ID: 1086283157

View in Genome Browser
Species Human (GRCh38)
Location 11:85214190-85214212
Sequence AAGTAGCAGCTGAAAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 381}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086283157_1086283161 25 Left 1086283157 11:85214190-85214212 CCCTCTCCTTTCAGCTGCTACTT 0: 1
1: 0
2: 1
3: 46
4: 381
Right 1086283161 11:85214238-85214260 TAGCTCTCGTCTTGATTATTAGG 0: 1
1: 0
2: 1
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086283157 Original CRISPR AAGTAGCAGCTGAAAGGAGA GGG (reversed) Intronic
901259121 1:7858364-7858386 AAGTAACTTCTGAAAAGAGAGGG + Intergenic
901353943 1:8626350-8626372 AGGAAGCAACAGAAAGGAGAGGG - Intronic
901357534 1:8664199-8664221 CAGTAGCAGCTGACAGGGGCTGG + Intronic
901404014 1:9033946-9033968 GAGAAGCAGCTGAACAGAGAGGG - Intergenic
901668098 1:10837888-10837910 GGGTAGCAGCTGGAAGGAGGTGG + Intergenic
904346833 1:29878249-29878271 GAGTTGCAGCTGCAGGGAGAGGG + Intergenic
905847698 1:41246505-41246527 AAGGAGCAGCTGAAAGGAGTTGG + Intergenic
906110873 1:43321255-43321277 AAGGACCAGCTGAAATAAGAAGG - Exonic
908159997 1:61397101-61397123 AAATAGCATCTAAAGGGAGATGG + Intronic
908166602 1:61464965-61464987 AAGTAGGACCTGAGTGGAGAGGG + Intergenic
908790552 1:67776688-67776710 TAGTCCCAGGTGAAAGGAGAAGG + Intronic
909000570 1:70212627-70212649 CAGTAGCCTCTTAAAGGAGAAGG + Intronic
909503913 1:76365914-76365936 ATGTAGGAACTGGAAGGAGATGG - Intronic
910091383 1:83468474-83468496 AACTAGCAGAGGAAAGGGGAAGG - Intergenic
910228556 1:84962648-84962670 AAATAGTACCTGAAAGGTGAGGG + Intronic
910359857 1:86404799-86404821 AAGGAGCAGAGGAAAGGAAAAGG - Intergenic
910534367 1:88279600-88279622 ATGTAGCAGCTGGAAAGAAATGG - Intergenic
910583046 1:88849246-88849268 TAGTAGCAGCAGAGATGAGACGG - Intergenic
910896286 1:92073072-92073094 AAGTGGCATCTAAAATGAGAAGG + Intergenic
911647538 1:100352468-100352490 GAGTAACTGCTGAAAGGAGGTGG + Intronic
912214165 1:107588374-107588396 AAGTATCAGGGAAAAGGAGAAGG + Intronic
913107989 1:115632431-115632453 AGATACCAGCTGAGAGGAGAGGG - Intergenic
913598966 1:120404845-120404867 GGGTGGGAGCTGAAAGGAGAAGG - Intergenic
914088411 1:144474775-144474797 GGGTGGGAGCTGAAAGGAGAAGG + Intergenic
914310201 1:146459435-146459457 GAGTGGGAGCTGAAAGGAGAAGG - Intergenic
914376725 1:147079082-147079104 AATTATCAGCTGACAGGGGACGG + Intergenic
914379637 1:147104750-147104772 GGGTGGGAGCTGAAAGGAGAAGG + Intergenic
914397565 1:147285412-147285434 AAGAAGCAGCTGCCAAGAGAAGG + Exonic
914591909 1:149113704-149113726 GGGTGGGAGCTGAAAGGAGAAGG + Intergenic
915789172 1:158649209-158649231 AACTAGAAGCTGACAGTAGAGGG - Intronic
917780658 1:178392719-178392741 TAGTATCAGCTGAAAGGCCAGGG - Intronic
917793070 1:178512281-178512303 AACTAGCAGTTGAAATGAGAGGG + Intergenic
917985371 1:180311664-180311686 GACTAGCAGCTGGGAGGAGAGGG + Intronic
918409085 1:184240044-184240066 AGGAAGCAGCTCTAAGGAGAGGG + Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919917593 1:202148437-202148459 AAGCAGCAGCAGTAAGGACAAGG - Exonic
920343113 1:205288116-205288138 CAGAAGCAGCTCAGAGGAGAAGG - Intergenic
921494841 1:215826726-215826748 AAGTAGCAGGTGAAAAGTAAAGG + Intronic
922012209 1:221600086-221600108 TAGTAGCATTTGAAAGCAGAAGG - Intergenic
923221352 1:231897064-231897086 AAGAAGGAGCTGGAAGGGGAAGG + Intronic
923458544 1:234187364-234187386 AAAGAGCAGCTCCAAGGAGAGGG + Intronic
924218962 1:241854017-241854039 AAGAAGCTGCTGCAAGGAGGAGG - Intronic
924253976 1:242163737-242163759 AAGAAAAAGGTGAAAGGAGATGG + Intronic
1062826809 10:575960-575982 GAGTAGCATCTGCAAGGAGGTGG - Intronic
1063290272 10:4738647-4738669 GAGTAGCAGGAAAAAGGAGAAGG - Intergenic
1063290278 10:4738680-4738702 GAGTAGCAGGAAAAAGGAGAAGG - Intergenic
1063290284 10:4738713-4738735 GAGTAGCAGGAAAAAGGAGAAGG - Intergenic
1063436869 10:6039720-6039742 ACGGAGCATCTGAAATGAGAAGG - Intronic
1064033498 10:11898163-11898185 AAATAACAGAAGAAAGGAGATGG + Intergenic
1064164291 10:12973339-12973361 AAGTCACAGCTGAATGGAGGGGG + Intronic
1066079176 10:31912600-31912622 AAGTAGGAGGGCAAAGGAGATGG + Intronic
1067007417 10:42678134-42678156 AGGTAGCAGCTAAGAGGTGAGGG + Intergenic
1067169252 10:43892689-43892711 AATGAGCAGCTGAAAGGAAGGGG - Intergenic
1068017477 10:51535608-51535630 ATGTAGTAGCTTAAATGAGAAGG + Intronic
1068177132 10:53475818-53475840 ATAAAGCATCTGAAAGGAGAAGG - Intergenic
1068763946 10:60742503-60742525 CAGTGGCCACTGAAAGGAGATGG - Intergenic
1068877679 10:62014428-62014450 AAGTAGCGGCTGAAGGTAGGGGG + Intronic
1068946859 10:62738436-62738458 AAGGGGCAGCTGCATGGAGAAGG + Intergenic
1069286299 10:66719950-66719972 AAGTAGCAAGTGAAAGAAAAGGG + Intronic
1070177406 10:73983697-73983719 AAGAACCATCTGAAAGGAGCAGG - Intergenic
1070865314 10:79705117-79705139 TATTAGGAGCTCAAAGGAGAAGG + Intronic
1071016935 10:81008503-81008525 ATGCAGCAGCTGAAAAGTGAAGG + Intergenic
1071338956 10:84624948-84624970 ATGTAGCAGCCAAAAGGAGAAGG + Intergenic
1071460686 10:85891609-85891631 AAGGACCATCTGAAAGGAGCAGG + Intronic
1071982535 10:91018331-91018353 GAGAAGCAGCTGAAAAGTGATGG + Intergenic
1072084199 10:92062394-92062416 AAGTAGCTGCATGAAGGAGATGG + Intronic
1072190284 10:93072569-93072591 CAGTAGCAGCTGATTGTAGATGG + Intergenic
1073555594 10:104447803-104447825 AAGCAGCAGCTGAAAGTAAGTGG + Exonic
1073710594 10:106033540-106033562 TAGTAATAGCTGAAAGGTGAGGG + Intergenic
1073870778 10:107861777-107861799 AAATACCAGCGGAAAAGAGAGGG - Intergenic
1074627349 10:115205755-115205777 TGGTAGCATATGAAAGGAGAAGG - Intronic
1075291978 10:121238489-121238511 AAGGAGAAGCATAAAGGAGATGG - Intergenic
1076203460 10:128576500-128576522 AAGTAGCAGCTGATCTGTGAAGG - Intergenic
1076584578 10:131536778-131536800 ATGTTGCAGGTGAAAGGAGGGGG + Intergenic
1076850942 10:133092715-133092737 AAGAAGCACCTGAATGAAGAAGG + Intronic
1076921754 10:133457969-133457991 GAGGAGCAGCTGAAATGAGGTGG + Intergenic
1077723475 11:4650324-4650346 GAGGAACAGCAGAAAGGAGAGGG + Intronic
1078488992 11:11751810-11751832 AAGTAGCAGCTTGAAGGAGTTGG + Intergenic
1082774201 11:57233475-57233497 AAGTGGGAGCTAAAAGGAGGGGG - Intergenic
1082985872 11:59171034-59171056 AAATGACAGCTGCAAGGAGAGGG + Intergenic
1083130335 11:60618961-60618983 AGGTAGGAGCTGAAGGGACACGG - Intergenic
1084202751 11:67572771-67572793 AATTAGGAGCTGAAGGGACACGG + Intergenic
1085280119 11:75324718-75324740 AAGTCGCAGCAGAAAGGGAAGGG - Intronic
1085704322 11:78772407-78772429 GAGCAGCAGCAGAGAGGAGATGG - Intronic
1085847348 11:80081523-80081545 CTGAAGCAGCTGAAAGGAAAGGG + Intergenic
1085993068 11:81875093-81875115 AAGTTGGAGCTTAAAAGAGAAGG - Intergenic
1086056115 11:82649062-82649084 AAGGAGCAGAAGAAAGGAGGAGG - Intergenic
1086283157 11:85214190-85214212 AAGTAGCAGCTGAAAGGAGAGGG - Intronic
1086399154 11:86446687-86446709 AAGAAACTGCTGAAAGGTGATGG + Intronic
1086673987 11:89582038-89582060 GAATAGCAGCTGACAGGAGCTGG - Intergenic
1087431767 11:98064965-98064987 AAGTATCTGCTGTAAAGAGAAGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088039861 11:105366867-105366889 AAGTAGAAGCTGTAAGAAGAGGG - Intergenic
1088454825 11:110022600-110022622 AAGTAGATGCTGAGAAGAGATGG - Intergenic
1093202400 12:16204622-16204644 AAGAGGCAGCTGAAAGGAACAGG + Intronic
1094083734 12:26566019-26566041 AAGGAGGAGAGGAAAGGAGAAGG + Intronic
1094214253 12:27923563-27923585 AAGTATCAGCTGGAGGGAGAAGG - Intergenic
1096370768 12:51067248-51067270 AAGAAGCAGCTGTTAGGAAAGGG - Intronic
1098507451 12:71270538-71270560 AAGTAGCAGATGAAAAGTAAAGG - Intronic
1101207353 12:102501832-102501854 AAGTAGCTGCTGAGAAGAAAGGG + Intergenic
1101867482 12:108531463-108531485 AAGTCTCTCCTGAAAGGAGAGGG - Intronic
1102772744 12:115492786-115492808 AACTTGCAGCTTAAAGCAGAAGG + Intergenic
1102944530 12:116974294-116974316 AAGAACTACCTGAAAGGAGAAGG + Intronic
1103582448 12:121925310-121925332 AAGTAGCAGATGGAGGAAGAAGG - Intronic
1104468943 12:129013199-129013221 AAGTACCAGCTGGAAGGACCAGG + Intergenic
1105585216 13:21737294-21737316 AAGAAGCAGGAGAAAGGAGCAGG - Intergenic
1106274693 13:28192913-28192935 AAATAACATCTGAAAAGAGATGG - Intronic
1106318038 13:28612456-28612478 AAGAAGCAGCTACAATGAGAGGG - Intergenic
1106949763 13:34870340-34870362 AATAAGGAGCTGAATGGAGAGGG - Intergenic
1108699426 13:52931157-52931179 AAGCCAGAGCTGAAAGGAGATGG - Intergenic
1110023398 13:70505573-70505595 AGGTAGCAGGTAGAAGGAGAGGG + Intergenic
1110972248 13:81779890-81779912 AAGTAGCAGAGGAAAGCAGTAGG - Intergenic
1111552566 13:89833914-89833936 AAGGAGCAGAGGAAAGGAAAAGG - Intergenic
1111822919 13:93235167-93235189 AGGTTGAAGCTGAAAGGAGGAGG + Intronic
1112894809 13:104285959-104285981 AAGCAGGAGCTGAAAGAAGTTGG + Intergenic
1113250682 13:108449199-108449221 AAATGGAAGCTGATAGGAGAGGG - Intergenic
1113370997 13:109725431-109725453 AATTATCAGCTGAAAGAGGAAGG + Intergenic
1114231169 14:20784219-20784241 TAGCAGCATCTGAAAGGAAAGGG + Intergenic
1115018529 14:28646379-28646401 AAGAAGAAGAAGAAAGGAGAAGG + Intergenic
1115312721 14:31995600-31995622 AGGTAGCCGATGAGAGGAGAAGG + Intergenic
1115901155 14:38149691-38149713 AAGTAGGAGCTGAAAGCCAAAGG + Intergenic
1119623864 14:76153508-76153530 CAATAGCAGCTGAAATGACAGGG - Intronic
1120388408 14:83874945-83874967 ATGAAGCAGCTGAAAAGTGAGGG - Intergenic
1121108953 14:91299404-91299426 CAGTAGGAGCTGAAACAAGAAGG + Intronic
1122679515 14:103447339-103447361 AATTAGCAGCTAAGAGGAGATGG - Intronic
1124555507 15:30721430-30721452 GAGAAGCAGGAGAAAGGAGATGG - Intronic
1124675754 15:31684265-31684287 GAGAAGCAGGAGAAAGGAGATGG + Intronic
1125071221 15:35555908-35555930 AAATAGCAGCTGAGTAGAGAAGG - Intergenic
1125753798 15:42048899-42048921 AAGTGGCAGCTGAAAGGTTTTGG - Intronic
1126374857 15:47987337-47987359 AGGCAGCAGCTGAAAAGAGGGGG + Intergenic
1128491912 15:68155825-68155847 AAATAACTGCTGAAGGGAGAAGG - Intronic
1128557465 15:68641478-68641500 AAGGAGCAGGGAAAAGGAGAAGG + Intronic
1128648325 15:69393079-69393101 AAGTGGGAGCTGAGGGGAGAGGG + Intronic
1129113109 15:73349742-73349764 AGGTAGCAGCAGTAGGGAGAGGG - Intronic
1129959307 15:79668937-79668959 AAGGAGCAGAGGAAAGGAAAAGG - Intergenic
1130091062 15:80821769-80821791 AAATTGGGGCTGAAAGGAGAAGG + Intronic
1130109199 15:80950691-80950713 AAGCAGCAGCTGAAAGGGACTGG - Exonic
1130445069 15:83992931-83992953 TAGTAAGAGCTGAAAGGTGAGGG - Intronic
1133081429 16:3323789-3323811 AAGGAGCAGCGGAAAGGAAAAGG - Intergenic
1133911115 16:10067629-10067651 AAACAGCAGCTGAGAGGAGTGGG + Intronic
1134035463 16:11027138-11027160 AAGGAGCAGAAGAAAGGAAAAGG + Intronic
1135731740 16:24900378-24900400 AAGAAGCAGGAGAAAAGAGATGG + Intronic
1136480396 16:30538099-30538121 AAGGAGCAGAGGAAAGGAAAAGG - Intronic
1137815811 16:51396478-51396500 AATTAGCAGGTCAAGGGAGAAGG + Intergenic
1137872922 16:51967800-51967822 AAAGTGAAGCTGAAAGGAGAAGG - Intergenic
1137930123 16:52579010-52579032 AGGAAGGAGCAGAAAGGAGAGGG + Intergenic
1139477350 16:67209336-67209358 AGGCAGCAGCTGAGAGGACACGG + Intronic
1141952134 16:87346014-87346036 GAGTGGCTGCTGAGAGGAGAAGG + Intronic
1141972684 16:87493663-87493685 AAGTAGCCGCGGAAAGAAGGCGG - Intergenic
1142522078 17:512021-512043 AAGCAGCAGCTGCCAGGGGAAGG + Exonic
1143435456 17:6921266-6921288 ATGTGGCAGCTGTAAGGAGATGG + Intronic
1144032014 17:11331793-11331815 AAGAAGCAGCTGGAAAGAGAGGG - Intronic
1144225389 17:13139894-13139916 ACGTGGCAGCAGGAAGGAGAAGG - Intergenic
1144402573 17:14920401-14920423 AAGTAGCACCTGAGAGGAGGTGG + Intergenic
1145785756 17:27592833-27592855 AAGTGTTAGCTCAAAGGAGAAGG - Intronic
1146064464 17:29623473-29623495 AGGAAGCAGCTGAAAGAACAAGG + Intergenic
1147307214 17:39572513-39572535 AAAGGGCAGCTGAAGGGAGATGG - Intergenic
1147337417 17:39735951-39735973 AAGTAGAAGCACAGAGGAGAGGG - Intergenic
1147508060 17:41039940-41039962 AAGGAGCAGGTGAAAAGAGGTGG + Intergenic
1147621509 17:41871139-41871161 AAATAGCAGTTGAAATGAGATGG - Intronic
1147669120 17:42166574-42166596 AAGTAGTAGCTGCAGGGGGATGG - Intronic
1147836306 17:43334443-43334465 AGATAGGAGCTGAAAGGACACGG - Intergenic
1149560508 17:57604879-57604901 GAGGAGCAGCTGGAAGGAGTGGG - Intronic
1149560657 17:57605757-57605779 CAGAGGCAGCTGAAAGAAGAGGG - Intronic
1149623576 17:58064093-58064115 AAGCCGGAGCTGAAAGCAGAGGG + Intergenic
1150515474 17:65805384-65805406 AAGTAACAACTGAAAGAAAAGGG + Intronic
1151669485 17:75564212-75564234 CTGTAGCAGTTGGAAGGAGATGG + Intronic
1152682141 17:81674043-81674065 AAGCAGCAGCTGGAAGGGGGTGG + Intergenic
1153496022 18:5700441-5700463 CTGAAGAAGCTGAAAGGAGATGG + Intergenic
1153931531 18:9883667-9883689 GACTTGCAGCTGAAAGCAGAGGG - Intergenic
1155566306 18:27138407-27138429 ATGTAGAAGCTGGCAGGAGAAGG - Intronic
1156074286 18:33254730-33254752 GAGGAGCAGATGGAAGGAGAAGG + Intronic
1158055772 18:53278561-53278583 AATTAACAGCAGGAAGGAGAGGG - Intronic
1158495113 18:57948489-57948511 AAGAATCAGGTGCAAGGAGAGGG - Intergenic
1159924144 18:74251609-74251631 AAGCAGCAGATGAAAAGAAAGGG + Exonic
1163933442 19:20420922-20420944 TAGTAGCAGCTGCAAGAAAAGGG + Intergenic
1164268732 19:23648952-23648974 AAGTAGCATGTGAAATGACATGG + Intronic
1164335919 19:24321266-24321288 AAGGAGTAGCTGAAGGGAGAGGG - Intergenic
1164535601 19:29084558-29084580 AAGAAGTAGCTGAAAGAGGAAGG + Intergenic
1164827900 19:31297843-31297865 AAGTGGCAGCTGAAATGGGTGGG - Intronic
1168104225 19:54156791-54156813 CAGTCGCAGCAGAAAGGAAAAGG - Exonic
1168534310 19:57156390-57156412 TAGTAGCTGCTGGAAGGTGAGGG - Intronic
1202682534 1_KI270712v1_random:20555-20577 AACAAGCACCTGCAAGGAGAAGG - Intergenic
925746954 2:7051526-7051548 AAGGAGCAGCGAAGAGGAGATGG + Intronic
925906654 2:8543842-8543864 CAGTAGCAGCTGGCAGGAAATGG + Intergenic
926762404 2:16290549-16290571 GACTGGCAGCTGAAATGAGAGGG - Intergenic
927857688 2:26537574-26537596 AGGAAGCAGCTGAGAGGTGAGGG + Intronic
928822225 2:35374999-35375021 AAGAAGCACCAGAAAGGACAAGG + Intergenic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
929771310 2:44894544-44894566 AAGTTGCAGCTAACAGAAGAAGG - Intergenic
930149288 2:48042107-48042129 AAGAACCAACTGAAAGGAGTAGG - Intergenic
930306654 2:49683323-49683345 TAATAGAAGCTGAAAGCAGAAGG + Intergenic
930400869 2:50884866-50884888 AAGTAGCAATTGAAGGGGGAGGG + Intronic
930449069 2:51511265-51511287 ATGGAGCAGCTGAACAGAGAGGG - Intergenic
930780325 2:55218620-55218642 AAGTAGAATCTGAGATGAGAAGG + Intronic
930915992 2:56688874-56688896 AAGTATAAGCTGAAAGGAGGAGG + Intergenic
931632407 2:64312786-64312808 ACGTAGGAGCTGAGTGGAGAAGG - Intergenic
932036857 2:68253926-68253948 AAGTAGCTCCTGAAGGGGGAAGG - Intronic
935876251 2:107511377-107511399 AAGGTGCAGCTGAAAGCAGGAGG - Intergenic
936959723 2:118060432-118060454 AAGGAGCAGGTGAGAGGAGAAGG + Intergenic
937571311 2:123365691-123365713 CAGTAGCAGCAGAAAGCAGCAGG + Intergenic
937995127 2:127688218-127688240 CAGTAACAGCACAAAGGAGATGG - Intergenic
938647981 2:133350903-133350925 AAGTAGGAGCTGACAGGTGAAGG - Intronic
941427594 2:165368134-165368156 GAAGAGGAGCTGAAAGGAGATGG + Intronic
941561416 2:167050222-167050244 ATGTAACAGCTGAAAGGTAACGG - Intronic
941747657 2:169103998-169104020 AGGCAGCTGCTGAAAGGAGAGGG + Intergenic
942068524 2:172294386-172294408 ATGGAGCAGCTGACATGAGAGGG - Intergenic
942234028 2:173887092-173887114 ACGTAGCAGGTGAAAGTAGAGGG + Intergenic
942490193 2:176482250-176482272 ATGTTGGAGCTGAAAGGACAAGG - Intergenic
942895478 2:181048069-181048091 CAGTAGAAGCTGAAAGGAAAGGG - Intronic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
943704340 2:191019260-191019282 AAATGGTAGCTGGAAGGAGAGGG - Intronic
943902197 2:193454789-193454811 AAAGACCAGCAGAAAGGAGATGG + Intergenic
943974312 2:194451381-194451403 AATTATCAGCTGAAAGAAAATGG - Intergenic
944644994 2:201770802-201770824 AGGTAGCAGCTGAAAAGGCAAGG + Intronic
945447842 2:209959422-209959444 ATGTAGCAGCTGTGAGAAGAGGG - Intronic
945618982 2:212109473-212109495 AAGTAATAGCTGAAAGAAGTGGG - Intronic
946042752 2:216796545-216796567 AAGTAGCAGAAGAAAGACGATGG + Intergenic
946150308 2:217761155-217761177 AAGGAGCAGAGGAAAGGAAAAGG - Intergenic
947732169 2:232437343-232437365 AAGAAGCAGGTGGCAGGAGATGG + Intergenic
948066350 2:235083693-235083715 AAACAGCAGCAGAAAGCAGAGGG + Intergenic
948731684 2:239968150-239968172 AAGTAGAAGATGGAAGGTGATGG + Intronic
1169233634 20:3911121-3911143 AGGCAGCATCTGTAAGGAGAAGG + Intronic
1169369524 20:5017954-5017976 AAGTAGAATAGGAAAGGAGAAGG + Intergenic
1169911284 20:10649627-10649649 CATTTGCATCTGAAAGGAGATGG + Exonic
1170247310 20:14236681-14236703 CAGTAGCCTCTGAAAAGAGAGGG - Intronic
1170591567 20:17775707-17775729 ATGTTGCAGCTGAGAGGTGAAGG - Intergenic
1170950300 20:20930690-20930712 AAGTAGCAGGTAAATGGGGAAGG - Intergenic
1172586871 20:36091835-36091857 AGATAGCATCTGAAAGAAGATGG - Intronic
1174541085 20:51290005-51290027 AAGTCCCAGGTGAGAGGAGATGG + Intergenic
1174835409 20:53852135-53852157 AAGAAACAGCTGGAGGGAGAAGG - Intergenic
1175368910 20:58473644-58473666 AAATAACAGCTGAAAGCAGATGG + Intronic
1175487697 20:59357101-59357123 AAGGAGCAGTGGGAAGGAGAAGG - Intergenic
1175568749 20:60002303-60002325 AAGGATCAGCTGCAAGGACATGG - Intronic
1177260288 21:18721210-18721232 AAATCGCAACTGAAAGGAGCTGG - Intergenic
1177485454 21:21749484-21749506 AAGAAAGAGATGAAAGGAGAAGG - Intergenic
1181453018 22:23036637-23036659 AAGTAGCTGCTGAAAGAGGAAGG + Intergenic
1181633060 22:24161524-24161546 AAGTAGCAGCTGAGAGAAGCAGG - Intronic
1182963994 22:34504459-34504481 AAGTAGCTGATGGAGGGAGAAGG + Intergenic
1183226728 22:36555481-36555503 ATATAGCACCAGAAAGGAGATGG + Intergenic
1183342570 22:37289839-37289861 AGGAAGCAGCTGGAAGGAGCAGG + Intronic
1183821935 22:40353303-40353325 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
1184639488 22:45861814-45861836 AAGTAGGAGGTGAGAGGAGATGG - Intergenic
950496954 3:13339619-13339641 AAGGAGCAGCTGGAAGGACTGGG + Intronic
950732837 3:14977165-14977187 AAGTAGAAGCTGGAGGCAGATGG - Intronic
951073164 3:18356648-18356670 AATTAGCAGCTGAGAGATGAAGG - Intronic
952119592 3:30226302-30226324 AAGAAGAAGATGACAGGAGAGGG - Intergenic
956964475 3:74443125-74443147 CAGTAGCAGCTTTAAGGAGAAGG + Intronic
957021519 3:75133617-75133639 AATGATCAGCTGAAAGGATATGG - Intergenic
957905335 3:86546107-86546129 AATTAGCAGCTGAAAGAGGTGGG - Intergenic
959548275 3:107623445-107623467 ATGTGGCAGCTAAAAGTAGAAGG - Intronic
960476143 3:118131103-118131125 AAGTATAAGCTGAAAGGAAAAGG + Intergenic
960507762 3:118514046-118514068 AGATAGCAGAAGAAAGGAGACGG - Intergenic
960582809 3:119294923-119294945 AAGCAGAAGCTGAAACGAAAGGG + Exonic
961178221 3:124853646-124853668 AAGTAGAACCTGGAAGGAGAAGG + Intronic
962120664 3:132556958-132556980 AAGGAGCAGAGGAAAGGGGAGGG - Intergenic
962417168 3:135193572-135193594 AAGCAGAAGCTGAGAGCAGAGGG + Intronic
962508373 3:136072131-136072153 AAATATCAGATGACAGGAGATGG - Intronic
962941117 3:140125547-140125569 AGGTATCAGCTGAGAGGAGTTGG + Intronic
963509290 3:146226929-146226951 TACTAGCAGCTCAAAGGAGATGG - Intronic
963554217 3:146766650-146766672 AAGTAAAAACTGAAAGGAGAAGG + Intergenic
963626990 3:147685665-147685687 AATTAACAGTTGAAATGAGAAGG - Intergenic
964428083 3:156574212-156574234 AAAAAGCAGCTGAAAGTATATGG - Intergenic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964763446 3:160156157-160156179 AAGAAGCAGGAGAAAGGAAATGG - Intergenic
966678067 3:182610788-182610810 AAGGAGCAGAGGAAAGGAAAAGG + Intergenic
966879322 3:184341081-184341103 CAGTAGCAGTAGAAAGGACAGGG + Intronic
967002433 3:185349070-185349092 AAGCAGCAGCTGTAAGCATATGG + Intronic
969185619 4:5472083-5472105 AAGTAGGAGCTGAGAGGACATGG + Intronic
969446315 4:7246681-7246703 AGGTAGCATCTGGAGGGAGATGG + Intronic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970559514 4:17268975-17268997 AAGTAGCAAAGGAAAGGTGATGG - Intergenic
970926068 4:21453787-21453809 ATGTGCTAGCTGAAAGGAGATGG - Intronic
971233493 4:24819755-24819777 AAGCAGCAGCACAAAGGGGAAGG + Intronic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971514649 4:27471248-27471270 AAGTAGCAGAAGACAGGAGGTGG + Intergenic
971796128 4:31230559-31230581 TAGAATCCGCTGAAAGGAGAAGG + Intergenic
972306927 4:37839588-37839610 AAGTAGAAGATGGAATGAGAAGG + Intronic
972587783 4:40454147-40454169 AAGTAGCAGCAGAGATGATACGG + Intronic
974393929 4:61310761-61310783 AAGCAGCAGATGAAAGGAAAGGG - Intronic
977664943 4:99635450-99635472 AAGTGGAAGATGAAAGTAGAGGG + Intergenic
977698266 4:99991341-99991363 AAGGAGCAGAGGAAAGGAAAAGG - Intergenic
978598092 4:110400376-110400398 AAGGAGCAGAGGAAAGGAAAAGG - Intronic
981855109 4:149280002-149280024 GGGTAGCAGCTGAGAGGGGAGGG + Intergenic
983091942 4:163514392-163514414 AACTGGCAGCTGAAAGGTGGGGG + Intronic
983124738 4:163936821-163936843 AACTAACAGCTGAAAAGAGAAGG + Intronic
983790312 4:171789034-171789056 AAGGAAAAGCTGAAAGGATAAGG + Intergenic
984535534 4:180970070-180970092 AAGTAGCAGCAAAAAGAAGAGGG - Intergenic
984703985 4:182834580-182834602 AAGAAGGAGGGGAAAGGAGAAGG - Intergenic
984951091 4:185008287-185008309 AAGCAAGAGCTCAAAGGAGAAGG - Intergenic
987091950 5:14516017-14516039 CACTAACAGCTAAAAGGAGAGGG - Intronic
988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG + Intergenic
990474409 5:56147872-56147894 AAGAAGAAGAAGAAAGGAGAAGG - Intronic
991996407 5:72391310-72391332 AAGGAGGAGATGAAAGGTGAGGG + Intergenic
992031443 5:72725535-72725557 AAGGAGCAGAAGAAAGGAAAAGG + Intergenic
992506942 5:77396190-77396212 AAGTAACTGCTGAAACCAGAGGG - Intronic
992916362 5:81457454-81457476 AAATAGCAGATGAAAGTATAAGG + Intronic
993121917 5:83785287-83785309 AAGGAGAAGCTGAAAGCACAGGG - Intergenic
993885531 5:93411250-93411272 AAGGAGCAGCTGAGATGAAAAGG + Intergenic
994818407 5:104615162-104615184 AGGTAGCAGGTAACAGGAGATGG - Intergenic
994905715 5:105839220-105839242 AAGTAGGAGCTGTGAGAAGAGGG - Intergenic
995009773 5:107244157-107244179 AAGTTGATGCTGCAAGGAGAGGG - Intergenic
995203114 5:109448406-109448428 GAGTAGAAGCTGAAAAAAGATGG - Intergenic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998727117 5:145030313-145030335 AAGTAGCTGGTGAGAGAAGAAGG + Intergenic
998880265 5:146638226-146638248 GAGTAGCAACTGAAGGGAGGTGG - Intronic
998921077 5:147069057-147069079 AACTATAAGCTGAAAGGACATGG + Intronic
998997328 5:147879952-147879974 AAGTGGCAGCAGAAAGGAGGTGG + Intronic
999376614 5:151091170-151091192 AAGAAGAAGCAGAAAGGAGCTGG - Intronic
999773447 5:154792676-154792698 AAGGAACAGGAGAAAGGAGAAGG + Exonic
1001662990 5:173410439-173410461 AACTATCAGCTGAAAGGACAGGG - Intergenic
1001737811 5:174021143-174021165 AAGAAGCAGAAGGAAGGAGAAGG + Intergenic
1002305810 5:178282105-178282127 GAGGAGCAGCTGAACGGAGCAGG - Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1004183364 6:13399908-13399930 AAGTAGCAGGGAGAAGGAGAAGG + Intronic
1004872562 6:19922236-19922258 CACCAGCTGCTGAAAGGAGAAGG + Intergenic
1006061220 6:31421306-31421328 AATTTCCTGCTGAAAGGAGAGGG + Intergenic
1006491638 6:34392755-34392777 AACCAGCATCTGAAAGGAGAGGG + Intronic
1006975221 6:38094168-38094190 AAGTAGCAGCAGAGAGCTGAGGG + Intronic
1007180152 6:39923731-39923753 CAGTAGGAGCTGAAGGGAGCTGG + Intronic
1007591000 6:43020965-43020987 CAGGAGCAGCTGAAAGGAGGTGG - Exonic
1008375003 6:50781464-50781486 AAGTAGGAGCTGGATGGTGATGG - Intergenic
1008518571 6:52341691-52341713 AAGTTTCAGTTGAAAGGAGTTGG + Intergenic
1009317804 6:62244084-62244106 AAGTAGCAGATGACAGGAGCAGG - Intronic
1009358838 6:62789205-62789227 GAGAATCAGCTGATAGGAGAGGG + Intergenic
1009896563 6:69758420-69758442 GAGTGCCAGCTGAAAGGAAATGG - Intronic
1013353570 6:109327778-109327800 AAGGAGCAGAGGAAAGGAAAAGG - Intergenic
1013431165 6:110055891-110055913 ATGCAGCACCTGAAAGGAAAAGG - Intergenic
1014080392 6:117280418-117280440 AGGTAGCAACTGGAAGAAGATGG - Intergenic
1014329052 6:120036765-120036787 AAGACACAGATGAAAGGAGAGGG + Intergenic
1015823880 6:137291702-137291724 AACAAACAGCTGAAAGGAAAAGG - Intergenic
1016781034 6:147958803-147958825 AAGAGGCAGATGAAAGAAGAAGG - Intergenic
1017065516 6:150525671-150525693 ATGTGGTAGCTGAAAGGACAGGG - Intergenic
1017868932 6:158469818-158469840 AAGCAGCAGAAGGAAGGAGATGG + Intronic
1018009303 6:159655284-159655306 AAGAAGCAGCGGAAAGGCGCTGG + Intergenic
1021102844 7:16603502-16603524 AAGTAGGGGTGGAAAGGAGATGG + Intronic
1021129047 7:16888640-16888662 CAGTAGCAGCTGTAAGGAGCTGG - Intergenic
1021522459 7:21551425-21551447 AAATAGCAGCGGAAAGGAATTGG - Intronic
1022545079 7:31179645-31179667 GGGTAGAAGGTGAAAGGAGAGGG + Intergenic
1022547422 7:31201925-31201947 ATGTAGCATCTGAAAGGAAAGGG + Intergenic
1023783331 7:43679774-43679796 AAGAAGCAGCAGAAAGGAAAAGG + Intronic
1023828856 7:44027983-44028005 AAGCAGCAGGTGACAGGAGCAGG - Intergenic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1024563336 7:50662422-50662444 CATTTGCTGCTGAAAGGAGATGG - Intronic
1024632312 7:51260031-51260053 AAGGAGCAGAGGAAAGGAAAAGG - Intronic
1025139248 7:56448830-56448852 TAGTAGCTGCTTAAAGGAAAAGG + Intergenic
1027308227 7:76924921-76924943 AACTAGCAGAGGAAAGGGGAAGG - Intergenic
1027822147 7:83060474-83060496 GAGCAGCAGCTGGAAGCAGAGGG - Intronic
1028099592 7:86803616-86803638 AAGTGGCAGCAAAAAGTAGAAGG - Intronic
1028935548 7:96459798-96459820 ATGTAGCAGCTAAGAGTAGAGGG + Intergenic
1029739156 7:102482240-102482262 AAGCAGCAGGTGACAGGAGCAGG - Intergenic
1029757157 7:102581419-102581441 AAGCAGCAGGTGACAGGAGCAGG - Exonic
1029775097 7:102680480-102680502 AAGCAGCAGGTGACAGGAGCAGG - Intergenic
1030674471 7:112370239-112370261 AAAGAGCAGCTGCAAGGATAAGG - Intergenic
1031103531 7:117511592-117511614 AAGAAGCAGCTGAAATGTGTAGG + Intronic
1032654914 7:133917187-133917209 AACTAGTACCTGAAAGGTGACGG - Intronic
1032774256 7:135094184-135094206 ATGTTGCAGCTAAAACGAGAAGG - Intronic
1034215018 7:149398578-149398600 AAGCAGCAGCTGGAGGGAGGTGG - Intergenic
1035329457 7:158086664-158086686 CAGTATGAGCTGAAACGAGAAGG + Intronic
1035617028 8:1009706-1009728 ACGCAGCAGGTGAAAGGAAAAGG - Intergenic
1036146353 8:6258352-6258374 AAGTCTCAGGTGACAGGAGAAGG + Intergenic
1036690298 8:10940890-10940912 AAGGAGCAGCTGAAGGGAAGGGG - Intronic
1038186776 8:25282388-25282410 ATACAGCAGGTGAAAGGAGATGG - Intronic
1038228562 8:25679663-25679685 AAACAGCAGCTGAAATGATAAGG - Intergenic
1038988871 8:32844229-32844251 AGGTCACAGCTGAGAGGAGAGGG - Intergenic
1041130671 8:54696512-54696534 AAGGAGCAGAGGAAAGGAAAAGG + Intergenic
1041146488 8:54881447-54881469 AGGAAGCAGATGAGAGGAGATGG - Intergenic
1041435150 8:57831239-57831261 AAGAAGCAACGGTAAGGAGACGG + Intergenic
1041741824 8:61164678-61164700 AAGTAGCTGCTTATATGAGAAGG - Intronic
1042396694 8:68299779-68299801 GTTTAGCAGCAGAAAGGAGATGG + Intergenic
1042849017 8:73197531-73197553 AAGAATCAGAGGAAAGGAGAGGG - Intergenic
1043456147 8:80414345-80414367 AACTGGCAGCTGAGAGGAGGAGG + Intergenic
1043543032 8:81283762-81283784 AAGTAGACTCAGAAAGGAGAAGG + Intronic
1044726077 8:95195369-95195391 AGGGAGCAGCTGAAATGAGAGGG - Intergenic
1046414390 8:113892596-113892618 AAGTAGAAGCTAAGAGGAGGTGG - Intergenic
1047053070 8:121134921-121134943 AATTTGCAGCTGGGAGGAGAAGG + Intergenic
1048531580 8:135254850-135254872 CAGAAGCAGCAGAGAGGAGAAGG + Intergenic
1048786450 8:138055669-138055691 TTGTAGAAGCTGAAAGGAGGAGG - Intergenic
1049123111 8:140757711-140757733 TAGTAGCAGGTGAACAGAGATGG - Intronic
1050063869 9:1738239-1738261 AAGTAGAAGCTGAAAGTGCAAGG - Intergenic
1050942169 9:11473144-11473166 AAGAAGCAGAAGAAAGAAGAAGG + Intergenic
1052353454 9:27480749-27480771 AAGTAGTAGAAGAAAGGAAAGGG + Intronic
1052848990 9:33364486-33364508 AAGTAGCCACTGAAAGGCCAGGG - Intronic
1053140396 9:35679229-35679251 AAGTAGCGGCTGAAGTCAGAGGG - Exonic
1053337619 9:37289933-37289955 AAGCAACAACTTAAAGGAGATGG - Intronic
1055356997 9:75447947-75447969 CAGTAGCAGCAGAGAAGAGAAGG - Intergenic
1055712510 9:79079003-79079025 CAGTAGCAGCTGAAAAGACAAGG + Intergenic
1056122347 9:83501915-83501937 GAGTTGCAGCAGAAAGGAGGAGG - Intronic
1056711379 9:88994514-88994536 AAGCAGCAGCAGAATGGAGAAGG + Exonic
1058561441 9:106233168-106233190 AAGAAGGAGGAGAAAGGAGAAGG - Intergenic
1058978622 9:110148451-110148473 AAGGAGGAGATGAAAGAAGAAGG + Intronic
1059236951 9:112769203-112769225 AACTAGCATGTGAAGGGAGAAGG + Intronic
1059250007 9:112879969-112879991 AGCTAGCAGCTGCAGGGAGATGG - Intronic
1060534965 9:124378402-124378424 AAGTAGCAGCTGAATGCTGCTGG - Intronic
1061537259 9:131257886-131257908 CAGAAGCAGCTGGAAGGAGCAGG + Intergenic
1185913792 X:4011645-4011667 AAGGAGGAGCAGGAAGGAGAAGG - Intergenic
1187012290 X:15292453-15292475 AAGATGCCACTGAAAGGAGAAGG - Intronic
1187514770 X:19959011-19959033 CATTATCAGCTGATAGGAGAGGG - Intronic
1187773713 X:22731002-22731024 AAGAAGCAGCAGAAAGGACCTGG - Intergenic
1188631562 X:32368708-32368730 AAGAAACAGCTGAAAAGATATGG + Intronic
1188657244 X:32713525-32713547 ATATAGTAGCTGAAAGGAAAGGG - Intronic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189699379 X:43701275-43701297 AAGGAGCCTCTGAGAGGAGATGG - Intronic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1190259875 X:48791024-48791046 GAGGAGCAGGTGAAAGGAGGTGG + Intronic
1190579866 X:51881791-51881813 AAATAGCAGCTGGAAGTAAATGG - Intronic
1191753410 X:64568142-64568164 ACTTAGCAGCTGAAATGAAATGG - Intergenic
1192054530 X:67759603-67759625 AATATGCAGATGAAAGGAGAAGG - Intergenic
1192446226 X:71213563-71213585 AGGTAGGAGCTGGAAGGGGAAGG - Intergenic
1194448556 X:94015185-94015207 AAGAAGCTGCAGAAAGTAGAAGG - Intergenic
1195152410 X:102085394-102085416 ATGTAGCATCAGAAAGTAGAAGG - Intergenic
1195238037 X:102921165-102921187 AAATAGAAGGTGAAAGAAGATGG + Intergenic
1195387321 X:104325388-104325410 AAGTCTCAGCTGCAAGGAAAAGG - Intergenic
1197166352 X:123381889-123381911 AAGTAGAAGAGGAAAAGAGAAGG - Intronic
1197329141 X:125132411-125132433 AAGTAGAAGATGAAAAGATAAGG - Intergenic
1197806682 X:130404448-130404470 TAGTAGCAGCTGGTAGGAGAGGG + Intronic
1199394218 X:147315667-147315689 AAACAGCAGCTGAAACTAGAAGG + Intergenic
1199497109 X:148464804-148464826 AAGGAGCAGAGGAAAGGAAAAGG + Intergenic
1199736489 X:150691173-150691195 AAGGAGCAAGTGAAAGGTGAGGG - Intergenic
1200254587 X:154573288-154573310 AAGCAGGAGATGAAAGGAAAGGG + Intergenic
1200263182 X:154631120-154631142 AAGCAGGAGATGAAAGGAAAGGG - Intergenic
1200988298 Y:9326134-9326156 AATTGGCAGCTGCAAGGATATGG - Intergenic
1202109560 Y:21406050-21406072 AATTGGCAGCTGCAAGGATATGG - Intergenic
1202119721 Y:21510059-21510081 AATTGGCAGCTGCAAGGATATGG + Intergenic
1202122174 Y:21533600-21533622 AATTGGCAGCTGCAAGGATATGG + Intronic
1202156833 Y:21895783-21895805 AATTGGCAGCTGCAAGGATATGG - Intronic
1202159279 Y:21919324-21919346 AATTGGCAGCTGCAAGGATATGG - Intergenic
1202185728 Y:22184239-22184261 AATTGGCAGCTGCAAGGATATGG - Intergenic
1202205632 Y:22402157-22402179 AATTGGCAGCTGCAAGGATATGG + Intronic