ID: 1086281975

View in Genome Browser
Species Human (GRCh38)
Location 11:85200551-85200573
Sequence GAGAACTACCCCATCTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 86}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086281972_1086281975 -5 Left 1086281972 11:85200533-85200555 CCCCTTGCATTGCAGTTGGAGAA 0: 1
1: 1
2: 2
3: 19
4: 187
Right 1086281975 11:85200551-85200573 GAGAACTACCCCATCTATGCAGG 0: 1
1: 0
2: 1
3: 12
4: 86
1086281968_1086281975 21 Left 1086281968 11:85200507-85200529 CCAAGGCGGCCCAGTCTCAGCAT 0: 1
1: 0
2: 0
3: 15
4: 127
Right 1086281975 11:85200551-85200573 GAGAACTACCCCATCTATGCAGG 0: 1
1: 0
2: 1
3: 12
4: 86
1086281974_1086281975 -7 Left 1086281974 11:85200535-85200557 CCTTGCATTGCAGTTGGAGAACT 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1086281975 11:85200551-85200573 GAGAACTACCCCATCTATGCAGG 0: 1
1: 0
2: 1
3: 12
4: 86
1086281967_1086281975 22 Left 1086281967 11:85200506-85200528 CCCAAGGCGGCCCAGTCTCAGCA 0: 1
1: 0
2: 0
3: 23
4: 145
Right 1086281975 11:85200551-85200573 GAGAACTACCCCATCTATGCAGG 0: 1
1: 0
2: 1
3: 12
4: 86
1086281973_1086281975 -6 Left 1086281973 11:85200534-85200556 CCCTTGCATTGCAGTTGGAGAAC 0: 1
1: 0
2: 1
3: 13
4: 158
Right 1086281975 11:85200551-85200573 GAGAACTACCCCATCTATGCAGG 0: 1
1: 0
2: 1
3: 12
4: 86
1086281970_1086281975 11 Left 1086281970 11:85200517-85200539 CCAGTCTCAGCATCAGCCCCTTG 0: 1
1: 0
2: 0
3: 23
4: 315
Right 1086281975 11:85200551-85200573 GAGAACTACCCCATCTATGCAGG 0: 1
1: 0
2: 1
3: 12
4: 86
1086281969_1086281975 12 Left 1086281969 11:85200516-85200538 CCCAGTCTCAGCATCAGCCCCTT 0: 1
1: 0
2: 6
3: 23
4: 311
Right 1086281975 11:85200551-85200573 GAGAACTACCCCATCTATGCAGG 0: 1
1: 0
2: 1
3: 12
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086281975 Original CRISPR GAGAACTACCCCATCTATGC AGG Intronic
902848012 1:19127536-19127558 GAGGACTACCACCTCTGTGCTGG + Intronic
906907567 1:49912189-49912211 GAAAACTATCCCATCTGTGCAGG + Intronic
909026422 1:70487077-70487099 GGGAACTATCTCATCTGTGCAGG + Intergenic
910408195 1:86912785-86912807 TAGAACTACTCCACCTATGTTGG - Intronic
910535990 1:88298299-88298321 GTTAACTACCCCATCTTTGCAGG - Intergenic
912300711 1:108513901-108513923 GAGAACTACCTAATGCATGCAGG - Intergenic
916372527 1:164115554-164115576 GAGAAATACCTCATGCATGCAGG - Intergenic
917050836 1:170920683-170920705 GAAAACTATCCCTTTTATGCAGG + Intergenic
917639673 1:176970779-176970801 ATGAAATATCCCATCTATGCTGG - Intronic
917703988 1:177613003-177613025 GATAACTATCCCACCTGTGCAGG + Intergenic
918688598 1:187451100-187451122 AAGAACTACCCCATACATGATGG + Intergenic
921874298 1:220176782-220176804 GAGAACTATCCTATCTGTGCAGG + Intronic
924618914 1:245642647-245642669 GGGAACTATCCTGTCTATGCAGG - Intronic
1063087445 10:2832468-2832490 GAGAACTTCCACATCTATTTGGG + Intergenic
1064327049 10:14361218-14361240 CATAACTACCACATCTATACTGG - Intronic
1076651746 10:131994334-131994356 AAGCACTACCCCTTCTATGCTGG - Intergenic
1080171819 11:29312962-29312984 AAGAACTACCCAATCCATACTGG + Intergenic
1082210724 11:49498275-49498297 GAAAACTATCCCATCTGTGCAGG + Intergenic
1082284909 11:50307744-50307766 GGGAACTACCCCATACATTCTGG + Intergenic
1083530580 11:63418148-63418170 GAAAACTATCCCACCTATGCAGG + Intergenic
1084198550 11:67540555-67540577 GGGAACGACCCCATCTTTGGAGG + Intergenic
1085219954 11:74865326-74865348 GGGAACTATCCTATCTGTGCAGG + Intronic
1086098379 11:83072516-83072538 GAGGACTACCCCAACTCTGTGGG - Intergenic
1086281975 11:85200551-85200573 GAGAACTACCCCATCTATGCAGG + Intronic
1086638914 11:89126517-89126539 GAAAACTATCCCACCTGTGCAGG - Intergenic
1086798312 11:91136959-91136981 GAGAACTGCCATATCTCTGCAGG + Intergenic
1086929499 11:92677271-92677293 CAGAACTGCCCCATTTATACAGG + Intronic
1087925305 11:103912072-103912094 GAGAATTTCCCCATCTATCAGGG + Intronic
1097547761 12:61025459-61025481 GAAAACTTCCCCATCCTTGCTGG - Intergenic
1097730323 12:63121919-63121941 AAGCACTCCCCCATCTATCCAGG + Intergenic
1098373013 12:69780221-69780243 GGGAACTATCCCATCTGTGCAGG - Intronic
1099106921 12:78508014-78508036 GAGAACTTCCCCATCTAGCAAGG + Intergenic
1102567736 12:113808042-113808064 GACAACAACCCCATCAATTCTGG + Intergenic
1102920252 12:116786405-116786427 AAGAACTACCCGATCTCGGCCGG - Intronic
1114152837 14:20064186-20064208 GAGAACTATCCTACCTGTGCAGG + Intergenic
1118886704 14:69873252-69873274 GAGATTTAACCCATTTATGCTGG + Intronic
1119320163 14:73725866-73725888 GAGAGCTACCCCAGCTTTGGTGG + Intronic
1124369244 15:29094044-29094066 GCCAACCACCCCATCTATGGAGG - Intronic
1126516670 15:49546874-49546896 GAGAACTCCCCCATCTAGCAAGG + Intronic
1131601914 15:93857922-93857944 AAGAACAACACCATATATGCTGG + Intergenic
1139594663 16:67950662-67950684 GAGAACCACACCCTCAATGCAGG + Exonic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1149306233 17:55349358-55349380 GTGAACTAGGCCAACTATGCTGG - Intergenic
1149538880 17:57453773-57453795 GAGAATTAACCCATTTATGCCGG - Intronic
1152879567 17:82807371-82807393 GAGATCTACCCCATTAAAGCCGG - Intronic
1153350796 18:4079121-4079143 TAGGCCTGCCCCATCTATGCTGG - Intronic
1156629526 18:38950031-38950053 AAGAACAACCTCATCAATGCTGG - Intergenic
1167234121 19:48303541-48303563 GGGAACTCCTCCATCTGTGCTGG - Intronic
925348152 2:3184586-3184608 GGGAAGAACCCCATCTATACAGG + Intergenic
928256287 2:29725771-29725793 TTGAGCTACCACATCTATGCAGG + Intronic
928398301 2:30959984-30960006 GAGCACTACCCCTTCTATGCAGG + Intronic
929617962 2:43327219-43327241 GAGAACTACCCCAGATGGGCTGG - Intronic
938249972 2:129807052-129807074 GAGAAATACCTCATCCATACGGG + Intergenic
948340202 2:237244523-237244545 GACAACAACCCAATCTAGGCAGG - Intergenic
1178589503 21:33897309-33897331 GCCAACTCCCCTATCTATGCAGG - Exonic
1179573424 21:42291764-42291786 GGGAACGACCCCATCTAGGAGGG - Intronic
1180639830 22:17289264-17289286 GAAAACAACCTCATCTATCCTGG + Intergenic
958833268 3:99115069-99115091 GGAAACTATTCCATCTATGCAGG - Intergenic
961165814 3:124763157-124763179 CAGAACTACACCATAAATGCAGG + Exonic
962268837 3:133963254-133963276 CAGATCTACCCCATCTCTGGAGG - Intronic
963363467 3:144304990-144305012 GAGACCTGCCCCACCTGTGCAGG - Intergenic
963971092 3:151430096-151430118 CTGAAGTACCCCATCTATTCAGG - Intronic
968696515 4:2032457-2032479 GAGAACTTCCCCAACTTAGCAGG - Intronic
970270340 4:14339812-14339834 GAGACATCCCCCAACTATGCTGG + Intergenic
971617674 4:28813246-28813268 AAGAACTATCCTGTCTATGCAGG + Intergenic
978133112 4:105223696-105223718 GAGAATAATGCCATCTATGCAGG + Intronic
986312006 5:6557756-6557778 GAAAATTTCCCCATCTGTGCTGG + Intergenic
988375259 5:30427923-30427945 GAGAACTTCCCAATCTAGGAAGG - Intergenic
992519708 5:77537986-77538008 GACATCTACACAATCTATGCAGG - Intronic
993495855 5:88608136-88608158 GAGCACAACCCCATTTATGAAGG - Intergenic
995548855 5:113259816-113259838 GAAAATTAACCCATTTATGCTGG - Intronic
996470266 5:123852379-123852401 AAGAACTACCCTCTCTATGCAGG - Intergenic
996989336 5:129609675-129609697 GAGAGCTGCCACATCTATACTGG - Intronic
997447663 5:133953260-133953282 GAGAACCACCCCAAATATCCTGG + Intergenic
1004028781 6:11845780-11845802 GAGATCTACCCCCTATAGGCAGG + Intergenic
1004581371 6:16956950-16956972 GAGATGTATCCCATCAATGCCGG - Intergenic
1011103981 6:83758514-83758536 GAGAACTATCCCATATGTGCAGG - Intergenic
1011804761 6:91059913-91059935 GGGAACTATCCCATCTGTGCAGG - Intergenic
1012186238 6:96220617-96220639 GAGAAATACCTAATCCATGCAGG - Intergenic
1013333485 6:109130636-109130658 GAAAACAACCCCCTCTCTGCTGG + Intronic
1014421580 6:121252602-121252624 GACAAATACCCAATATATGCAGG + Intronic
1016210404 6:141525793-141525815 GAGATTTATTCCATCTATGCAGG + Intergenic
1019107642 6:169681998-169682020 GGGAACTATCTCATCTCTGCAGG + Intronic
1025794688 7:64728516-64728538 GAAAACTTCCCCAGCTTTGCTGG - Intergenic
1042295496 8:67213114-67213136 GAGAACTGTGACATCTATGCTGG - Intronic
1047957999 8:129990092-129990114 GAGCACTTCCCCATCTATGAAGG + Intronic
1053531617 9:38887637-38887659 GACCACTACACAATCTATGCAGG + Intergenic
1054203841 9:62112065-62112087 GACCACTACACAATCTATGCAGG + Intergenic
1054634521 9:67476300-67476322 GACCACTACACAATCTATGCAGG - Intergenic
1055032555 9:71785113-71785135 GAGAAATACCGAATGTATGCGGG + Intronic
1055940960 9:81649260-81649282 GAGAACTACAATTTCTATGCTGG + Intronic
1058283986 9:103153153-103153175 GGAAACTATCCCATCTGTGCTGG - Intergenic
1058284003 9:103153290-103153312 GTGAACTATCCTGTCTATGCAGG - Intergenic
1062399044 9:136364474-136364496 GAGAACTACCGCAGGTAGGCGGG - Exonic
1062711742 9:137978463-137978485 GAGCACTACCCCTTCCATGAAGG + Intronic
1187258310 X:17661380-17661402 GAGAAATACCTAATGTATGCGGG - Intronic
1191592725 X:62905731-62905753 GAGAACTTCCCCAACCAAGCAGG - Intergenic
1191907244 X:66106845-66106867 GAGAACTTCCCCAACCAAGCAGG - Intergenic
1197515393 X:127421831-127421853 GAAAACTTCCCCATCCTTGCTGG - Intergenic
1198156136 X:133962578-133962600 GAGAACAATGCCAGCTATGCTGG + Intronic