ID: 1086279215

View in Genome Browser
Species Human (GRCh38)
Location 11:85166431-85166453
Sequence AAAAGCCAGGTAGCCAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086279215 Original CRISPR AAAAGCCAGGTAGCCAAATT GGG (reversed) Intronic
901176963 1:7310485-7310507 AACAGGCAGTGAGCCAAATTTGG + Intronic
901866707 1:12111335-12111357 AAAAGAAAAGTAGCCAAATGTGG - Intronic
908241052 1:62189270-62189292 ACAAGGCATGAAGCCAAATTGGG - Intergenic
908613630 1:65892073-65892095 AAAAGCAAGGAATCAAAATTTGG - Intronic
909111899 1:71489724-71489746 TAAGGCCAGTTAGACAAATTTGG - Intronic
912553638 1:110500424-110500446 AAAAGCCAGAGAGCCAAGATTGG + Intergenic
915414372 1:155729358-155729380 AAAAGCCCGGTAGGAAAACTGGG + Exonic
917226390 1:172788420-172788442 AAAAGCCAAGTACCAGAATTGGG + Intergenic
917585952 1:176426381-176426403 AAAAGCCTGAAAGCCAAAATGGG + Intergenic
919208846 1:194453831-194453853 AATACCCAGGTGCCCAAATTGGG - Intergenic
919526906 1:198664981-198665003 AAAATCCAGGTATCCTAATCTGG + Intronic
919549348 1:198965465-198965487 AAAAGCCTGGGAGACATATTTGG - Intergenic
921504022 1:215944154-215944176 AATAGGCAGCTGGCCAAATTTGG - Intronic
922820969 1:228485474-228485496 TAAAGGCAAATAGCCAAATTAGG - Intergenic
1062760947 10:18338-18360 AAAAGCCAGGAAAACATATTTGG + Intergenic
1063947978 10:11195884-11195906 AAAAGCCATGTTTCCAACTTAGG - Intronic
1065518667 10:26551158-26551180 AGCAGCCAGGTGGACAAATTTGG - Intronic
1065870491 10:29952102-29952124 AAAAACCAGGTAGCAAATCTAGG + Intergenic
1068613775 10:59089268-59089290 AAAAATAAGGTAGCCAAATGGGG - Intergenic
1070237175 10:74640765-74640787 AATAGGCAGCTAGCCAGATTTGG + Intronic
1073193076 10:101666064-101666086 AAAAGCCAGTTAGCCAGACCTGG - Intronic
1076287472 10:129314250-129314272 TATAGCCAGGGAGCCAAATCCGG + Intergenic
1080720049 11:34839912-34839934 AAAAGCCATGTAGACTAATGAGG - Intergenic
1081267142 11:41038822-41038844 AAATGCCAGGGTGCCATATTTGG - Intronic
1083732209 11:64658590-64658612 AAAGGCCAGGTGGCCAAAAGGGG + Intronic
1085478407 11:76802761-76802783 AAAAGCCAGGTTCCCTAATCAGG + Intergenic
1086279215 11:85166431-85166453 AAAAGCCAGGTAGCCAAATTGGG - Intronic
1088804772 11:113342078-113342100 AAAAGCAAGGTAGACAGATGAGG + Intronic
1089889275 11:121863783-121863805 AAAAGACAGATATCCAAGTTTGG - Intergenic
1090273581 11:125404469-125404491 AAAAGCCAGATTCCCAAACTCGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092042328 12:5395676-5395698 AAAAGCCAGGCAGCAACAATGGG - Intergenic
1092711705 12:11344956-11344978 AAAACCAAGGGAACCAAATTAGG - Intergenic
1093239654 12:16654397-16654419 AAAAGCCAGGAAGACAACCTAGG - Intergenic
1097305522 12:58064475-58064497 AAAAGAAAGGTAGAAAAATTAGG - Intergenic
1098154365 12:67582045-67582067 AAAGGACAGGTAGCCAAGTCTGG - Intergenic
1099668866 12:85664604-85664626 AACAGCTATGAAGCCAAATTGGG - Intergenic
1100064206 12:90621521-90621543 AAATTCCAGGAAGCCTAATTTGG + Intergenic
1100760543 12:97802014-97802036 GAGAGTCAGGTAGTCAAATTGGG - Intergenic
1102342590 12:112135225-112135247 AACAGCCAGGTAGCCGAATCTGG - Intronic
1104554648 12:129788804-129788826 AAATGACAGGTAGCCAAGATAGG + Intronic
1106693307 13:32143374-32143396 AAAAGCAAAGTAGCAAACTTAGG - Intronic
1110430543 13:75417781-75417803 AAAAGCCAGGCAGCCACCTGAGG - Intronic
1110762512 13:79245938-79245960 CATAGGCAGGAAGCCAAATTTGG + Intergenic
1110804445 13:79737431-79737453 AACATCCAGGTAGACATATTGGG - Intergenic
1112651901 13:101408628-101408650 GAAAACCAGGCAGCCAAATCAGG - Intronic
1113780370 13:112973286-112973308 AAAAACCACGCAGCCAAATGAGG + Intronic
1114030650 14:18576960-18576982 AAAAGCCAGGAAAACATATTTGG - Intergenic
1114052224 14:18930102-18930124 GAAAGCAAGGCAGCCAAACTGGG - Intergenic
1114110335 14:19471822-19471844 GAAAGCAAGGCAGCCAAACTGGG + Intergenic
1115061524 14:29196788-29196810 AAGAGTCAGGCAGCCATATTGGG - Intergenic
1118079256 14:62339412-62339434 AAAAGGCAGGGGACCAAATTTGG - Intergenic
1118347323 14:64949879-64949901 AAGAGCCAGGGAGGCAAATGAGG - Intronic
1119362862 14:74066247-74066269 AACAGGCAGGAAGCCACATTTGG - Intronic
1119598934 14:75961525-75961547 AAAGGCCATTTAGCCAAATAAGG + Intronic
1121833843 14:97074516-97074538 AAGAACCAGGTAGTCACATTTGG - Intergenic
1123844869 15:24289221-24289243 CAAATCCAAGTACCCAAATTAGG + Intergenic
1123860020 15:24455900-24455922 CAAATCCAAGTACCCAAATTAGG + Intergenic
1124514909 15:30359335-30359357 AAAAGCCAAATAACCCAATTAGG + Intergenic
1124728013 15:32171427-32171449 AAAAGCCAAATAACCCAATTAGG - Intronic
1126503376 15:49374062-49374084 AAAAACCAGTTACCCAAATCAGG - Intronic
1126810380 15:52396869-52396891 TAAAGACAGGTACCCAAATAAGG + Intronic
1127164112 15:56226083-56226105 AAAAGACAGGGAGACAAAATAGG + Intronic
1130715973 15:86334983-86335005 AAAACCATGGTAGACAAATTAGG + Intronic
1130739288 15:86581254-86581276 AAAAGAAAGGAAGGCAAATTAGG + Intronic
1131915404 15:97259965-97259987 AGAAGCCAGGTAGCAAGATGGGG + Intergenic
1134892792 16:17855806-17855828 AAAAGCCAGGTAGAGAAATTTGG - Intergenic
1136735835 16:32466823-32466845 AAAAGCCAGGAAAACATATTTGG - Intergenic
1140969016 16:79994979-79995001 ACAAGCCAAGTTGCCAAAATTGG + Intergenic
1203017240 16_KI270728v1_random:362751-362773 AAAAGCCAGGAAAACATATTTGG + Intergenic
1203035575 16_KI270728v1_random:635909-635931 AAAAGCCAGGAAAACATATTTGG + Intergenic
1143787592 17:9267565-9267587 AAAAGCCTGGCAGCCATGTTTGG - Intronic
1144309929 17:14004186-14004208 TAAAGCCAGTTGGCCAAATCTGG - Intergenic
1144424652 17:15130633-15130655 CAAAGAAATGTAGCCAAATTTGG + Intergenic
1144549978 17:16231966-16231988 AAAAACAAGGTAAACAAATTAGG + Intronic
1145099595 17:20063394-20063416 AAAAGGAAGGTACCCAAATTAGG - Intronic
1147880696 17:43651593-43651615 AGAGGCCAGGGAGCCAAATTGGG + Intronic
1148994248 17:51694867-51694889 AAAAGCCAGCTAGCCATATGCGG - Intronic
1149392662 17:56207678-56207700 AAAAGGGAGGGAGCCAAATTAGG - Intronic
1149708150 17:58714434-58714456 AAAAGACTGGTACCCAAAGTTGG - Intronic
1152953854 18:18692-18714 AAAAGCCAGGAAAACATATTTGG + Intergenic
1153397374 18:4639889-4639911 AACAGCCAAGAAGCCAAATTTGG + Intergenic
1155418594 18:25628996-25629018 AAAAGCAAGGTAGGCAAATGAGG - Intergenic
1155893238 18:31292302-31292324 AAGAGTCAGGTAGACAAGTTTGG - Intergenic
1159819106 18:73117443-73117465 AAAAGACAGTTAGGCAAATATGG - Intergenic
1160234072 18:77071743-77071765 ATAAGGTAGGAAGCCAAATTGGG + Intronic
1166521439 19:43482904-43482926 AAGAGCCAGGGAGCAAAATAAGG - Intronic
925593123 2:5529514-5529536 ACATGCCCGGCAGCCAAATTGGG + Intergenic
926813389 2:16776447-16776469 AAAAATCAGGGAGCAAAATTAGG + Intergenic
927644275 2:24866324-24866346 AAATGCCAGGTGGCTAAAGTGGG + Intronic
931371243 2:61665034-61665056 AAAATCCAGGCATCCAAATAAGG - Intergenic
933130399 2:78665433-78665455 AAATGCTAGGTAGCAAAACTTGG - Intergenic
933244025 2:79955220-79955242 AAAAGGGAGGTAGCAGAATTGGG - Intronic
933248793 2:80005067-80005089 GATAGCCAGGTACCCTAATTGGG + Intronic
934309991 2:91853240-91853262 AAAAGCCAGGAAAACATATTTGG + Intergenic
934947241 2:98550630-98550652 AAAAACCAGGCAGCCACATGAGG - Intronic
936704975 2:115061343-115061365 AAAAGCCATTTGGCCAATTTTGG - Intronic
936734315 2:115421894-115421916 AAAAGCAAGGATGTCAAATTTGG + Intronic
938179726 2:129169521-129169543 ATAAGCCAGGGACCCAAATGAGG + Intergenic
938470257 2:131553423-131553445 GAAAGCAAGGCAGCCAAACTGGG - Intergenic
938497556 2:131808807-131808829 AAAAGCCAGGAAAACATATTTGG + Intergenic
939457766 2:142460597-142460619 AACAGGCAGCTAGCTAAATTTGG + Intergenic
939688639 2:145229938-145229960 AAAAGCCATGTACCATAATTTGG - Intergenic
940089930 2:149903760-149903782 ATAAGCCAGGAAGAGAAATTTGG + Intergenic
942262592 2:174184084-174184106 AAAATCCAAGTATCCAAAGTTGG + Intronic
943042858 2:182823905-182823927 AAGGGCCATGTAGCCATATTAGG - Intergenic
945835310 2:214832831-214832853 AAATGCCACCTGGCCAAATTTGG - Intergenic
946336922 2:219043817-219043839 AAAAGGCAGGTGGGAAAATTGGG + Intergenic
947385619 2:229587491-229587513 GAAAGCCAGGTAGACAAAAATGG + Intronic
948535203 2:238640749-238640771 AAAAGCCAGGAAGCATAACTTGG + Intergenic
1180242006 21:46515333-46515355 AAAAGACAGGTAGCAAGATTGGG - Intronic
1180454766 22:15504016-15504038 AAAAGCCAGGAAAACATATTTGG - Intergenic
1180470696 22:15652475-15652497 GAAAGCAAGGCAGCCAAACTGGG - Intergenic
1180536726 22:16399124-16399146 AAAAGCCAGGAAAACATATTTGG + Intergenic
951185828 3:19711880-19711902 AAAACCTAGGTAGATAAATTAGG + Intergenic
952084916 3:29808318-29808340 AAAAGAGAAGAAGCCAAATTGGG - Intronic
953840927 3:46389763-46389785 CAAAGCCCGGTATCCAAAGTTGG + Intergenic
956140373 3:66140454-66140476 GGAAGCCAGGTAGGCAAAATGGG + Intronic
957314984 3:78565204-78565226 AAAAGCCAAGATGCCATATTCGG + Intergenic
958792955 3:98673117-98673139 AAAAACAAGATAGACAAATTGGG - Intergenic
962075438 3:132076750-132076772 AAAACCCAGGTAACAAAGTTGGG - Intronic
964576087 3:158170148-158170170 ATAAGCCAGGTGAACAAATTAGG - Intronic
964757114 3:160098407-160098429 GAAAGCCAGAGAGCCAGATTTGG + Intergenic
965332650 3:167395831-167395853 GAAAGCCATGTAGCCTACTTTGG + Intergenic
967699086 3:192570559-192570581 TAAATCCAGCTAACCAAATTTGG - Intronic
971245487 4:24923562-24923584 AAAAGTTAGGTAGCCAAGATAGG + Intronic
971439209 4:26661613-26661635 AAAACCCAAATAGCCAAATTAGG + Intronic
972208613 4:36809611-36809633 AAAAGGAAGGAAGCCAAATATGG + Intergenic
972883465 4:43455275-43455297 AAAAGCCAAGTTGACAGATTTGG - Intergenic
973914308 4:55617925-55617947 AAAACCCAGTTAGTCAAATTAGG + Intronic
974498336 4:62662866-62662888 AAAAGCCAATCAGCAAAATTTGG - Intergenic
975341228 4:73243329-73243351 AAAAGCCAGGAGATCAAATTAGG + Intronic
975656033 4:76642002-76642024 ATCAGCCAGGAAGGCAAATTTGG + Intronic
976285721 4:83369410-83369432 TAAAGCCAAGCAGCCCAATTTGG - Intergenic
977277369 4:94994190-94994212 ATAAGCCAGGTTGACAAACTTGG - Intronic
977987695 4:103403642-103403664 GAAAGACAAGAAGCCAAATTAGG - Intergenic
979756915 4:124352132-124352154 AAAAGCCCAGTAGCCACATATGG + Intergenic
980021044 4:127710599-127710621 AAGAGACAGTTAGCCAATTTGGG + Intronic
981198177 4:141944471-141944493 AAAACCCAGGAAGACAAACTAGG - Intergenic
981478096 4:145208621-145208643 AAAAGACAAGTATCCAAATTTGG - Intergenic
981564733 4:146087812-146087834 GAAAGCCAGTTAGCCAAGTTGGG - Intergenic
983086120 4:163446688-163446710 AAAAGCCAGCTACAGAAATTGGG - Intergenic
983831289 4:172330492-172330514 AATAGCCAGGTACACACATTGGG - Intronic
985164191 4:187074927-187074949 GGAAACCAGGTAGCCAAACTGGG + Intergenic
986554238 5:8995161-8995183 TCAAGCCAGGTACACAAATTTGG + Intergenic
987840258 5:23214311-23214333 GAAAGTCAGGAAGACAAATTAGG - Intergenic
988053536 5:26060972-26060994 TAAAGGCAGGGAGACAAATTAGG + Intergenic
988316076 5:29630114-29630136 AAAAGCTAAGTAGTTAAATTGGG - Intergenic
988821957 5:34896008-34896030 CAGAGCCAGGTAGCCAAACAAGG + Intronic
991138425 5:63210655-63210677 AAATACCAGGTAGTCAATTTTGG - Intergenic
991452708 5:66769848-66769870 AAGAGCCAAGAACCCAAATTGGG - Intronic
992471351 5:77058493-77058515 AAAAGCAAGATAGGCCAATTTGG + Intronic
994877980 5:105450000-105450022 AAGAGTCAGCTAGCCACATTAGG - Intergenic
996056025 5:118983811-118983833 AACAGGCAGGTAGCAGAATTGGG - Intronic
996998575 5:129729197-129729219 AGAAGCCAGGTCTCCTAATTTGG + Intronic
1003695309 6:8400239-8400261 AAAATCCAGGTAGAAATATTAGG + Intergenic
1008321831 6:50123600-50123622 AAAAACAATGTAGACAAATTGGG - Intergenic
1010646519 6:78395350-78395372 AAAATGCAGGAAGCCAGATTGGG + Intergenic
1011685749 6:89822137-89822159 AACAGCCAGGAGGCAAAATTTGG + Intergenic
1012173638 6:96051194-96051216 AAAGGCCAGGTATGTAAATTAGG - Intronic
1013148025 6:107414184-107414206 TAAAGCCAGATAGCCCTATTTGG - Intronic
1014002964 6:116385372-116385394 TGAAGGCAGGTAGACAAATTTGG + Intronic
1015062123 6:128978814-128978836 AAGAGCTAGGTGGGCAAATTCGG + Intronic
1015489563 6:133810605-133810627 AAACACCAGGTAGCCTTATTAGG + Intergenic
1017044121 6:150331176-150331198 CAATGCCTGGTAGGCAAATTTGG - Intergenic
1021407076 7:20284074-20284096 AAAAGACAGTTAGCTAATTTGGG + Intergenic
1022841252 7:34165935-34165957 AAAAGGCAGTCAGCCAGATTTGG - Intergenic
1023613504 7:41995057-41995079 AAAATCCAGGTGGCAAAATTTGG - Intronic
1024697623 7:51872322-51872344 AAAGGCCAGGTAACCAAAAAGGG - Intergenic
1024830946 7:53456067-53456089 AAATGAAAGGTAACCAAATTGGG + Intergenic
1024886911 7:54153031-54153053 AAAAGACAGGTTGTGAAATTTGG + Intergenic
1026197128 7:68182839-68182861 AAAAGTCAAGAAGCCAAATTTGG - Intergenic
1030780193 7:113591490-113591512 AATAGCCAGGTAACCAAGTGTGG + Intergenic
1031758223 7:125674159-125674181 AAAAGCCTGGGAGCCACATATGG - Intergenic
1031779744 7:125946154-125946176 AAGAGACAGGGAGCCAAAGTAGG - Intergenic
1032556228 7:132837998-132838020 GAAAGGCAGATACCCAAATTTGG + Intronic
1032775880 7:135112207-135112229 ACAAGGCAGGGAGACAAATTAGG - Intronic
1036724036 8:11202631-11202653 TGAAGCCAGATAGCCAAAATAGG + Intergenic
1038166012 8:25085603-25085625 AAAAGGCAGGTACCAAAATGAGG + Intergenic
1041123216 8:54608165-54608187 AAAAGGCAGATGGCCAAAATAGG - Intergenic
1041180405 8:55241603-55241625 AAAAGGTATGAAGCCAAATTTGG - Intronic
1042419056 8:68563586-68563608 AAAAGCCAGCTAGCAGATTTTGG + Intronic
1042460227 8:69057174-69057196 AAAAATCAGGTGGGCAAATTTGG - Intergenic
1043217647 8:77614931-77614953 AAAAGACAAGAAGCCATATTTGG - Intergenic
1044777563 8:95707592-95707614 AAAAGGCAGGTACACAAACTGGG - Intergenic
1044900212 8:96935928-96935950 AAAAAAGAGGTAGACAAATTTGG - Intronic
1046955669 8:120060446-120060468 AAAAGCTAGGTAGCTGAATAAGG - Intronic
1048237281 8:132703435-132703457 CAAAGCCTGGTAGGCAAATGTGG + Intronic
1048858501 8:138704341-138704363 AAACCCCAAGTAGCCTAATTGGG + Intronic
1051033787 9:12718131-12718153 AAGAGACAGGAAGCCAAACTAGG - Intergenic
1051166909 9:14272252-14272274 AAAAGCCAGATTGAAAAATTGGG - Intronic
1052176893 9:25473058-25473080 AATATCCAGGTAGTCACATTGGG - Intergenic
1052331783 9:27277690-27277712 AGAAGCAAATTAGCCAAATTTGG - Intergenic
1057378596 9:94546928-94546950 AAAAGCCACGTTTCAAAATTTGG + Intergenic
1057612609 9:96559775-96559797 AAGTGCCAGGTAAGCAAATTTGG - Intronic
1060618581 9:125042840-125042862 AAAAGCCAGGGAGCAGAATGTGG - Intronic
1061385327 9:130286225-130286247 ATAAGCCAGGTAGCCAGGATGGG - Intronic
1062719197 9:138026367-138026389 AAAAGCCAGGTAGGGAACCTAGG - Intronic
1187577496 X:20573441-20573463 AAAAGCCAAGTATCTTAATTAGG - Intergenic
1188015249 X:25101183-25101205 AAAATCCATGAAGCCAGATTGGG + Intergenic
1188338485 X:28969321-28969343 AAAATTCAGGAAGCCAGATTGGG - Intronic
1189581878 X:42414777-42414799 AATATCCAGGTAGTCACATTGGG - Intergenic
1190977040 X:55416207-55416229 AAAAACCAGGTACTCACATTGGG + Intergenic
1194513563 X:94823364-94823386 AAAAGTCAGGGAGCCAAGGTAGG + Intergenic
1196549131 X:117000636-117000658 AAAAGCCAGGTTGACTGATTTGG + Intergenic
1196629614 X:117922504-117922526 TAAAGCCATGTAGTCACATTGGG + Intronic
1197869492 X:131051532-131051554 AGAACCCAGGAAGCCAAAGTGGG + Intergenic
1197923602 X:131622735-131622757 AAAAATCAGTAAGCCAAATTAGG + Intergenic
1197936002 X:131741096-131741118 AATCTCCAGGTAGCCATATTGGG + Intergenic
1199619890 X:149689734-149689756 GAGAGCCAGGAAGCAAAATTGGG - Intronic
1199652917 X:149965398-149965420 AAATGCCAGCAAGCCAAATCTGG - Intergenic
1200336146 X:155353503-155353525 AACATCCAGGTACCCACATTGGG + Intergenic
1200350324 X:155487724-155487746 AACATCCAGGTACCCACATTGGG - Intergenic
1202244156 Y:22799599-22799621 AAAAGTCAGTTACCCAAACTAGG - Intergenic
1202397144 Y:24433349-24433371 AAAAGTCAGTTACCCAAACTAGG - Intergenic
1202473637 Y:25236743-25236765 AAAAGTCAGTTACCCAAACTAGG + Intergenic