ID: 1086286898

View in Genome Browser
Species Human (GRCh38)
Location 11:85261559-85261581
Sequence ATTGGATCTTGCGGGAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 2, 2: 5, 3: 7, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086286892_1086286898 -1 Left 1086286892 11:85261537-85261559 CCTGGATTGTGGGAATTAGGATA 0: 1
1: 1
2: 5
3: 10
4: 112
Right 1086286898 11:85261559-85261581 ATTGGATCTTGCGGGAGGAAGGG 0: 1
1: 2
2: 5
3: 7
4: 122
1086286885_1086286898 15 Left 1086286885 11:85261521-85261543 CCCCGTGGGCCATTGTCCTGGAT 0: 1
1: 0
2: 0
3: 17
4: 98
Right 1086286898 11:85261559-85261581 ATTGGATCTTGCGGGAGGAAGGG 0: 1
1: 2
2: 5
3: 7
4: 122
1086286886_1086286898 14 Left 1086286886 11:85261522-85261544 CCCGTGGGCCATTGTCCTGGATT 0: 1
1: 0
2: 4
3: 13
4: 107
Right 1086286898 11:85261559-85261581 ATTGGATCTTGCGGGAGGAAGGG 0: 1
1: 2
2: 5
3: 7
4: 122
1086286887_1086286898 13 Left 1086286887 11:85261523-85261545 CCGTGGGCCATTGTCCTGGATTG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1086286898 11:85261559-85261581 ATTGGATCTTGCGGGAGGAAGGG 0: 1
1: 2
2: 5
3: 7
4: 122
1086286890_1086286898 6 Left 1086286890 11:85261530-85261552 CCATTGTCCTGGATTGTGGGAAT 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1086286898 11:85261559-85261581 ATTGGATCTTGCGGGAGGAAGGG 0: 1
1: 2
2: 5
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086286898 Original CRISPR ATTGGATCTTGCGGGAGGAA GGG Intronic
906143899 1:43548969-43548991 AGTGGAACTGGCTGGAGGAAGGG - Intronic
907145086 1:52224192-52224214 ATTGGAGCTTTCCTGAGGAAGGG + Intronic
907788945 1:57642527-57642549 ATTGGGGCTTGAGGGAGGGAGGG - Intronic
909264701 1:73541859-73541881 ATTGGATGTCGCTGCAGGAAGGG - Intergenic
911176544 1:94823195-94823217 TTTGGATTTAGAGGGAGGAAAGG - Intronic
912322416 1:108726923-108726945 ACTGGATCTTGAAGGATGAATGG + Intronic
912336282 1:108866064-108866086 TTTGGATGTTGCTGGATGAAGGG + Intronic
915151616 1:153837070-153837092 ATTGGATTTTGAGGGAGGCATGG - Intronic
915318164 1:155041369-155041391 ATTGGAGGTGGAGGGAGGAAAGG - Intronic
916044235 1:160986982-160987004 TTTGGATCCTGCGGGAGAAAAGG + Intergenic
916213208 1:162374829-162374851 GTTGGATCTTGGGGCAGGAGAGG + Intronic
917958330 1:180123123-180123145 ATTGGACCTTGTGTGAGGACGGG - Intergenic
920249706 1:204615407-204615429 TGTGGATCTTCTGGGAGGAAAGG + Intergenic
1066394800 10:35009084-35009106 ATTGTATGTTGAGGGAGGAGGGG + Exonic
1069543275 10:69311615-69311637 ATTGTATCCTGGAGGAGGAAGGG - Intronic
1071145169 10:82561196-82561218 AATGCCTCTTGGGGGAGGAAGGG + Intronic
1077887533 11:6396597-6396619 ATTGGGTCTTGGGAGAGGACTGG - Intronic
1081970539 11:47195256-47195278 TTTGGATGTTGCATGAGGAATGG + Intergenic
1086286898 11:85261559-85261581 ATTGGATCTTGCGGGAGGAAGGG + Intronic
1086895739 11:92309894-92309916 ATTGGCTCTTGAGGGAAGATTGG + Intergenic
1088100210 11:106146412-106146434 ATTGGATCTTGCTGGAAGAAGGG - Intergenic
1091399520 12:173705-173727 AGGGGAGCTTGCGGGTGGAACGG + Intronic
1092350097 12:7749225-7749247 CTTGGCTCTTGAGGGAGGATGGG + Exonic
1092656389 12:10689319-10689341 ATTGGATCTTGGGGTAGCAGAGG - Intergenic
1100512512 12:95290622-95290644 ATTGGAGATGGAGGGAGGAATGG + Intronic
1102115455 12:110399490-110399512 ATTAGTGTTTGCGGGAGGAAGGG + Intronic
1102321732 12:111941875-111941897 ATAGCATCTTGGGGGTGGAAGGG + Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1104518632 12:129452185-129452207 ATTGGATTTTGCCTGAGAAAAGG + Intronic
1107246034 13:38295211-38295233 ATTGGATCATGTAGGAGAAATGG + Intergenic
1111140076 13:84105296-84105318 ATTGGATATTGCTGAAAGAAGGG + Intergenic
1111848162 13:93538020-93538042 ATGGTATCTTGCAGGATGAAAGG + Intronic
1115149106 14:30262999-30263021 ATTGGAACTTGCTGGTAGAATGG + Intergenic
1115979820 14:39038179-39038201 ATTGGAAATTGCATGAGGAAGGG - Intronic
1118765734 14:68908236-68908258 AAAGGATCTTGAGGGAGGAAAGG - Intronic
1120227795 14:81810301-81810323 ATTGGATCATGAGGTGGGAAGGG - Intergenic
1123988960 15:25669060-25669082 CTAGGATCTTGGTGGAGGAAAGG - Intergenic
1124459160 15:29873046-29873068 AATGGGTCTTGCAGGATGAATGG + Intronic
1125168309 15:36737213-36737235 ATTGGAACCTGCAGGAGCAAAGG - Intronic
1126628840 15:50713004-50713026 ATTGGATCTACAGGGAGGTAGGG - Intronic
1126856737 15:52846523-52846545 ATTGGGTCTTGCTGGTTGAAAGG + Intergenic
1128224964 15:65995085-65995107 CTGGGATCTTGAAGGAGGAACGG + Intronic
1130206670 15:81881875-81881897 TTTGGATCCTGAGGAAGGAAGGG + Intergenic
1133030495 16:3008581-3008603 GTTGGATCTTGGGAAAGGAAGGG - Intergenic
1134870742 16:17650310-17650332 ATGGGCTCCTGCGGGAAGAAAGG - Intergenic
1142364546 16:89643164-89643186 ATTGGAGCTTCCTGGAGAAAGGG + Intergenic
1143046213 17:4081969-4081991 ATTGACTCTTGAAGGAGGAAGGG - Intronic
1147169342 17:38609039-38609061 ATTGCATCTTGGGGAAGGAGAGG - Intergenic
1148238825 17:45986569-45986591 CTTGGATCTTGCAGGAGGCTGGG + Intronic
1152273450 17:79339508-79339530 ATTGGAGCTGGTGGGAGGGAAGG + Intronic
1152942413 17:83179741-83179763 AGTAGCTCTTGCGGGAGAAAGGG - Intergenic
1153485131 18:5590322-5590344 ATTGGATTTTAAAGGAGGAAAGG - Intronic
1157477299 18:48031515-48031537 ATTGGATTTTTGAGGAGGAAGGG + Intronic
1161107239 19:2450343-2450365 ATGGGGTCTTGGGGCAGGAAAGG + Intronic
1161742920 19:6035218-6035240 TCTGGGTCTTGCAGGAGGAAGGG + Intronic
1163068835 19:14820806-14820828 TTTGCATCTTGCACGAGGAACGG + Intronic
1165661250 19:37582267-37582289 ATTGGATTTGGCAGGATGAAGGG - Intronic
1165828601 19:38719515-38719537 AGTGGATAGTGAGGGAGGAAGGG + Intronic
925170308 2:1745963-1745985 ATAGGATCCTGCAGGAGAAATGG - Intergenic
927494924 2:23545880-23545902 CTTGGATGAGGCGGGAGGAAGGG - Intronic
933435913 2:82249712-82249734 ATTGGATCTTGCTGGAGAAAGGG + Intergenic
938833024 2:135072215-135072237 ATTGGATCTTGTTGGAGGAAGGG + Intronic
939500832 2:142981683-142981705 ACTGTATTTTGAGGGAGGAAGGG - Intronic
940424510 2:153515092-153515114 TTTGGATGTTGGGGGAGGGAGGG + Intergenic
941231603 2:162917331-162917353 ATTGGATCTTGCTGGAGGAAGGG - Intergenic
946561778 2:220922002-220922024 ATGGGATCTTGGTGGATGAACGG + Intergenic
948734354 2:239990590-239990612 AGTGGATCTTGGGGCAGGAACGG + Intronic
1169931363 20:10836509-10836531 AATGGATCTGGCAGGGGGAAGGG + Intergenic
1170791773 20:19514670-19514692 ATTGGATTTTATGAGAGGAAGGG + Intronic
1171013449 20:21521223-21521245 AGTGGCTCTTGGGGGTGGAAAGG - Intergenic
1173936346 20:46869324-46869346 AGTCGATCTTGTGGGAGAAATGG - Intergenic
1175480707 20:59308772-59308794 ATTGGATATGGCAGGAGGACTGG - Intronic
1177882164 21:26707228-26707250 AATGGGTCTTGGGGGAGGGAGGG - Intergenic
1180196727 21:46201113-46201135 CCTGGATCATGTGGGAGGAAGGG + Intronic
1181781405 22:25196174-25196196 ATTGGCTCCTGCAGGGGGAAGGG + Exonic
1182253193 22:29018296-29018318 ATTGGATGTGGAGAGAGGAAGGG + Intronic
1183243252 22:36674017-36674039 ACTTGATCATGCGGGAGGGACGG - Intronic
1183816735 22:40308118-40308140 AGGGTATCTTGGGGGAGGAAAGG - Intronic
949242604 3:1890071-1890093 CTTGGGTCCTGAGGGAGGAAAGG - Intergenic
949571017 3:5293287-5293309 ATTGGAGCCTGAGGGAGGATGGG + Intergenic
950321637 3:12060285-12060307 ATTGGTTCTGGCAGGAAGAAAGG + Intronic
955973959 3:64463090-64463112 ATTGGATCTTTAGGAAGGAGGGG + Intergenic
963641418 3:147865336-147865358 ATTGGATCTTCTTGGAGGAAAGG - Intergenic
969442069 4:7223148-7223170 TTTAGATCTTGCAAGAGGAAAGG + Intronic
969705620 4:8789614-8789636 ATGGGATCGTGAGGAAGGAAGGG + Intergenic
971365458 4:25973435-25973457 ATTGCATCTTATGGGTGGAAGGG - Intergenic
971478798 4:27096109-27096131 AGGGGAGCTTGCGGAAGGAAAGG - Intergenic
973612788 4:52652967-52652989 ATTGGAACTTGAGGAAGAAAAGG + Intronic
973651359 4:53000109-53000131 ATGGGATGTTGCGGGAGGCAGGG + Intronic
975841032 4:78474410-78474432 ATTGGAACTTGGGGGAAAAAAGG + Intronic
977988665 4:103415748-103415770 ATGAGATCTTGCTGGTGGAAGGG + Intergenic
980765177 4:137293411-137293433 GTTGGCTTTTGGGGGAGGAAGGG - Intergenic
981523264 4:145686991-145687013 ATTGGATCTTGTGGGGGGGGCGG + Intronic
983870982 4:172825246-172825268 ATGGAGTCTTGCGGGAGGGAGGG + Intronic
984349356 4:178570638-178570660 ATTGGATCTTGCTGGAGGAAGGG - Intergenic
988106394 5:26754640-26754662 ATTAGATCTTGCTGGATGCATGG + Intergenic
990063783 5:51686428-51686450 ATTGGATTTTGAGGAAAGAAAGG - Intergenic
991478540 5:67050450-67050472 ATAGGACCTTGAGGGAGGACTGG - Intronic
992770319 5:80041383-80041405 ATTTGATGGGGCGGGAGGAAGGG + Intronic
998871163 5:146553593-146553615 ATTGCCTCTGGCAGGAGGAAGGG - Intergenic
998955758 5:147436503-147436525 ATTGGATGTTGTAGAAGGAAAGG + Intronic
999785029 5:154883140-154883162 CTTGAATCCTGAGGGAGGAAAGG - Intergenic
1004250896 6:14022439-14022461 ATTGGAACGAGCAGGAGGAAAGG - Intergenic
1006195602 6:32239935-32239957 ATGGGGTATTGCTGGAGGAATGG + Intergenic
1006241984 6:32690244-32690266 CTTAGTTCTTGCAGGAGGAAAGG + Intergenic
1006250968 6:32784195-32784217 CTTAGTTCTTGCAGGAGGAAAGG + Intergenic
1010101367 6:72112150-72112172 ATTGGATGCAGGGGGAGGAAAGG - Intronic
1014438047 6:121442001-121442023 AATGGATTTTTTGGGAGGAAAGG - Intronic
1019038189 6:169079935-169079957 ATTGGATCCTGGGGCAGAAAAGG + Intergenic
1022418203 7:30196218-30196240 ATTGCATCTTGCTGGAGGAAGGG + Intergenic
1025009786 7:55386861-55386883 ATTGGACCTTGCTGGAGAAAGGG + Intronic
1030634305 7:111931228-111931250 AATGGATCCTGCCAGAGGAAGGG + Intronic
1030717666 7:112829216-112829238 ATTAGATGTTGCAGAAGGAAAGG - Intronic
1032025518 7:128438898-128438920 ATTGGATCATGGGGAAGGGATGG - Intergenic
1032891532 7:136199983-136200005 CTTGGATCTTGGGGGATGTATGG + Intergenic
1035194306 7:157203204-157203226 ATTGAATCTTAAGTGAGGAAAGG + Intronic
1038238511 8:25785309-25785331 TTTGGATCCTGGAGGAGGAAGGG + Intergenic
1038388818 8:27175676-27175698 TCTGGATCCTGCGGGAGGCATGG - Intergenic
1042239955 8:66653895-66653917 ATTTGTTCTTGGAGGAGGAAGGG - Intronic
1044150562 8:88771248-88771270 ATTGGATCTTGAGGTGGGAGGGG + Intergenic
1044428791 8:92084669-92084691 ATTCTATCTTTGGGGAGGAAGGG + Intronic
1048253078 8:132883322-132883344 ATTCGATCTTGCAGCAGGTATGG + Intronic
1049201497 8:141342738-141342760 ACTGGACCTTGCAGGAGGGATGG + Intergenic
1049822771 8:144646144-144646166 CTTGGAGCCTGCTGGAGGAAGGG + Intergenic
1051637315 9:19192549-19192571 ATTGGATATTACTGGAGCAAAGG - Intergenic
1051840883 9:21396545-21396567 AGTGGCTCTTGTGGGTGGAAAGG - Intergenic
1053128883 9:35604575-35604597 GTGGGATCTTGCGGAAGGACGGG + Intergenic
1056476049 9:86952155-86952177 ATTGGATCATGGGGAAGGGATGG - Intergenic
1056518708 9:87380312-87380334 ATTGAATTTTGGCGGAGGAAAGG - Intergenic
1057200996 9:93139970-93139992 CTGGGATCTTGGGAGAGGAAGGG - Intergenic
1058164078 9:101601109-101601131 ATTTGATCCTGAGGGAGAAAAGG + Intronic
1058620637 9:106879262-106879284 ATTGGAGCTGGCAGAAGGAAGGG + Intronic
1186404469 X:9289936-9289958 AGTGGATCTTGTGAGAGAAAAGG + Intergenic
1186438521 X:9564801-9564823 GGTGGGTGTTGCGGGAGGAAGGG + Intronic
1188059152 X:25579055-25579077 ATTGCATCTTGAAGGAGGTAGGG + Intergenic
1195068110 X:101255485-101255507 ATGGGATCTTGCAACAGGAAGGG - Intronic
1198242437 X:134798712-134798734 ATTGAATCTTGCTGGAGGAAGGG + Intronic