ID: 1086279779

View in Genome Browser
Species Human (GRCh38)
Location 11:85171987-85172009
Sequence CAGCTGAACCACAGGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 329}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086279779_1086279787 16 Left 1086279779 11:85171987-85172009 CCACTGTCCCTGTGGTTCAGCTG 0: 1
1: 0
2: 4
3: 34
4: 329
Right 1086279787 11:85172026-85172048 CTGCTGGCACTGAAGAGTCCGGG 0: 1
1: 6
2: 35
3: 128
4: 334
1086279779_1086279783 0 Left 1086279779 11:85171987-85172009 CCACTGTCCCTGTGGTTCAGCTG 0: 1
1: 0
2: 4
3: 34
4: 329
Right 1086279783 11:85172010-85172032 GCTTAGATGTTCCAGCCTGCTGG 0: 1
1: 0
2: 10
3: 144
4: 433
1086279779_1086279786 15 Left 1086279779 11:85171987-85172009 CCACTGTCCCTGTGGTTCAGCTG 0: 1
1: 0
2: 4
3: 34
4: 329
Right 1086279786 11:85172025-85172047 CCTGCTGGCACTGAAGAGTCCGG 0: 1
1: 4
2: 40
3: 87
4: 318
1086279779_1086279788 24 Left 1086279779 11:85171987-85172009 CCACTGTCCCTGTGGTTCAGCTG 0: 1
1: 0
2: 4
3: 34
4: 329
Right 1086279788 11:85172034-85172056 ACTGAAGAGTCCGGGCATTCTGG 0: 1
1: 0
2: 1
3: 18
4: 119
1086279779_1086279789 30 Left 1086279779 11:85171987-85172009 CCACTGTCCCTGTGGTTCAGCTG 0: 1
1: 0
2: 4
3: 34
4: 329
Right 1086279789 11:85172040-85172062 GAGTCCGGGCATTCTGGACGAGG 0: 1
1: 0
2: 2
3: 18
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086279779 Original CRISPR CAGCTGAACCACAGGGACAG TGG (reversed) Intronic
900832586 1:4975832-4975854 CATGTGGAACACAGGGACAGTGG - Intergenic
901518711 1:9767207-9767229 CACCTGGAGAACAGGGACAGTGG + Intronic
902141708 1:14362123-14362145 CAGCAGACCCACAGAGACGGTGG - Intergenic
904124689 1:28229688-28229710 CGCTTGAACCCCAGGGACAGAGG + Intronic
904273245 1:29364045-29364067 CACCTGACCCCCAGTGACAGAGG + Intergenic
905031781 1:34889163-34889185 CTGCAGAACCCCAGGGAAAGAGG - Intronic
905529278 1:38663918-38663940 CAGGAGAACTGCAGGGACAGTGG - Intergenic
905952644 1:41964792-41964814 CTGCTGAACCACAGATACTGTGG - Intronic
906065424 1:42977169-42977191 CAGTTGAACCAGAGAGGCAGAGG - Intergenic
907488321 1:54792361-54792383 CAGCTTCACCACAGGGATAGAGG - Intronic
908450760 1:64252282-64252304 CAACTGAACCACAGAGATGGTGG - Intronic
908460696 1:64346060-64346082 AAGCTGAGCCCCAGGAACAGGGG + Intergenic
909406123 1:75291629-75291651 CAGATGAACAACATGGACAAAGG + Intronic
910646306 1:89519108-89519130 CAGCTGAACCACTGGGACTCTGG + Intergenic
912171508 1:107106114-107106136 CTGCTAGACCTCAGGGACAGTGG + Intergenic
913115420 1:115692201-115692223 CAGGTAAAGCACAGGGAGAGAGG + Exonic
913529258 1:119721898-119721920 CTGCAGAAACACAGGGGCAGAGG + Intronic
913595252 1:120369840-120369862 CAGCTGTAGAACAGAGACAGTGG + Intergenic
914092020 1:144509135-144509157 CAGCTGTAGAACAGAGACAGTGG - Intergenic
914306516 1:146424729-146424751 CAGCTGTAGAACAGAGACAGTGG + Intergenic
914595533 1:149148072-149148094 CAGCTGTAGAACAGAGACAGTGG - Intergenic
917122224 1:171654830-171654852 CAGCTGAGCCACAGGGGAGGTGG - Intergenic
917704043 1:177613320-177613342 CATCTGGGCCACTGGGACAGTGG + Intergenic
918688029 1:187444142-187444164 GAGCTGAGCCAGAGGGACACAGG + Intergenic
919362306 1:196610269-196610291 CAGCTAAGCCACAGGGAGAGGGG - Intergenic
920059422 1:203217305-203217327 CAGCTGAAGCACAGTGCCACAGG + Intronic
922096534 1:222447744-222447766 CAGCAGAACCACAGGGAGTCTGG - Intergenic
922576191 1:226662183-226662205 GAGCTGAGCAACAGGGACACAGG + Intronic
923073394 1:230587189-230587211 CAGCTGACCCCCAGGCACACAGG + Intergenic
923619424 1:235565897-235565919 GAGCTGACACAGAGGGACAGAGG + Intronic
1062880095 10:971303-971325 GAGATGAAGCACAAGGACAGGGG + Intergenic
1063651200 10:7938814-7938836 TAACTGAACCTCAGGAACAGTGG + Intronic
1065003912 10:21362255-21362277 CTGCTAAACCTCAGGGAGAGGGG + Intergenic
1065373955 10:25017384-25017406 CCTCTGAACCACCGGTACAGAGG + Intronic
1065898079 10:30182058-30182080 CAGCAGAGCTACAGGGACAGTGG + Intergenic
1066149552 10:32601154-32601176 CACTTGAACCTCAGGGGCAGAGG - Intronic
1067409577 10:46052823-46052845 CAGCTGAACTGAAGGGTCAGTGG - Intergenic
1067847878 10:49737676-49737698 CAGCAGAGCCACAGGCAGAGGGG + Intronic
1069376286 10:67796183-67796205 CACTTGAACCCAAGGGACAGAGG + Intergenic
1070055038 10:72926133-72926155 CAGCTTAACCAAAGGGAGAATGG + Intronic
1071785696 10:88897253-88897275 TAGCTGAATCTCTGGGACAGGGG + Intronic
1073757741 10:106598868-106598890 CTCCTGAACAACAGGAACAGAGG + Intronic
1074406189 10:113181990-113182012 CAGCTGAGTCCCAGAGACAGGGG + Intergenic
1074454562 10:113586081-113586103 CAGATGCACCAGAGGGCCAGGGG - Intronic
1075208241 10:120465481-120465503 CAGCAGAAAAACAGGGCCAGAGG + Intronic
1075512390 10:123083112-123083134 CACCTGAAGCTCAGGGACTGGGG - Intergenic
1075717119 10:124562419-124562441 CAGCAGAATCAAGGGGACAGAGG + Intronic
1075719871 10:124578335-124578357 CAGGTGAGCCACAGGGCCACAGG + Intronic
1076118319 10:127916677-127916699 GAGCTGGAGCCCAGGGACAGAGG + Intronic
1076866292 10:133167943-133167965 CAGCTGACCCACGGAGGCAGGGG - Intronic
1077758126 11:5058399-5058421 CACTTGAACCCCAGGGACAGAGG + Intergenic
1077788127 11:5407357-5407379 CAGCTGAAACTCAGGAAGAGGGG - Intronic
1079011064 11:16828722-16828744 CACCTGAACCACCTGGACTGAGG - Intronic
1079064243 11:17276215-17276237 CAGTTAAACCACAGTGACCGAGG + Intronic
1079654701 11:22973823-22973845 CAACTGAACCACCAAGACAGTGG + Intergenic
1080056371 11:27910860-27910882 CAGCAGAAGCAAAGGCACAGAGG + Intergenic
1083276890 11:61601951-61601973 AAGCTGAGCCAGAGAGACAGGGG - Intergenic
1084017046 11:66390356-66390378 CACCTGAACCCGGGGGACAGAGG - Intergenic
1084335922 11:68457813-68457835 CAGGTGTAGCACAGGGCCAGAGG - Intergenic
1084615174 11:70231086-70231108 CTGCTGTAAGACAGGGACAGTGG - Intergenic
1086279779 11:85171987-85172009 CAGCTGAACCACAGGGACAGTGG - Intronic
1087171047 11:95050558-95050580 CAGCTGTCCCACACGGACTGTGG + Intergenic
1089459702 11:118645413-118645435 CAGCTGAGGCACAGTGCCAGTGG + Exonic
1090275794 11:125418527-125418549 CGGCTGTACCCCAGGAACAGCGG + Intronic
1090370510 11:126248060-126248082 CACCTGAACCAGAGAGGCAGAGG + Intronic
1093340435 12:17967202-17967224 CTGCTGATCCACAGAGACTGTGG + Intergenic
1094058267 12:26287721-26287743 CAGCTGAATCAGAAGGGCAGCGG - Intronic
1095162010 12:38929364-38929386 CACCTGAACCCCAGAGGCAGAGG + Intergenic
1096513852 12:52145875-52145897 GAGCTGACACAGAGGGACAGGGG - Intergenic
1097191026 12:57219712-57219734 CAGCTGGGCCAGGGGGACAGGGG + Intronic
1102281899 12:111625025-111625047 CAGCAGAAGCAAAGGCACAGAGG - Intergenic
1103140293 12:118542183-118542205 CAGCTGAAACAGAAGGACTGGGG + Intergenic
1103140522 12:118544089-118544111 CACCTGAAACACATGGACTGGGG - Intergenic
1104476511 12:129074729-129074751 CAGCAGACACACAGGGGCAGGGG - Exonic
1104783719 12:131436805-131436827 CTCCTAAACCACAGGGACTGAGG + Intergenic
1104951807 12:132444487-132444509 CAGCAGACCCCCTGGGACAGGGG - Intergenic
1105835857 13:24211632-24211654 CAGCTGGACAACATGGAGAGAGG - Intronic
1106387593 13:29302685-29302707 CAACTGAACCACAGAGATGGTGG - Intronic
1106425543 13:29625294-29625316 CAGCTGAAACACAGAGCCTGTGG - Intergenic
1107111722 13:36705035-36705057 CAGCTGAACTGGAGGCACAGTGG - Intergenic
1107272047 13:38631403-38631425 CACCTGAACCCCAGAGGCAGAGG - Intergenic
1108417079 13:50208906-50208928 CAGCAGAACCTCAGGCACAAGGG - Intronic
1108692097 13:52868669-52868691 CACCTGAACAACAGAGACATGGG + Intergenic
1109677315 13:65694659-65694681 CAGGTGAATCACAAGGTCAGGGG + Intergenic
1112594670 13:100796912-100796934 CTGCAGAACCACAGGGAGATGGG + Intergenic
1113560001 13:111271209-111271231 CAGCAGGACCACAAGGACAGAGG - Intronic
1113574797 13:111387652-111387674 AAGCTGAGCCACAGGCACTGAGG - Intergenic
1113627132 13:111855624-111855646 CACCAGAAGCACTGGGACAGGGG + Intergenic
1114958216 14:27849479-27849501 CTGCTGAACCACAGAGACTGTGG - Intergenic
1115758999 14:36559232-36559254 CACTTGAACCACAGAGTCAGAGG - Intergenic
1117011749 14:51477821-51477843 CACTTGAACCCCAGGGACAGAGG - Intergenic
1117154279 14:52922411-52922433 CAGGTGAACTACAGTGAAAGAGG + Intronic
1117300501 14:54421324-54421346 CAGCCGAACCCAGGGGACAGAGG + Intergenic
1117752684 14:58939770-58939792 CAGCTAAGCCTCAGGGACAGAGG + Intergenic
1119402370 14:74371961-74371983 CAGCTGCAGCACAGGGAGAGTGG - Intergenic
1119613467 14:76082955-76082977 CAGTACAGCCACAGGGACAGAGG - Intronic
1120643861 14:87048460-87048482 CAACTGAATGACAGGGACTGGGG + Intergenic
1121277667 14:92678903-92678925 CAGAAGAACCACAGGCACGGTGG + Intronic
1121477998 14:94230713-94230735 CATCTGGAGCACAGGGACACAGG + Exonic
1122168914 14:99854498-99854520 CAGGCCAACCGCAGGGACAGGGG - Intronic
1122565789 14:102654767-102654789 AAACTCAACCACAGGGAAAGAGG - Intronic
1123778565 15:23603812-23603834 CTGCTGAAGCACAGGGACAGTGG + Intronic
1124354546 15:28985021-28985043 CAGCTCAACCACTGAGGCAGAGG - Intronic
1124805939 15:32883019-32883041 CTGCTGAAGAGCAGGGACAGAGG + Intronic
1125031025 15:35076357-35076379 CAGATGAACCACGGGGCCTGTGG + Intergenic
1126956271 15:53936408-53936430 CAGCTGAACTGCAGATACAGTGG - Intergenic
1127752663 15:62060824-62060846 CACCTGATCCACAGGTGCAGGGG - Intergenic
1129393396 15:75231775-75231797 CAGCAGAGGCACAGGGACACCGG - Intergenic
1130030367 15:80308360-80308382 CCGCTGAACTGCAGAGACAGCGG + Intergenic
1130299758 15:82671197-82671219 CACTTGAACCACAGAGGCAGAGG + Intronic
1131650684 15:94395191-94395213 CAGCTGATGCACATGGAAAGTGG - Intronic
1132389433 15:101427709-101427731 CAGCTGACCCACAGGGATTGGGG - Intronic
1132693165 16:1190685-1190707 GAGCTGCCCCACAGGCACAGGGG + Intronic
1132797271 16:1731243-1731265 CACCTGAACCCCAGGGGCGGAGG + Intronic
1133042886 16:3069888-3069910 CACTTGAACCAGAGAGACAGAGG - Intronic
1134039811 16:11059948-11059970 CAGCTGTGCCTCAGGGAGAGAGG + Intronic
1134403719 16:13936826-13936848 AAGGTGAAGCAAAGGGACAGAGG + Intronic
1134771454 16:16812792-16812814 CAGCTGAACAGGAGGGACAGTGG + Intergenic
1135424460 16:22325442-22325464 CAGCAGAGCCTCAGGGACGGAGG + Intronic
1136043873 16:27600703-27600725 CAGCTGTGCCACAAGGGCAGTGG - Intronic
1137237337 16:46626429-46626451 CAGCTGAACAGCAAGGACATCGG - Intergenic
1140049975 16:71471952-71471974 CAGATGAACCTCAGTGACGGTGG + Intronic
1140563135 16:76007824-76007846 CAGCAAAAACACAGGGACTGGGG - Intergenic
1140864746 16:79050237-79050259 AAGCTGACCCACAGACACAGGGG - Intronic
1141944554 16:87300398-87300420 CACCTGAGCCCCAGGGACGGAGG + Intronic
1142148088 16:88500905-88500927 CACCTGACCGACAGGTACAGCGG + Intronic
1142237709 16:88930500-88930522 CAGCTCAGCCACAGGGAAGGAGG + Intronic
1144211565 17:13019894-13019916 CACTTGAACCCCAGAGACAGAGG + Intergenic
1144239299 17:13294571-13294593 CACTTGAACCCCAGGGGCAGAGG - Intergenic
1144661346 17:17072822-17072844 CAGCTGATGCACAGGTGCAGAGG - Intronic
1145005760 17:19336874-19336896 CCCCTGAACCTCAGGGAAAGGGG + Intergenic
1146048618 17:29531677-29531699 CACCTGAACCCCGGGGGCAGAGG + Intronic
1146439555 17:32882109-32882131 CAGCTGGACCACAGGAACAATGG - Intergenic
1146517303 17:33499175-33499197 CAGCTGGACCAGAGGGACTGAGG - Intronic
1146674727 17:34765392-34765414 CACCTAAGCCCCAGGGACAGCGG - Intergenic
1146918792 17:36695995-36696017 CACCTGAACCAGAGAGTCAGAGG - Intergenic
1148135476 17:45289111-45289133 GAGCTGAACCACAGGTGCTGAGG + Intronic
1148405938 17:47415872-47415894 AAGACGAACCTCAGGGACAGAGG - Intronic
1148818455 17:50346725-50346747 CAGCTGAGCCCGAGGGGCAGCGG + Intronic
1148900644 17:50873516-50873538 CAAGTTAATCACAGGGACAGGGG + Intergenic
1150307660 17:64100143-64100165 CACCTGAACCACAGGTACCTGGG + Intronic
1152450158 17:80373434-80373456 CAGCTGAAGCACAGAGACAAAGG - Intronic
1153724757 18:7943265-7943287 CAGAAGAGCCACAGGGGCAGTGG - Intronic
1153858408 18:9173912-9173934 CAACTGAACCGCAGAGACATTGG + Intronic
1154127476 18:11704527-11704549 CTGCTAACCCACAGGTACAGAGG + Intronic
1155272899 18:24158189-24158211 CAGCTGTCTCACAGGGAGAGAGG - Intronic
1156946056 18:42832968-42832990 CACTTGAACCCCAGAGACAGAGG + Intronic
1158076588 18:53537024-53537046 GAGCTGAGCCACAGTGACTGTGG + Intergenic
1158752231 18:60275325-60275347 CACTTGAACCACGGAGACAGAGG - Intergenic
1159141820 18:64405715-64405737 GAGCTGAAGCCCAGGCACAGAGG - Intergenic
1160761732 19:788889-788911 CAGCCCGACCACAGGGTCAGCGG - Intergenic
1160856721 19:1221127-1221149 CAGCTCTACCCCAGGGACAGAGG - Intronic
1161285435 19:3465987-3466009 CAGCTGGAAGACAGAGACAGGGG - Intronic
1162490781 19:10990235-10990257 CACTTGAACCACAGAGGCAGAGG - Intronic
1163085127 19:14973862-14973884 CAGGTGAGCAACAGGGAGAGCGG + Intronic
1164010161 19:21195112-21195134 CTGCTGAATCACAGGGCCACAGG - Exonic
1165858073 19:38891964-38891986 CAGCTGGAGGACAGGGACACAGG + Intronic
1166389856 19:42402773-42402795 GAGCTGAGCCCCATGGACAGAGG - Exonic
1166547178 19:43640383-43640405 GAGCTGAGCCACCGGGACAGGGG + Intergenic
1166588215 19:43969794-43969816 CAACCGAACCATAGAGACAGTGG - Intronic
1167257688 19:48441135-48441157 CAGGTGGACCACAAGGACAGGGG + Intronic
1167381842 19:49142784-49142806 CAGCTGCAGCGGAGGGACAGAGG - Exonic
1168600634 19:57715372-57715394 CACTTGAACCCAAGGGACAGAGG + Intronic
925280491 2:2681220-2681242 AACCTCAACCAGAGGGACAGAGG + Intergenic
925971947 2:9112228-9112250 CAGCTGATCCGGAGGGAGAGCGG - Intergenic
926098085 2:10095577-10095599 CAGCTGGACGGCTGGGACAGTGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
926803796 2:16686039-16686061 CACCAGAAGCACAGAGACAGTGG + Intergenic
927316028 2:21684155-21684177 TAGCTGACCCAAAGGAACAGTGG - Intergenic
928427564 2:31191903-31191925 CCTCTGAACCACAGGGGCATGGG - Intronic
928477683 2:31647172-31647194 CAGCTGTACCATAGACACAGAGG + Intergenic
930752034 2:54943568-54943590 CAGCAGAATGGCAGGGACAGAGG - Intronic
930759337 2:55015761-55015783 CAGCTGGACAACAGAGAGAGAGG + Intronic
932169084 2:69537432-69537454 CAGCAGACCCACAGGCAGAGTGG + Intronic
934149122 2:89128652-89128674 CAGCTGAACCACAGCAAGAAGGG + Intergenic
934218173 2:90053390-90053412 CAGCTGAACCACAGCAAGAAGGG - Intergenic
934479081 2:94618565-94618587 CTGCTGAACCACAGAGACTGTGG + Intergenic
934546280 2:95219347-95219369 CAGCAGAATCAAAAGGACAGAGG - Intronic
935291025 2:101611175-101611197 CCCTTGAACCTCAGGGACAGGGG - Intergenic
936834019 2:116684813-116684835 CAGCTGAATAACAGGGCTAGGGG + Intergenic
937340107 2:121085839-121085861 CAGCAGATCCCCAAGGACAGAGG + Intergenic
938289087 2:130140094-130140116 CAGCTGAAAGGCAGGGGCAGGGG + Exonic
938467441 2:131532844-131532866 CAGCTGAAAGGCAGGGGCAGGGG - Exonic
939671812 2:145022193-145022215 CAGCTGAACTCCAGGGAAGGTGG - Intergenic
941107425 2:161372096-161372118 TTGCTCAACCACAGGGAGAGTGG + Intronic
945992033 2:216404142-216404164 CAGGTGAGACAGAGGGACAGAGG + Intergenic
946922518 2:224594550-224594572 CACTTGAACCACAGAGGCAGAGG - Intergenic
947024963 2:225727216-225727238 CAGGAGAAGCCCAGGGACAGTGG - Intergenic
947128493 2:226896884-226896906 CACTTGAACCCCGGGGACAGAGG - Intronic
947776015 2:232709917-232709939 CAGCTGGAGCCCAGGCACAGTGG - Intronic
947816573 2:233041415-233041437 CAGCTGCCCCACAGGGACATGGG + Intergenic
1169519011 20:6351213-6351235 TATCTGAACCACAGGTCCAGTGG + Intergenic
1169742168 20:8906808-8906830 TGGCTGACCCACAGGGACTGAGG + Intronic
1170542406 20:17402575-17402597 CACTTGAACCCTAGGGACAGAGG + Intronic
1171782347 20:29430691-29430713 CGGCTGAACCACAGCCACGGGGG - Intergenic
1171933139 20:31246619-31246641 CGGCTGAACCTCAGGGATGGAGG - Intergenic
1172032511 20:31991739-31991761 CAGCTGAAGCAAAGGCTCAGAGG - Intronic
1174038486 20:47682865-47682887 CAGATGTACCCCAGGGCCAGCGG - Intronic
1174570178 20:51495845-51495867 CAGGTTTCCCACAGGGACAGAGG - Intronic
1174582394 20:51581185-51581207 CAGCAGGACCAAAGGCACAGAGG - Intergenic
1176129652 20:63491285-63491307 CAGATGCAGCACAGGCACAGCGG + Intronic
1178358646 21:31930227-31930249 CAGCTACACAACAGGGAAAGCGG + Intronic
1178455990 21:32752088-32752110 CAGCAGAACCAAAGGGACTGAGG - Intronic
1179602028 21:42485688-42485710 CACCTGAACCACAGGTACCAGGG - Exonic
1181108373 22:20587744-20587766 CAGCTGAAAGGCAGGGGCAGGGG + Intergenic
1181689187 22:24548944-24548966 CAGCTCTACCACTGGGACTGTGG - Exonic
1182358526 22:29733667-29733689 CTGCAGGGCCACAGGGACAGTGG + Intronic
1182369373 22:29800164-29800186 AAGCAGAGCAACAGGGACAGTGG - Intronic
1183522692 22:38304574-38304596 CAGCAGAAGAACAGGAACAGTGG + Intronic
1183623672 22:38989155-38989177 CAGCTCTACCCCAGGGAGAGGGG + Intronic
1184766396 22:46574824-46574846 CATCTGAACCACTGGGGCTGAGG - Intergenic
1184924896 22:47630056-47630078 CAGCTGGACCACAGAGCCATCGG + Intergenic
1185082133 22:48715400-48715422 CAGCTCAGCCTCAGAGACAGCGG + Intronic
949870635 3:8584961-8584983 CAGTTGGAGAACAGGGACAGAGG - Intergenic
949909440 3:8889132-8889154 TAGCTGAATCACTGGGAGAGTGG - Intronic
950491122 3:13305704-13305726 CCGCTGCACCAGTGGGACAGGGG - Intergenic
952639525 3:35576952-35576974 CACTTGAACCCCAGAGACAGAGG - Intergenic
952888019 3:38023573-38023595 TAGCTTACCCACAGGGTCAGCGG + Intronic
960064249 3:113353725-113353747 CAGCTGCACGATAGAGACAGAGG + Intronic
960624038 3:119662824-119662846 CAGCAGAAGCACGGGCACAGAGG + Intronic
960680119 3:120238893-120238915 TGGCTGAACCACAGAGACTGTGG + Intronic
961064395 3:123862244-123862266 CAGATGAACTACAGGGACACAGG - Intronic
961537579 3:127579328-127579350 CAGCTGGACCATATGGACTGAGG - Intronic
961750456 3:129091121-129091143 CAGCTGAACAGCAAGGACATCGG - Exonic
962910090 3:139840164-139840186 CAGGTGAACCTGATGGACAGTGG - Intergenic
965288772 3:166849582-166849604 CCACTGATCCACAGGGACTGTGG + Intergenic
965456224 3:168903962-168903984 CAGGTAAACCACAGGCAAAGGGG - Intergenic
965840548 3:172900988-172901010 CAGCAGAATGAAAGGGACAGAGG - Intronic
966711106 3:182973721-182973743 CACCTGAACCCCGGAGACAGAGG + Intronic
967003920 3:185365516-185365538 CAGCTGAAGCACACAGAAAGAGG - Intronic
967868356 3:194208648-194208670 CATCTGAACCATGGGGAAAGAGG + Intergenic
968495220 4:911458-911480 CAGGTGGCCCACCGGGACAGTGG + Intronic
968874408 4:3257767-3257789 CTTCTCAACCACAGGGTCAGCGG - Intronic
969464693 4:7349398-7349420 CCGCTGGAGCACAGGGCCAGTGG + Intronic
970343980 4:15135657-15135679 TTGCAGAGCCACAGGGACAGAGG - Intergenic
970365166 4:15350713-15350735 AAGCTGAACCAGAGAGACTGTGG + Intronic
970375094 4:15449032-15449054 CATCTAAATCACATGGACAGAGG + Intergenic
972273908 4:37539294-37539316 CAGGAGAACCACAGGACCAGTGG - Intronic
972544941 4:40071648-40071670 CACCTGAACCCAAGAGACAGAGG - Intronic
973284792 4:48403321-48403343 TGGCTGAACCACAGAGACAGCGG + Intronic
973694960 4:53481740-53481762 CAGCTGGTCCCCAGGGCCAGGGG - Exonic
975128294 4:70806701-70806723 CAGCTAAAACACAGGTACAGAGG - Exonic
976607148 4:86994757-86994779 CAGCTGGAGCAGAGGGAAAGGGG + Intronic
977128243 4:93198501-93198523 CAGCTGAACCAGAGGGACTAAGG + Intronic
978268664 4:106859974-106859996 TTGCTGAAGCACAGGGCCAGAGG + Intergenic
978826310 4:113028213-113028235 CACCTGATCCAGTGGGACAGAGG + Intronic
981191685 4:141872099-141872121 CTGCAGAGCCACAGGGGCAGAGG - Intergenic
981734058 4:147930930-147930952 CAGCCCACCTACAGGGACAGTGG + Intronic
981749617 4:148081497-148081519 CAGCTGTAACACAGACACAGGGG + Exonic
981939124 4:150262811-150262833 CAGCCGAGCCAGAGGGTCAGGGG - Intergenic
982333027 4:154203229-154203251 CAGGTGAATCACAAGGTCAGGGG + Intergenic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
986329225 5:6705146-6705168 CAGTGGACCCACTGGGACAGGGG - Intergenic
986618316 5:9643142-9643164 CTGCTTAATCACAGGGATAGGGG + Intronic
986695499 5:10351657-10351679 GAGCTGAGCCATAGGGGCAGAGG + Intergenic
986734248 5:10656448-10656470 CAGATGAACTAAAGGGACACTGG + Intergenic
986758186 5:10856976-10856998 GAGATGAAACACAGGCACAGCGG - Intergenic
986859176 5:11905389-11905411 CTGCTGAATCAGAGGGACAGGGG - Intergenic
986954339 5:13132890-13132912 CACTTGAACCTCAGAGACAGAGG - Intergenic
987460090 5:18198475-18198497 CTGCAAAGCCACAGGGACAGAGG + Intergenic
987781718 5:22445726-22445748 CTGCTGAATCACCAGGACAGGGG - Intronic
988100431 5:26669634-26669656 CTGCTAAACCCCAGGGACAGAGG - Intergenic
990463937 5:56054607-56054629 CACTTGAACCAGGGGGACAGAGG - Intergenic
990545045 5:56814809-56814831 TATCTGTAGCACAGGGACAGGGG + Intergenic
991009458 5:61867887-61867909 CTGCTTAACAACAGGAACAGTGG - Intergenic
991526063 5:67559189-67559211 AAGGTGAACCCCAGGGATAGAGG + Intergenic
995258262 5:110072490-110072512 CAACTGAACCACAGAGACAGTGG + Intergenic
995301267 5:110586027-110586049 CAGCTTAATCACAGGGAAGGGGG + Intronic
995595971 5:113748155-113748177 TAGCTGAACCACAGGGTGACAGG - Intergenic
996350845 5:122539838-122539860 CAGCTGAACCTGAGTGATAGCGG + Intergenic
997073327 5:130642743-130642765 CAGCTCAACCACAGTAAGAGAGG - Intergenic
997734407 5:136202876-136202898 CTGCTGAGCCAGAGGGAGAGTGG + Intergenic
998622752 5:143812578-143812600 CACCTGAGCCACAAGGACAACGG + Intronic
1001099071 5:168799059-168799081 CAGCTCATCCACAGGGAAAATGG + Intronic
1001129115 5:169048827-169048849 CAGCTGAACCAATGGGGCAAGGG - Intronic
1001227106 5:169954514-169954536 CTGCTGAACCACAGCTTCAGGGG - Intronic
1001263833 5:170257301-170257323 CAGCAGAAACTCAGGGCCAGAGG + Intronic
1002119711 5:176993100-176993122 CATTTGAACCCCAGAGACAGGGG + Intronic
1002161159 5:177314772-177314794 CAGCAGAACCCCAGTTACAGTGG - Intergenic
1002319547 5:178366739-178366761 CAGCAGAAGCACAGGCACGGAGG - Intronic
1002429319 5:179193956-179193978 CAGCTGAACCACAAGAACAGAGG - Intronic
1002844638 6:935783-935805 CAACTGAACCACACGGACTGGGG - Intergenic
1003559524 6:7169326-7169348 ATGCTGGACCACAGGGGCAGAGG - Intronic
1004386659 6:15178893-15178915 CACCTGAACCAGAGAGGCAGAGG + Intergenic
1008096255 6:47342568-47342590 CAACTGATCCACAGGCCCAGTGG + Intergenic
1008167493 6:48156703-48156725 CTGCTGCACCACAGTCACAGGGG + Intergenic
1009416698 6:63423538-63423560 CACCTGAACCCCAGAGGCAGAGG + Intergenic
1013011161 6:106121706-106121728 CACCTGAACCCCAGAGACAGAGG + Intergenic
1013933011 6:115557589-115557611 GAGTTGAAGAACAGGGACAGAGG - Intergenic
1014362337 6:120494916-120494938 CACTTGAACCAGAGAGACAGAGG + Intergenic
1017569709 6:155731371-155731393 CAGCCAGACCACAGGAACAGAGG + Intergenic
1018028283 6:159822464-159822486 CAGCTGGGCCACAGGGAGAGGGG - Intergenic
1018666972 6:166147757-166147779 CTGCGGAACAACACGGACAGTGG + Intergenic
1019032298 6:169024118-169024140 CAGCAGAAGCAGAGGGGCAGCGG + Intergenic
1019727269 7:2610016-2610038 GAAATGAACCACAGGGAGAGGGG - Intronic
1020837606 7:13173629-13173651 CAGCAGAAGGACAGGGAAAGGGG - Intergenic
1020867988 7:13590747-13590769 CAGCTGCACCTCAGGGACCAAGG + Intergenic
1022469397 7:30672985-30673007 CTGCTGAAACACAGGGTCACAGG - Intronic
1022722458 7:32953499-32953521 CACTTGAACCCCAGGGACGGAGG - Intergenic
1023813677 7:43931780-43931802 CAGTTGAACCAGAGAGACGGAGG - Intronic
1024595054 7:50925566-50925588 AAGCTGAATCACTGAGACAGAGG + Intergenic
1025635480 7:63316631-63316653 AAGCGGAAGCACAGGGCCAGTGG - Intergenic
1025647215 7:63431539-63431561 AAGCGGAAGCACAGGGCCAGTGG + Intergenic
1026466084 7:70655813-70655835 CAGCTGAACCCCCTAGACAGTGG + Intronic
1026760326 7:73121746-73121768 CAGCTGCACCACAGGGTTGGCGG + Intergenic
1027036668 7:74930567-74930589 CAGCTGCACCACAGGGTTGGCGG + Intergenic
1027086895 7:75270892-75270914 CAGCTGCACCACAGGGTTGGCGG - Intergenic
1027123011 7:75535793-75535815 CACCTGAACCCCAGAGGCAGAGG - Exonic
1029610984 7:101626507-101626529 CAGGTGAGACACAGGCACAGAGG + Intronic
1032467845 7:132157732-132157754 CAGATGAAACAAAGGAACAGTGG + Intronic
1032955174 7:136962214-136962236 CACTTGAACCTCAGAGACAGAGG - Intronic
1033228180 7:139576945-139576967 GAGCTGAGGCACAGGGACATGGG - Intronic
1035662530 8:1358947-1358969 CAGCAGAACCTCTGGGCCAGCGG + Intergenic
1037381513 8:18289889-18289911 AAGCTGAACCACATGGAAATTGG + Intergenic
1037995980 8:23352667-23352689 CATCTTAACCACAGAGACTGAGG - Intronic
1039637077 8:39179133-39179155 CGGCTGAACCACAGAGACTATGG + Intronic
1039965385 8:42280270-42280292 CAGGAGAACCACAAGAACAGGGG - Intronic
1042121456 8:65493109-65493131 CACTTGAATCCCAGGGACAGAGG - Intergenic
1042166163 8:65948107-65948129 CACCTGAACCATAGGGACCAAGG - Intergenic
1045322462 8:101092268-101092290 GAGCTGTGGCACAGGGACAGTGG - Intergenic
1048024377 8:130571370-130571392 CAACAGAAACACAGAGACAGCGG + Intergenic
1048853620 8:138667921-138667943 TAGCTGAACCACAGAGACAGAGG + Intronic
1048911086 8:139135758-139135780 CAGCTCAGACACAGGGACTGGGG - Intergenic
1049213331 8:141396613-141396635 CAGCTGCACCACAGGCACACGGG + Intronic
1049244399 8:141554159-141554181 GAGCTCAGGCACAGGGACAGGGG + Intergenic
1049432128 8:142570054-142570076 CAGCTGAACCACAGCCCCAGTGG + Intergenic
1049463458 8:142740477-142740499 CAGCTGTCCCAAGGGGACAGTGG + Intergenic
1049513776 8:143043065-143043087 CTGGTGACGCACAGGGACAGAGG + Exonic
1049750394 8:144280401-144280423 CCCCAGAACCACAGCGACAGGGG + Intronic
1049769202 8:144372067-144372089 CAGCTGAGCCACAGGGCCCAGGG - Intergenic
1051293219 9:15567103-15567125 CACCTGAACCCGGGGGACAGAGG - Intronic
1052369280 9:27645698-27645720 CTGCTGATCCACAGAGACTGTGG - Intergenic
1052841746 9:33297502-33297524 CATCTGACCCACAGAAACAGTGG - Intronic
1053001921 9:34581394-34581416 GTTCTGAACCACAGGGACAAAGG + Intronic
1053039363 9:34856867-34856889 TGGCTGAACCACAAAGACAGTGG + Intergenic
1053309548 9:37008141-37008163 CAGTTGAACCCTAGGGGCAGAGG - Intronic
1053460855 9:38270011-38270033 CAGCAGTACCACACGCACAGGGG - Intergenic
1053678746 9:40465000-40465022 CTGCTGAACCGCAGAGACTGTGG - Intergenic
1053928731 9:43093353-43093375 CTGCTGAACCGCAGAGACTGTGG - Intergenic
1054284977 9:63159942-63159964 CTGCTGAACCGCAGAGACTGTGG + Intergenic
1054291824 9:63300538-63300560 CTGCTGAACCGCAGAGACTGTGG - Intergenic
1054389842 9:64605081-64605103 CTGCTGAACCGCAGAGACTGTGG - Intergenic
1054505872 9:65911295-65911317 CTGCTGAACCGCAGAGACTGTGG + Intergenic
1056292533 9:85158097-85158119 GAGCTAAACCACAGGGAGGGAGG - Intergenic
1057892154 9:98877447-98877469 CAGCTGAACACCATGGAGAGGGG - Intergenic
1057938653 9:99261444-99261466 CAGCTGTGCCAGAGGCACAGAGG + Intergenic
1058683106 9:107457161-107457183 CGGGTGAACCACAAGGTCAGGGG + Intergenic
1059076350 9:111197432-111197454 CAACTGAACCACAGAGATGGTGG - Intergenic
1059644099 9:116247097-116247119 CAGCTGCACCACATTGATAGAGG + Intronic
1060602652 9:124888442-124888464 AAGCTGAGCCACAGGTACACAGG + Intronic
1061206948 9:129170074-129170096 CAGGTGAATCACAAGGTCAGGGG - Intergenic
1061792275 9:133064957-133064979 CACCTGCTGCACAGGGACAGGGG + Intronic
1062174316 9:135152558-135152580 TAGCTGAGCCCCAGGCACAGGGG + Intergenic
1062343012 9:136102126-136102148 CAGCTGGCCCAGAGGGAAAGTGG + Intergenic
1062525185 9:136975381-136975403 CATCTTGACCACAGGGACTGAGG + Intergenic
1187356093 X:18573400-18573422 CTGCTGAAGCACAGGAACACCGG - Intronic
1187502466 X:19851147-19851169 AAGCTGAACAAAAGGGTCAGGGG + Intronic
1188099896 X:26071142-26071164 CAGCTGAATCACAGAGACCACGG + Intergenic
1189528944 X:41858209-41858231 CAGCTGTGCCTCAGGCACAGAGG + Intronic
1190536659 X:51435270-51435292 CAGCTGAACTATAGGCTCAGTGG - Intergenic
1192189366 X:68981323-68981345 AAGCTGAAATACAGGGAAAGGGG - Intergenic
1192716486 X:73647746-73647768 CTGCTGATCCACAGAGACTGTGG - Intronic
1194263968 X:91733413-91733435 CAGCTGAACCACAGAGTTGGTGG + Intergenic
1194615936 X:96103537-96103559 CAGCTGAACGTCAGGGACTGTGG - Intergenic
1195582010 X:106515453-106515475 CAGCTGAAGACCAGGGGCAGGGG + Intergenic
1198786323 X:140292309-140292331 TGACTGAACCACAGAGACAGTGG + Intergenic
1200179474 X:154141514-154141536 CAGCTGAAGCACTGCCACAGAGG + Intergenic
1200372228 X:155739344-155739366 CAGCTGAACTGCAGAGACAGTGG - Intergenic