGGAAGGGGTATGTGGATGG + Intergenic
981873624 4:149515829-149515851 TTGGGGAAAAGGTATGTGGATGG + Intergenic
982300995 4:153879406-153879428 CTGGGGAAGAGATATGTGGATGG + Intergenic
982317692 4:154048060-154048082 TTGGGGAAAGGGTGGGTGGAGGG + Intergenic
982597686 4:157406415-157406437 TTGGGGAAGAGGTATGTGGATGG - Intergenic
982623251 4:157732254-157732276 GTGGGGAAGAGGTGTGTGGATGG - Intergenic
983185152 4:164692203-164692225 TTGGGGAAGAGGTATGTGGAAGG + Intergenic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
983582766 4:169325442-169325464 TTGGGGAAGAAGTATGTGGATGG + Intergenic
984060199 4:174981396-174981418 TTTGGGAAGAGGTATGTGGATGG - Intergenic
984500204 4:180549173-180549195 GGGGGGAAAGGGTAAGTGGAAGG - Intergenic
984806789 4:183758540-183758562 CTGGGGACGGGGCGTGGGGAAGG + Intergenic
985084342 4:186297570-186297592 CAGGGGTAGGGGTGTGGGGAGGG - Intergenic
985208348 4:187565496-187565518 ATGTGGAGGGGGTTTGTGGAGGG - Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986025663 5:3848044-3848066 TTGACGAAGAGGTATGTGGATGG + Intergenic
986087193 5:4463347-4463369 TTGGGGAAGAGGTGTGTGGATGG + Intergenic
986261542 5:6151893-6151915 TTGGGGAAGAGGTATGTGGATGG - Intergenic
986307868 5:6528938-6528960 CTGGGGAGAGGGTACCTGGAAGG - Intergenic
986531315 5:8739697-8739719 TTGGAGAAGAGGTATGTGAATGG - Intergenic
986743038 5:10720389-10720411 TTGGGGAAGAGGTATGTGGATGG + Intronic
986879088 5:12147840-12147862 AGGGGGAGGGGGTATGGGGAAGG - Intergenic
987061382 5:14247063-14247085 GTGGGGAAGGGGGAGGTGGGGGG - Intronic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987466172 5:18274900-18274922 TTGGAGAAGAGGTATGTGGATGG - Intergenic
987468059 5:18296015-18296037 TTGGGGAAGAGGTATGTGGATGG - Intergenic
987578254 5:19757680-19757702 TTGGGGAAGAGTTATGTGGGTGG - Intronic
987657060 5:20821020-20821042 TTGGGGAAGAGGTATGTGGCTGG - Intergenic
988079743 5:26400797-26400819 TTGGAGAAGAGGTATGTGTATGG - Intergenic
988107837 5:26773175-26773197 TTGGGGAAGAGGTATGTGGATGG + Intergenic
988188869 5:27901871-27901893 TTGGGGAAGAGGTATGTGGATGG + Intergenic
988228302 5:28443184-28443206 TGGGGGAAGAGGTATGTGAATGG - Intergenic
988562217 5:32291467-32291489 TTGGGGAAGAGTTATATGGATGG + Intronic
988766491 5:34382928-34382950 TTGGGGAAGAGGTATGTGGCTGG + Intergenic
989045118 5:37266961-37266983 TTGGGGAAGAGGTATGCGGATGG - Intergenic
989085558 5:37672668-37672690 CTTGGCAAGGGGAATGTGGCAGG - Intronic
989189974 5:38661134-38661156 GTGGGGGTGGGGTATGTGTATGG + Intergenic
989307413 5:39973993-39974015 TTGGGGAAGAGGCATGTGGATGG - Intergenic
989457561 5:41661138-41661160 TTGGGGAAGAAGTATGTGGATGG - Intergenic
990185312 5:53204450-53204472 CTGGAGGAGGGATATGTGGTCGG - Intergenic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
990642815 5:57806846-57806868 CTGGGGAAAGGTTATGGGCAGGG + Intergenic
991013709 5:61910258-61910280 TTGGGGAAGAGGTTTGTGGATGG - Intergenic
991033639 5:62106553-62106575 TTGGGGAAGAGGTATGTGGCTGG + Intergenic
991146529 5:63312543-63312565 CAGCCTAAGGGGTATGTGGAAGG + Intergenic
991330653 5:65489054-65489076 TTGGGGAAGAGGTATGTGGATGG - Intergenic
991461681 5:66865134-66865156 CTGGGGAAGGTGGATTTGGTGGG + Intronic
991628862 5:68633884-68633906 CTGGGGTAGGGGTTTGCGGAAGG + Intergenic
991654161 5:68886367-68886389 CTGGGGTGGGGGTAGGGGGAGGG - Intergenic
991671552 5:69053418-69053440 CTAGGTCATGGGTATGTGGATGG - Intergenic
992004627 5:72465363-72465385 CTGGGGAAGGGGAGTGTTGAAGG + Intronic
992243040 5:74790482-74790504 TTGGGGAAGAGGTATGTGGATGG + Intronic
992534843 5:77689421-77689443 CTTGGGAAGGGGTGGGTGGGTGG - Intergenic
992638403 5:78747479-78747501 GTGGGGAGGGGGTGTGTGGTGGG - Intronic
992747425 5:79833411-79833433 CTGGGGGTGGGGTATGGCGAAGG + Intergenic
993203479 5:84848171-84848193 TTGGGGAAGAGATATGTGGATGG + Intergenic
993231825 5:85246909-85246931 TTGGTGAAGAGATATGTGGATGG - Intergenic
993319907 5:86459208-86459230 TTGGGGAAGGGGTACAAGGATGG + Intergenic
993367384 5:87050333-87050355 TTGGGGAAGAGGTAAGTGGATGG - Intergenic
993412491 5:87591186-87591208 TTGGAAAAGAGGTATGTGGATGG - Intergenic
993791865 5:92219538-92219560 TTGGAGAAGAGTTATGTGGATGG + Intergenic
994291282 5:98031321-98031343 GTGGGGAAGAGGTATGTGGATGG - Intergenic
994475000 5:100256538-100256560 CTGGGGAGGGGGTGGGTGGGTGG - Intergenic
994729638 5:103476723-103476745 CTGGGGAAGGGGGTGGTGGGGGG - Intergenic
994984330 5:106915098-106915120 TTGGGGAAGAGGTACGTGGATGG - Intergenic
995039016 5:107567554-107567576 CTGGGGCAGGGGTGGGTGGATGG - Intronic
995427644 5:112043096-112043118 TTGGGGAAGAGGTATGTAGATGG - Intergenic
995456457 5:112357803-112357825 CTAGGGAAGAGCTATGTGGATGG + Intronic
995570406 5:113474268-113474290 CTGGTGTAGGAGTATGTGCAAGG + Intronic
995776197 5:115727068-115727090 TTGGGGAAGAGTTATGTAGATGG - Intergenic
995894415 5:116995476-116995498 GTAGGGAAGGGGTATCTGGCAGG + Intergenic
995911776 5:117196304-117196326 CTGGGGTAGGGGTTGGGGGATGG + Intergenic
995946012 5:117646812-117646834 CTGGGGAAGGGTTGGGTGGAGGG - Intergenic
996016005 5:118534660-118534682 CTGGGGAAACGGGAAGTGGAGGG - Intergenic
996018646 5:118568490-118568512 TTGGGGAAGAGGTATGTGGATGG + Intergenic
996164876 5:120211887-120211909 TTGGGGAAGAGGTATGTGTATGG - Intergenic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
996423266 5:123285661-123285683 AAGGGGAAGGGGTGGGTGGAGGG - Intergenic
996726253 5:126675444-126675466 CTGGTGAGGGGGTATGGGCAGGG - Intergenic
996774492 5:127119303-127119325 CTGGGGTAGAGGCATGTGGATGG + Intergenic
996825652 5:127678470-127678492 TTGGGGAAGAGGTATGTGGATGG + Intergenic
997181939 5:131838563-131838585 TTCAGGAAGGTGTATGTGGAGGG + Intronic
997438525 5:133892374-133892396 CAGGGGCAGGGGTGGGTGGATGG - Intergenic
997668592 5:135651899-135651921 CTGGGGAAGATATATATGGATGG + Intergenic
997857726 5:137388381-137388403 CAGGGTAAGGGGTATGTGGCGGG + Intronic
998001656 5:138630650-138630672 CTGGGGCAGGGGGCTGTGGTGGG - Intronic
998129778 5:139645860-139645882 TTGGGGAAGGGGGCTGTGGTGGG + Intergenic
998290248 5:140907924-140907946 TTGGGGAAAAGGTATGTGAATGG - Intronic
999351457 5:150875464-150875486 TTGGGAAATAGGTATGTGGATGG + Intronic
999384436 5:151144406-151144428 CTGGGGCAGGGGTGTGTGGGCGG + Intronic
1000125270 5:158237606-158237628 CTGGAGAAGTGGGGTGTGGAGGG + Intergenic
1000136810 5:158361226-158361248 GTGGGAAATGGGTATGTGGTAGG - Intergenic
1000180517 5:158805970-158805992 CTGGGGCAGGGGTATGGGTGTGG + Intronic
1000411389 5:160937560-160937582 CTGGGAGATGGGTATGTGGCAGG - Intergenic
1000417055 5:160994530-160994552 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1000486392 5:161849056-161849078 CTGGGGGAGGGGGAGGTTGAAGG + Intronic
1000999633 5:167993737-167993759 CTGTGGAAGGGATATGGGCAAGG - Intronic
1001288402 5:170439727-170439749 CTGGGGAAGGGGAATGTTGCTGG - Intronic
1001430741 5:171660034-171660056 CTGGGGATGGGGGGTGGGGAAGG - Intergenic
1001568449 5:172715147-172715169 CTGGGGAAGTGGGATGGGAAGGG + Intergenic
1001831576 5:174793759-174793781 CTGGGGTAGGGGACTGCGGAGGG - Intergenic
1002052117 5:176577095-176577117 CTGGGGGTGGGGGATGTGAAGGG + Intronic
1002316483 5:178347425-178347447 TGGGGGGAGGGGTATGGGGAGGG + Intronic
1002381627 5:178833402-178833424 TTGGGGGGGGGGTACGTGGAGGG + Intergenic
1002845212 6:939282-939304 CTTGGCAAGGGGCATGGGGAGGG + Intergenic
1002998055 6:2305389-2305411 TTGGGGAAGAGGTATGCAGATGG + Intergenic
1003507481 6:6751700-6751722 CTGGGGGAGGGGGAGGGGGAGGG - Intergenic
1003695808 6:8405520-8405542 TTGGGGAAGAAGTATGTGGAGGG - Intergenic
1003758698 6:9150709-9150731 TTGGGGAAGAGGTATGTGGAGGG + Intergenic
1003791317 6:9550676-9550698 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1004824205 6:19402603-19402625 TTGGGGAAGAGATATGTGGATGG - Intergenic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005185259 6:23157694-23157716 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1005495385 6:26383487-26383509 CTCGGGGAGGGGGAAGTGGAGGG + Intronic
1005695184 6:28345216-28345238 CTGGGAAAGAGTCATGTGGATGG + Intronic
1005721981 6:28611614-28611636 GTGGGGAAGAAGTATGTAGAGGG - Intronic
1005886409 6:30101050-30101072 CTGGGGACTGGGTAGGCGGATGG - Intergenic
1005901611 6:30221528-30221550 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1006001637 6:30969703-30969725 GTGGGAAAGAGTTATGTGGATGG + Intergenic
1006062434 6:31433842-31433864 TTGGGGAAGAGGTTTGTGGATGG + Intergenic
1006321609 6:33322696-33322718 CTGGGGGAGGGGGATTTGGCGGG - Intronic
1006408831 6:33860280-33860302 CAGCGGAAGGGGTGTGTGGTGGG + Intergenic
1006612209 6:35300940-35300962 GGGGTGAAGGGGTATGTAGATGG + Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1007062623 6:38955718-38955740 ATGAGGGAGGGATATGTGGAGGG - Intronic
1007079338 6:39087629-39087651 CTGGGGAAAGGTTTTGGGGAGGG - Exonic
1007094043 6:39202462-39202484 CTGGGGAAGGGGCAAGGTGAGGG + Intronic
1007407849 6:41645081-41645103 TTGGGGAGGGGGCAGGTGGAAGG + Intronic
1007719988 6:43879199-43879221 CTGGGGCTGGGGTGTGTGTAGGG - Intergenic
1007775880 6:44223991-44224013 CTGGCGGAGGGGTATGGGGATGG + Intronic
1008079291 6:47177940-47177962 TTGGGGAAGAGGCATGTGGATGG - Intergenic
1008340360 6:50356996-50357018 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1008400371 6:51056095-51056117 TTGGGGAAGAAGTATGTGGATGG + Intergenic
1008996329 6:57664470-57664492 TTGGGGAAGAGGTATGTTGATGG + Intergenic
1009184848 6:60563263-60563285 TTGGGGAAGAGGTATGTTGATGG + Intergenic
1009390021 6:63134445-63134467 TTGGGGAAATGGTATGGGGATGG - Intergenic
1009660602 6:66606300-66606322 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1009851835 6:69208326-69208348 TTGGGGAAGAGGTATGTTGGTGG - Intronic
1010016065 6:71105844-71105866 CTGGGGAAGAGACATGGGGAGGG - Intergenic
1010107860 6:72189940-72189962 CTGGGGAAGAGGTACGTGGATGG - Intronic
1010325245 6:74555969-74555991 TTGGGGAACAGGTATGCGGATGG - Intergenic
1010390639 6:75332736-75332758 CTGTGGGAGGTGTATGTGGAAGG - Intronic
1010433742 6:75807437-75807459 TTGGGGAGTGGGCATGTGGAGGG + Intronic
1010818713 6:80389036-80389058 TTGGGGAAGAGATATGTGGATGG + Intergenic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1011268206 6:85548160-85548182 CTGGAGATGGGGAATGGGGATGG + Intronic
1011361235 6:86527024-86527046 CTTGGGAAGGGGTGAGTGAAGGG - Intergenic
1011481544 6:87798834-87798856 CTTGCCACGGGGTATGTGGATGG + Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012464045 6:99497247-99497269 ATGGGGAAGGGGGAGGTAGAGGG + Intronic
1013309307 6:108878993-108879015 CAGGTGGATGGGTATGTGGATGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013377303 6:109530005-109530027 ATGGGGAAAGTGTATGTGGTTGG + Intronic
1013406754 6:109850430-109850452 TTGGGGAACAGGTATGTGGATGG + Intergenic
1013723623 6:113064002-113064024 CTGGGGCAGGGGTAAAAGGAGGG - Intergenic
1014363317 6:120507723-120507745 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1014417074 6:121196018-121196040 TTGGGGAAGAAGTATGTGGATGG + Intronic
1014422866 6:121266911-121266933 GTGGGGAAGGGGCAAGGGGAGGG + Intronic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1014631728 6:123797430-123797452 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015475837 6:133658113-133658135 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1015937634 6:138418953-138418975 CTGGGGTAGAGGCATGTGGATGG + Exonic
1016119841 6:140332063-140332085 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1016147240 6:140692084-140692106 TTGGGGAAGAGATATGTAGATGG - Intergenic
1016167932 6:140971021-140971043 CTTGGGAGGGTGTATGTGTAAGG + Intergenic
1016245926 6:141980768-141980790 CTGTGGTAGGAGTATGTGTAAGG - Intergenic
1016292532 6:142540276-142540298 CTGGAGGAGGGATATGTGGTTGG - Intergenic
1016419528 6:143870040-143870062 TTGGGGAAGAGGTATGTGGATGG - Intronic
1016437541 6:144052746-144052768 GTGGGGGAGGGGGTTGTGGAGGG + Intronic
1016576177 6:145571959-145571981 TTGGGGAATAGGTAGGTGGATGG - Intronic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017227718 6:152040462-152040484 TTGGGGAAGAGGTATGTGGATGG - Intronic
1017352629 6:153459643-153459665 CTGAGGAAGGGGTAAGTGAAGGG - Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017931518 6:158959464-158959486 CTGGGGAGGGAGTCTGTGGAAGG + Intergenic
1018144870 6:160876801-160876823 CTGAGGAAGGGGTAAGTGAAAGG + Intergenic
1018454714 6:163941538-163941560 CTGGGGTTGGGGTGTGGGGATGG + Intergenic
1018534941 6:164809870-164809892 TTGGGGAACAGGTAGGTGGATGG - Intergenic
1018554045 6:165032676-165032698 CAGGGTAGGGGGTCTGTGGATGG - Intergenic
1018570902 6:165208675-165208697 TGGGGGAGGGTGTATGTGGATGG + Intergenic
1018599978 6:165528166-165528188 TTGGGGAAGAGGTATGTGGATGG + Intronic
1018612536 6:165660310-165660332 GTGGGGAAGGGGTGTGGAGATGG - Intronic
1018726727 6:166618423-166618445 GTGTGGAAGGGGTATGGGTAGGG + Intronic
1019153801 6:170025753-170025775 ATGGGGAGGGAGCATGTGGACGG + Intergenic
1019186922 6:170226005-170226027 CTGGGGCAGGGCTGTGGGGATGG - Intergenic
1019287273 7:229983-230005 ATGGGGTAGGGGGATGGGGAAGG + Intronic
1019472653 7:1229696-1229718 CGGGGGAAGGGGCAGGCGGAAGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019525112 7:1477294-1477316 GTGGGGATGGGGTGGGTGGATGG - Intronic
1020396806 7:7726139-7726161 TTGGGGAAGAGATATGTGGATGG + Intronic
1020509625 7:9037387-9037409 CACGGGAAGGGGGTTGTGGAGGG - Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021379352 7:19948863-19948885 GTGGGGTGGGGGGATGTGGAAGG - Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1021840308 7:24717058-24717080 CTGGGGGAGGGGTGTGGTGAGGG - Intronic
1021904856 7:25323045-25323067 CTGGGGAAGGGGATAATGGAGGG + Intergenic
1022078973 7:27000960-27000982 TTGGGGAAGAGGTATGTGTATGG + Intergenic
1022933801 7:35151485-35151507 CTAGGGAAGTGGTGTATGGAGGG - Intergenic
1023475486 7:40573423-40573445 CTGGGTAAGGTGGATGGGGAGGG - Intronic
1024157237 7:46638189-46638211 CTGGAGAGGGGCTATGAGGATGG - Intergenic
1024201212 7:47108131-47108153 CTGGGAAAGTGGTATGTTTATGG + Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024744297 7:52389053-52389075 CCGGGGAAGAGGTATGTGGATGG + Intergenic
1024866186 7:53906975-53906997 TTGGGGAAGAGGTATGTGAATGG + Intergenic
1025712861 7:63927828-63927850 CTGGGGAAAGGGTGTGAGGCAGG - Intergenic
1026989156 7:74573508-74573530 CTGGGGAAAGGGTTTCTGGGAGG - Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1027685888 7:81278586-81278608 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1028124625 7:87097746-87097768 GTGGGGTAGGGGTAGGGGGAGGG + Intergenic
1028237913 7:88383452-88383474 TTGGAGAAGAGGTATGTGGATGG + Intergenic
1028516974 7:91688445-91688467 TTGGAGATGGGGCATGTGGAAGG - Intergenic
1028536108 7:91889651-91889673 CTCGGAGAGGGGTATGTGGCAGG - Intergenic
1028581718 7:92416021-92416043 CTCTAGAAGGGCTATGTGGATGG - Intergenic
1028622096 7:92836368-92836390 CTGTGGGTGGGGTAAGTGGAGGG - Intronic
1028652055 7:93160989-93161011 CTGGGGAAGAGGCATATGAATGG + Intergenic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1028935103 7:96455694-96455716 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1029148484 7:98463569-98463591 TTGGGGAGGGGGCAGGTGGAGGG + Intergenic
1029241220 7:99164487-99164509 GTGGGGTAGGGGTAGGGGGAGGG + Intergenic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1030192359 7:106822293-106822315 TTGGGGAAGAGATATGTGGATGG + Intergenic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030457377 7:109792421-109792443 TTGGGGAAGGGATATGTGAATGG - Intergenic
1031031245 7:116737811-116737833 CTGGGAAAGGACTATTTGGATGG + Intronic
1031236914 7:119188654-119188676 TTGGGGAAGAAATATGTGGATGG + Intergenic
1031474364 7:122204729-122204751 TTGGGGAAGAGGTATGTGGGTGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031542813 7:123015902-123015924 GTGGGGTAGGGGTATGGGGGAGG - Intergenic
1031682123 7:124687980-124688002 TTGGGGAAGAGATATGTGGATGG + Intergenic
1031913609 7:127542508-127542530 CTGGGGAAGAGGCATGTGGCTGG + Intergenic
1032018251 7:128393080-128393102 CTGGGGAAAGGGTTTTGGGAAGG - Intronic
1032463358 7:132127725-132127747 CTGGGGGAGGGGTTTGGGGCTGG - Exonic
1032474838 7:132204592-132204614 CTGGGCTAGGGGGATGTTGATGG + Intronic
1032581195 7:133105138-133105160 CTGGGGCGGGGGTGGGTGGAGGG - Intergenic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1032923396 7:136575499-136575521 TTAGGGAAGAGGTATGTGGATGG - Intergenic
1033012240 7:137635010-137635032 CTAGGGAAGAGGTATAAGGAAGG + Intronic
1033076346 7:138253675-138253697 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1033392309 7:140939730-140939752 TTGGGGAAGAGATATGTGGGTGG + Intergenic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1034404384 7:150892362-150892384 CTGGGGAAGGGGCATGGGAGAGG + Intergenic
1034760481 7:153667687-153667709 CTGGGGCAGGGCTATCTGGGTGG + Intergenic
1034937383 7:155208844-155208866 GTGGGGAATGGGTGTGTGGGGGG + Intergenic
1034962783 7:155372909-155372931 CTGGGGGAGGCGGATGTGGGCGG - Intergenic
1034964205 7:155381731-155381753 CGGGGGAAGGGGGATGTCCACGG - Intergenic
1035242391 7:157540717-157540739 CTGGGGAAGGGCCTTGAGGATGG + Exonic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1035892443 8:3359589-3359611 CTGGGAAGGGGGTGTATGGAGGG + Intronic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036787413 8:11697460-11697482 CTGGGGAAGCGGTGTTCGGAGGG + Intronic
1037134160 8:15442630-15442652 TTGGGGGAGGTGTCTGTGGATGG - Intronic
1037726049 8:21483298-21483320 TTGGGGAAGGGAGGTGTGGATGG - Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037769399 8:21789751-21789773 CTGGGGAAGGGGCATCTCGAAGG - Intronic
1037881312 8:22574803-22574825 CTGGGGAAGGAGGATGTGGGCGG - Exonic
1037901515 8:22692026-22692048 CTGGGGCCGGGGTAGGTGAAGGG - Intronic
1037952431 8:23027911-23027933 CTGAGGAAGGGGGATGAGAAGGG + Intronic
1037963654 8:23117476-23117498 CTGAGGAAGGGGGATGAGAAGGG - Intergenic
1037967399 8:23145246-23145268 CTGAGGAAGGGGGATGAGAAGGG + Intronic
1038454367 8:27663008-27663030 TTAGGGAAGAGGTCTGTGGACGG - Intronic
1038804661 8:30779071-30779093 CTGGGGAAGGGGTGAGGGCATGG + Intronic
1039120862 8:34144683-34144705 TTGGGGATGGGGTAGGTGGGTGG + Intergenic
1039244149 8:35589644-35589666 CTGAGCAAGGAGTATGGGGAAGG - Intronic
1039324087 8:36465916-36465938 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1040385865 8:46914650-46914672 CTGGGGCAGGAGTGTGTGCAGGG - Intergenic
1040534540 8:48297349-48297371 CTGGGGATGGGGGTTGGGGAGGG + Intergenic
1041826225 8:62099180-62099202 CTGAGGAAGGGGTGAGTGAAGGG + Intergenic
1041934633 8:63321960-63321982 TTGGGGAAGAGGTATGTAGATGG + Intergenic
1041986269 8:63925098-63925120 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1042000978 8:64123366-64123388 TCGGGGAAGAGGTATGTGGATGG - Intergenic
1042162378 8:65910044-65910066 CTGGGGAAGATACATGTGGATGG - Intergenic
1042794233 8:72643131-72643153 GTGTGGAAAGGGTGTGTGGAAGG - Intronic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1043258012 8:78159447-78159469 TTGGGAAAGATGTATGTGGATGG + Intergenic
1043331475 8:79122678-79122700 TTGGGGAAGGAGTAGTTGGAGGG - Intergenic
1043800928 8:84608540-84608562 CTGGGGAAGGGCAAAGTGGGAGG - Intronic
1044150882 8:88773702-88773724 ATAGGAAAGAGGTATGTGGATGG + Intergenic
1044202477 8:89453118-89453140 TTGGGGAAGAGGTACGTGGATGG + Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044434707 8:92148373-92148395 TTGGGGAAGGGGTATGTGGAGGG + Intergenic
1044487073 8:92766553-92766575 TTGCAGAAGAGGTATGTGGATGG - Intergenic
1044603282 8:94026783-94026805 CTGGGGAAGGGGTAGGGGAATGG - Intergenic
1044633063 8:94297774-94297796 CTGGGGAAGAGGTATGTGAATGG - Intergenic
1044869924 8:96608653-96608675 CTGGCGAAGAGGTAGGTTGAGGG - Intronic
1045719992 8:105097915-105097937 CTTGGGAGTGGGTATGAGGAGGG - Intronic
1046246862 8:111575286-111575308 GTGGGGTAGGGGTAGGGGGAGGG - Intergenic
1046362897 8:113185420-113185442 CTGGGAAAGAGGGATGGGGAAGG - Intronic
1046417555 8:113937164-113937186 TTGGGGTAGAGGTATGTGGATGG - Intergenic
1046970469 8:120217133-120217155 GTGGGGAAGGTGTATGTTCATGG + Intronic
1047399917 8:124537769-124537791 CTGGAGTAGGGGTTTGGGGAGGG - Intronic
1047884239 8:129230938-129230960 CAGGGGAAGAGGCATGTAGATGG + Intergenic
1048926896 8:139279440-139279462 CAGGGGTAGGGGTATGAGGTGGG + Intergenic
1049070605 8:140352690-140352712 CTGGGGAAGGGGTGAGTGGGAGG - Intronic
1049280792 8:141743181-141743203 CTGGAGAAGGGTGATGGGGAAGG + Intergenic
1049280842 8:141743387-141743409 CTGGAGAAGGGTAATGGGGAAGG + Intergenic
1049308982 8:141923441-141923463 CTGAGGATGGGGCATGTGCATGG - Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050114361 9:2248343-2248365 CTGAGGGATGGGTATCTGGAAGG + Intergenic
1050124526 9:2342920-2342942 CTGGGAAAAAGGTATGTGGATGG + Intergenic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050498688 9:6271284-6271306 CTTGGGCAGGGGAGTGTGGAGGG - Intergenic
1050888656 9:10796111-10796133 CTGGGGAAGAGGTATGTAAATGG - Intergenic
1050901868 9:10960262-10960284 TTGAGGAAGAGGTATGTGGATGG + Intergenic
1051203773 9:14662811-14662833 TTAGGGAAAGTGTATGTGGAGGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051702729 9:19841704-19841726 CTGGGGAAGAGGTATATGGCTGG + Intergenic
1052227670 9:26109000-26109022 TTGGGGAAGAGGTATGTGGATGG + Intronic
1052368736 9:27641465-27641487 GTGAGGAAGAGGTATGTGGATGG + Intergenic
1052442182 9:28511661-28511683 TTGGGGAAGAGGTATGTGAATGG - Intronic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052615083 9:30828852-30828874 CAGAGGAAGGGTAATGTGGATGG + Intergenic
1052728500 9:32258852-32258874 CTGGGTATGGGGTAGGTGGGTGG - Intergenic
1052737256 9:32354949-32354971 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1053006345 9:34607430-34607452 CTGGGGGAGGGGTAGGTGATGGG - Intergenic
1053409668 9:37907392-37907414 CTGGGGCAGGGGAATGGGGCCGG - Intronic
1053605949 9:39658657-39658679 CTGGGGAAGGGATAAGTGAAGGG - Intergenic
1053863867 9:42415281-42415303 CTGGGGAAGGGATAAGTGAAGGG - Intergenic
1054247596 9:62683759-62683781 CTGGGGAAGGGATAAGTGAAGGG + Intergenic
1054561712 9:66718286-66718308 CTGGGGAAGGGATAAGTGAAGGG + Intergenic
1054801465 9:69353931-69353953 CTGGGCAATGGGTACATGGAGGG - Intronic
1054822151 9:69533468-69533490 CTGAGGAAGGGCTTTGAGGAAGG + Intronic
1055889526 9:81108064-81108086 CTGGAGAAGGGATTTGTGGTAGG + Intergenic
1055903851 9:81270563-81270585 GTGAGGAGGAGGTATGTGGATGG - Intergenic
1056156760 9:83845833-83845855 TTGGGGAAGAGGTATGTGGATGG + Intronic
1056314145 9:85372317-85372339 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1056353776 9:85777693-85777715 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1056935766 9:90913921-90913943 CTGGGGAATGGGCAGGTGAAAGG + Intergenic
1056954603 9:91072191-91072213 CTCGGCCAGGGGCATGTGGAAGG - Intergenic
1057384964 9:94598901-94598923 CAGGGGTAGGGGTGTGGGGAGGG + Intergenic
1057428813 9:94976192-94976214 CTGGGCAAAGGTTCTGTGGAAGG - Intronic
1058049448 9:100392195-100392217 AGGGGGAAGGGGGATGGGGAGGG - Intergenic
1058243561 9:102597590-102597612 CTTGGGAAGGTGTATGTGTCAGG + Intergenic
1058259175 9:102809056-102809078 TTGGGGAAGAGCTATGTGGATGG - Intergenic
1058347370 9:103980091-103980113 CTGGCGAAGAGATGTGTGGATGG - Intergenic
1058544088 9:106042125-106042147 TTGGGGAAAAGGTATGTAGATGG - Intergenic
1059196415 9:112375214-112375236 TTGGGGAAGAGGTATGTAGATGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059343689 9:113613928-113613950 CTGGGGGAGGGGGTTGTGTAGGG - Intergenic
1059439958 9:114301309-114301331 GTGGGGACTGGGTAAGTGGATGG + Exonic
1060178869 9:121517927-121517949 TTGAGGAAGAGTTATGTGGACGG + Intergenic
1060479351 9:124008934-124008956 CTGGGGGAGGGGGAGGTCGAGGG + Intronic
1060805681 9:126574691-126574713 CTGGGGAACATGTATGGGGATGG - Intergenic
1061042968 9:128150241-128150263 CAGGGGAAGTGGTATGTGGTAGG + Exonic
1061189168 9:129071633-129071655 ATGGGAAAGGGGTCTGGGGATGG + Exonic
1061325564 9:129861806-129861828 CTGGGGAAGTTGTACGTGCAAGG + Intronic
1061389591 9:130310088-130310110 CTGGGAAAGGGGAATGGGCAGGG - Intronic
1061832357 9:133304072-133304094 CTGGGGAAGGGGTGAGCCGAGGG - Intergenic
1061935858 9:133857269-133857291 GTGGGAGAGGGGTTTGTGGAAGG - Intronic
1062052247 9:134453653-134453675 CTGGGGTGGGGGGCTGTGGAGGG + Intergenic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1062169899 9:135129193-135129215 CTGGGGAAGTGGGGTGGGGATGG + Intergenic
1062237011 9:135515177-135515199 CTGGGGAAGGGGTACACAGAGGG - Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062735245 9:138133716-138133738 CTCGGCAAGGGGGATGTGGCAGG - Intergenic
1203475222 Un_GL000220v1:144360-144382 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1185593280 X:1292480-1292502 CTTGGCAAGGGGAATGTGGCAGG + Intronic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1186064641 X:5749006-5749028 CTGGGGAGGGGCTCTGAGGAAGG + Intergenic
1186384008 X:9091133-9091155 TTGGGGAAGAGGTATGTGGATGG - Intronic
1186428494 X:9484421-9484443 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1186469682 X:9811506-9811528 TCGGGGATGAGGTATGTGGATGG - Intronic
1186506589 X:10098306-10098328 CTGGGGAGGGGGGAGGGGGAAGG - Intronic
1187140920 X:16592913-16592935 ATGGGGAAGGGGTATTTCTAAGG - Intronic
1187524007 X:20037756-20037778 TTGGGGAAGAGATATGTGGATGG + Intronic
1188327131 X:28819093-28819115 CTGGGGAGTGGGTGTTTGGAGGG - Intronic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1188972918 X:36639110-36639132 CTGGGCAAGAGACATGTGGATGG + Intergenic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1189125008 X:38436793-38436815 CTTGGGTAGGGGTATGTAGATGG + Intronic
1189154797 X:38746105-38746127 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189645157 X:43120217-43120239 GTGGGGGAGGGGTATATGAAGGG + Intergenic
1190996666 X:55616856-55616878 TTGGAGAAGAGGTATGTGGATGG - Intergenic
1191133951 X:57043859-57043881 TTGGGGATGAGGTATGTGGATGG - Intergenic
1191151181 X:57222115-57222137 CTGGAGGAGGGATATGTGGTCGG - Intergenic
1191658714 X:63629180-63629202 TTGGGGAAGAGGTATGTTGATGG - Intergenic
1191719155 X:64215085-64215107 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1191759436 X:64630537-64630559 TTGGAGGAGAGGTATGTGGATGG + Intergenic
1191769412 X:64739470-64739492 TTGGGGAAGACGTCTGTGGATGG - Intergenic
1191872301 X:65758460-65758482 CAGAGGATGGGGAATGTGGATGG + Intergenic
1191941178 X:66483251-66483273 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1191946434 X:66539647-66539669 CTGGGGAAGAGGTATGTGGCTGG + Intergenic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1192214722 X:69150337-69150359 CTGAGCAAGGGGTTTGGGGATGG + Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1192661486 X:73047153-73047175 TTGGGGAAGAGGTATGTGAATGG - Intergenic
1192677665 X:73215238-73215260 CTGGGGAGGGGAGAGGTGGATGG + Intergenic
1192898791 X:75472533-75472555 TTGGGGAAGAGGTATGTGGATGG + Intronic
1192996271 X:76516203-76516225 TTAGGGAAGAGGTATGTCGATGG + Intergenic
1193447239 X:81619388-81619410 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1193573626 X:83174548-83174570 TTGGAGAAGAGGTATTTGGATGG - Intergenic
1194210358 X:91062977-91062999 GTGGGGAAGAAGTATGTAGATGG + Intergenic
1194232948 X:91346914-91346936 TTGGGGAAGAGGTATGTAGACGG + Intergenic
1194256021 X:91635062-91635084 GTGGGGTAGGGGGAGGTGGAAGG + Intergenic
1194343394 X:92731712-92731734 TTTGGGAAGAGGTATGTGGATGG + Intergenic
1194513333 X:94821623-94821645 GTGGGGAAGTGGTATGTGGATGG - Intergenic
1194692207 X:97000898-97000920 TTGGGGAAGTGGTATGTGACAGG - Intronic
1194694434 X:97028460-97028482 CAGGGGCAGGGGTTTGAGGATGG - Intronic
1194834036 X:98659426-98659448 TTTGGGAAGAGGTATGTGGATGG + Intergenic
1194849163 X:98851540-98851562 TTGAGGAAGAGGTATGTGAATGG - Intergenic
1194972634 X:100360960-100360982 TTTGGGAAGGGGGATGAGGAGGG + Intronic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195065034 X:101232750-101232772 CCGGGGAAGGGGTAGGTTAATGG - Intronic
1195322224 X:103729188-103729210 CTGGGGAAGGAGTGTCTGGGAGG - Intergenic
1195748847 X:108144735-108144757 TTGGGGAAGAGGTATGTGGATGG - Intronic
1195782267 X:108479237-108479259 TTGGGAAAGAGGTATGTGGATGG - Intronic
1195809702 X:108816222-108816244 TTGGGGAAAAGGTATGTGGATGG - Intergenic
1196135877 X:112209213-112209235 TTGAGGAAGAGGTATGTGGATGG - Intergenic
1196198404 X:112858885-112858907 CAAGGGAAGGGGAATGGGGAAGG - Intergenic
1197002381 X:121453545-121453567 TTGGGGAAGAGGTATGTGGATGG + Intergenic
1197044508 X:121978938-121978960 TTGGGGAAGAGGTGTGTGAATGG + Intergenic
1197084118 X:122452872-122452894 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1197097498 X:122613037-122613059 TTGGGGAAGAAGTATGCGGATGG + Intergenic
1197182179 X:123548408-123548430 TTGGGGAAGAGGTCTGTGGATGG + Intergenic
1197244963 X:124158365-124158387 TTGGGGAAGAGGTATGTGGATGG - Intronic
1197371970 X:125637239-125637261 TCGAGGAAGAGGTATGTGGATGG - Intergenic
1197379921 X:125727277-125727299 TTGTGGAAGAGGTATGTAGATGG - Intergenic
1197386688 X:125811616-125811638 TTGGGGAAGAGGTCTGTGGATGG - Intergenic
1197409245 X:126095818-126095840 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1197477284 X:126940805-126940827 TTGAGGAAGAGGTCTGTGGATGG - Intergenic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1198263006 X:134983250-134983272 TTGGGGAAGTGGTATGTGGTTGG - Intergenic
1198701389 X:139400924-139400946 CTGGGGAAGAGGTATATGGATGG + Intergenic
1198782960 X:140257184-140257206 TTGGGGAAGAGGTGTGTGGATGG - Intergenic
1199024464 X:142920347-142920369 TTGGGGAAGAGATGTGTGGATGG + Intergenic
1199116492 X:143998633-143998655 TTTGGGAAGAAGTATGTGGATGG - Intergenic
1199310350 X:146313773-146313795 TTGGGGAAGAGGTATGTGGATGG - Intergenic
1199451343 X:147981712-147981734 CTGGGGGAGGGGGAGGGGGAGGG + Intronic
1199547937 X:149027786-149027808 TTTGGGGAGGGGTATGTGGAAGG - Intergenic
1199712044 X:150476565-150476587 ATGGGGAGGAGGGATGTGGATGG + Intronic
1199744373 X:150762557-150762579 CTGGTGAATGGGCATCTGGAGGG - Exonic
1200651748 Y:5848377-5848399 TTTGGGAAGAGGTATGTGGATGG + Intergenic
1200689120 Y:6288810-6288832 GTGGGGTAGGGGGAAGTGGAGGG - Intergenic
1200689979 Y:6297424-6297446 GTGGGGTAGGGGGAGGTGGAGGG + Intergenic
1200745969 Y:6904244-6904266 TTGGGGAAGAAGTATGTGGATGG - Intergenic
1200986175 Y:9304967-9304989 GTGGGGAAGTGGTCTGTGAAAGG - Intergenic
1201045294 Y:9877296-9877318 GTGGGGTAGGGGGAGGTGGAGGG - Intergenic
1201046153 Y:9885912-9885934 GTGGGGTAGGGGGAAGTGGAGGG + Intergenic
1201796583 Y:17903010-17903032 TTGAGGAAGAGGTATGTGGACGG - Intergenic
1201804972 Y:18002975-18002997 TTGAGGAAGAGGTATGTGGACGG + Intergenic
1202357968 Y:24072072-24072094 TTGAGGAAGACGTATGTGGACGG - Intergenic
1202512810 Y:25598041-25598063 TTGAGGAAGACGTATGTGGACGG + Intergenic