ID: 1086297873

View in Genome Browser
Species Human (GRCh38)
Location 11:85391377-85391399
Sequence TGGAATAGTACCAATGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1347
Summary {0: 1, 1: 1, 2: 24, 3: 304, 4: 1017}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086297873_1086297878 -5 Left 1086297873 11:85391377-85391399 CCAATCCCATTGGTACTATTCCA 0: 1
1: 1
2: 24
3: 304
4: 1017
Right 1086297878 11:85391395-85391417 TTCCAAAAGATAAAGAAGGAGGG 0: 1
1: 18
2: 227
3: 808
4: 2213
1086297873_1086297876 -9 Left 1086297873 11:85391377-85391399 CCAATCCCATTGGTACTATTCCA 0: 1
1: 1
2: 24
3: 304
4: 1017
Right 1086297876 11:85391391-85391413 ACTATTCCAAAAGATAAAGAAGG 0: 34
1: 82
2: 153
3: 472
4: 1711
1086297873_1086297877 -6 Left 1086297873 11:85391377-85391399 CCAATCCCATTGGTACTATTCCA 0: 1
1: 1
2: 24
3: 304
4: 1017
Right 1086297877 11:85391394-85391416 ATTCCAAAAGATAAAGAAGGAGG 0: 1
1: 13
2: 208
3: 639
4: 1797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086297873 Original CRISPR TGGAATAGTACCAATGGGAT TGG (reversed) Intronic
900699637 1:4037549-4037571 TGGAATAGTATCAATAGGATTGG - Intergenic
900746685 1:4365666-4365688 TGGAGTAGTAGCAAAGGGAGGGG - Intergenic
902095420 1:13940185-13940207 TGGAATAGTTTCAGTAGGATTGG + Intergenic
903094565 1:20957987-20958009 TGGAATAGTTTCAGTAGGATTGG - Intronic
904569651 1:31453358-31453380 TGGAATAGTGTCAACAGGATTGG + Intergenic
904849822 1:33449294-33449316 TGGAAGAGTGTCAATAGGATTGG - Intergenic
904965666 1:34370611-34370633 AATAATAGTACCAATTGGATAGG - Intergenic
905497694 1:38406789-38406811 TGGAATAGTGTCAGTAGGATTGG - Intergenic
905648936 1:39643759-39643781 GAGAACAGTACCAAGGGGATGGG - Intergenic
906053680 1:42896829-42896851 TGGAATAGTGTCAAAAGGATTGG + Intergenic
906131152 1:43457885-43457907 TGGAATAGTGTCAAAAGGATTGG - Intergenic
906563715 1:46780491-46780513 TGGAATAGTGTCAAAAGGATTGG + Intronic
906585504 1:46973481-46973503 TGGAATAGCTTCAATAGGATTGG + Intergenic
906808144 1:48800051-48800073 TGGAATAGTTTCAGTAGGATTGG + Intronic
906869283 1:49459156-49459178 TGGAATAGTGTCAGTAGGATTGG + Intronic
906910787 1:49947132-49947154 TGGAATAGTGTCAATAGGATTGG - Intronic
907004368 1:50895463-50895485 TGTAATAGTTCGAGTGGGATTGG - Intronic
907561395 1:55392444-55392466 TGGAATAGTTTCAATAAGATTGG + Intergenic
907693700 1:56698593-56698615 TGGAATAGTATAAATGGCACAGG - Intronic
908275601 1:62467693-62467715 TGGAATAATGTCAATAGGATTGG - Intronic
908341849 1:63189265-63189287 TGGCATAGTATGAAGGGGATAGG - Intergenic
908660400 1:66428783-66428805 TGGAATAGTGTCAATAAGATTGG + Intergenic
908667903 1:66512480-66512502 TGGAATAGTGTCAATAGGATTGG - Intergenic
908803345 1:67903680-67903702 TGGAATAGTGTCAATAGGATTGG + Intergenic
908820026 1:68076606-68076628 CGGAATAGCGTCAATGGGATTGG + Intergenic
908862215 1:68502097-68502119 TGGAATACTGTCAATGGGATTGG - Intergenic
908890507 1:68842042-68842064 TGGAATAGTGTCAATAGGATTGG + Intergenic
909098600 1:71321831-71321853 TGGAATAGTGTCAAAAGGATTGG - Intergenic
909267534 1:73579776-73579798 TGGAATAGTTTCAGTAGGATTGG - Intergenic
909405587 1:75285057-75285079 TGGAATAGTGTCTATAGGATTGG + Intronic
909431755 1:75596387-75596409 TGGAATAGTTTCAGTGGGAATGG - Intronic
909703819 1:78556872-78556894 TGGAATAGTTTCAATAGGATTGG - Intergenic
909790878 1:79676684-79676706 TGGAATAGTGTCAGTAGGATTGG + Intergenic
909828072 1:80151002-80151024 TGGAATAGTGCCAGTAGGGTTGG + Intergenic
909860396 1:80597604-80597626 TGGAATAGTGTCAATAGGATAGG - Intergenic
909981093 1:82102118-82102140 TGAAATACTATCAATAGGATTGG + Intergenic
910141995 1:84036348-84036370 TGTAATAGTGTCAATAGGATTGG + Intergenic
910323750 1:85979774-85979796 TGGAATAGTGTCAATAGGATTGG - Intronic
910358398 1:86389975-86389997 TGGAGTAGTGTCAATAGGATTGG - Intronic
910738688 1:90491574-90491596 TGGAATAGTGTCAAAAGGATTGG + Intergenic
910820660 1:91342029-91342051 TGGAATAGTTTCAGTAGGATTGG - Intronic
911311311 1:96294984-96295006 TGGAATAGTTTCAATAGGAATGG + Intergenic
911318430 1:96382627-96382649 CGGAATAGTGTCAATAGGATTGG - Intergenic
911322431 1:96431210-96431232 TGGAATAGTGTCAATAGGATTGG + Intergenic
911689429 1:100815595-100815617 TGGAATAGTGTCAATAGGATTGG - Intergenic
911805915 1:102207890-102207912 TGGAATGGTGTCAATAGGATAGG + Intergenic
911999340 1:104811025-104811047 TGGAATAGTTTCAGTAGGATTGG + Intergenic
912180814 1:107216999-107217021 TGGAATAGTGCCAATAGGATTGG + Intronic
913035497 1:114960907-114960929 TGGAATAGTTTCAGTAGGATTGG + Intronic
913099813 1:115552581-115552603 TGTGAAAGTACCAATGGGGTTGG - Intergenic
913143452 1:115965248-115965270 TGGAATAGTGTCAAAAGGATTGG - Intergenic
913151648 1:116050182-116050204 TGGAATAGTGTCAAAAGGATTGG - Intronic
913339450 1:117743921-117743943 TGGAATAGTGTCAATAGGATTGG + Intergenic
913417902 1:118632312-118632334 TGGAATAGTGTCAACAGGATTGG + Intergenic
913429288 1:118772377-118772399 TGGAATAGTGTCAATAGGATTGG - Intergenic
913493798 1:119408306-119408328 TGGAATAGTGTCAATAGGATTGG - Intergenic
913587781 1:120293098-120293120 TGAAATAGTGTCAATAGGATTGG + Intergenic
913620404 1:120605271-120605293 TGAAATAGTGTCAATAGGATTGG - Intergenic
914346365 1:146802585-146802607 TGGAATAGTGTCAATAGGATGGG - Intergenic
914455147 1:147829366-147829388 TGGAATAGTGTCAAAAGGATTGG + Intergenic
914459525 1:147870277-147870299 AGCAATAGTGACAATGGGATTGG + Intergenic
914569799 1:148904967-148904989 TGAAATAGTGTCAATAGGATTGG + Intronic
914603030 1:149225291-149225313 TGAAATAGTGTCAATAGGATTGG - Intergenic
914968255 1:152281058-152281080 TGGAATAGTGTCAAAAGGATTGG - Intergenic
914997315 1:152556093-152556115 TGTAATAGTTTCAGTGGGATTGG - Intronic
915829019 1:159107991-159108013 TGGAATAGTGTCAATAGAATTGG - Intronic
915837000 1:159185170-159185192 TGAAATAGTCCCAAAGGTATAGG + Intronic
916331425 1:163621710-163621732 TGGAATAGTGTCAATAGAATTGG + Intergenic
916392796 1:164349696-164349718 TGGAATAGTTTCAGTAGGATTGG - Intergenic
916580919 1:166107584-166107606 TGGAATAGTATCAAAAGGACTGG - Intronic
916902957 1:169250026-169250048 TGGAATAGTTTCAGTAGGATTGG + Intronic
916911460 1:169352009-169352031 TGGAATAGTTTGAATAGGATTGG - Intronic
917011569 1:170480238-170480260 TGAAATAGTTTCAGTGGGATTGG + Intergenic
917057619 1:171000792-171000814 TGGAATAGTGTCAAAAGGATTGG + Intronic
917163743 1:172087875-172087897 AGGAATAGTAACAATAGAATAGG - Intronic
917317284 1:173739046-173739068 TGGAATAGTGTCCATAGGATTGG + Intronic
917319290 1:173762310-173762332 TGGAATAGTGTCAAAAGGATTGG - Intronic
917438764 1:175046976-175046998 TGGAATAGTTTGAATAGGATTGG + Intergenic
917643145 1:177003076-177003098 TGGAATAGTTTCAGTGGAATTGG - Intronic
917746644 1:178015273-178015295 TGGAATGGTTTCAGTGGGATTGG + Intergenic
917898180 1:179513618-179513640 TGGAATAGTGTCAAAAGGATTGG + Intronic
917907698 1:179603930-179603952 TGGAATAGTGTCAAAAGGATTGG + Intronic
917913317 1:179674593-179674615 TGGAATACTGTCAATAGGATTGG + Intronic
918172185 1:182008819-182008841 TGGAATAGTGTCAATAGGATTGG - Intergenic
918219394 1:182422531-182422553 TTGAATAGTAGCAATGAGAGTGG + Intergenic
918529922 1:185507363-185507385 TGGAATAGTGTCAATAGAATTGG + Intergenic
918589369 1:186223467-186223489 TGGAATAGTGTCAATAGGATTGG - Intergenic
918718391 1:187820995-187821017 TGGAATAGTTTCAATAGGATTGG + Intergenic
919073139 1:192781264-192781286 TGGAATAGTGTCAAAAGGATTGG + Intergenic
919160438 1:193823345-193823367 TGAAATAGTGTCAATAGGATTGG - Intergenic
919278151 1:195447852-195447874 TGGAATAGTGTCAATAGGATTGG - Intergenic
919283086 1:195517712-195517734 GAGAACAGTACCAAGGGGATGGG - Intergenic
919318436 1:196003131-196003153 TGGAACAGAACTAATAGGATAGG - Intergenic
919355790 1:196519884-196519906 TGGAATAGTTTCAATAGGAATGG - Intronic
919407751 1:197205801-197205823 TGGAATAATGTCAATAGGATTGG + Intergenic
919533774 1:198760528-198760550 TGGAATAGTTTCAATAGGAATGG + Intergenic
920768894 1:208861212-208861234 TGGAATAGTTTCAGTAGGATTGG - Intergenic
920800205 1:209180199-209180221 TGGAATAGTGTCAATAGGATTGG - Intergenic
920891993 1:209996545-209996567 TGGAATAGTTTCAGTAGGATTGG - Intronic
921404214 1:214761458-214761480 TGGAATAGTTTCAGTGGGAATGG + Intergenic
921496693 1:215851627-215851649 TGGAATAGTGTCAATATGATTGG - Intronic
921690481 1:218143276-218143298 TGGAATAGTGTCAATAGGATTGG - Intergenic
922377325 1:224981339-224981361 TGGAATAGTGTCAAAAGGATTGG + Intronic
922658216 1:227404656-227404678 TGGAATAGTGTCAAAAGGATTGG - Intergenic
923459065 1:234192045-234192067 TGGAATAGTGTTAATAGGATTGG - Intronic
923648531 1:235848954-235848976 TGGAATAGTGTCAAAAGGATTGG - Intronic
923996608 1:239502522-239502544 TGGAATAGTATCAAAAGGATTGG - Intronic
924192977 1:241574819-241574841 TGGAATAGTTTCAGTAGGATTGG + Intronic
924321121 1:242851705-242851727 TGGAATAGTGTCAATAGGATTGG + Intergenic
924830012 1:247583753-247583775 TGGAATAGTGTCAATAGGATTGG - Intergenic
924879864 1:248148865-248148887 TGGAATAGTGTCAATAGGATTGG + Intergenic
924885117 1:248206863-248206885 TGGAATAGTGTCAATAGGATTGG + Intergenic
1063306221 10:4903389-4903411 CAGAATAGAACCAATGGGATTGG + Intergenic
1063442382 10:6083433-6083455 TGGCAGACTTCCAATGGGATTGG + Intergenic
1063453207 10:6164901-6164923 CAGAATAGAACGAATGGGATTGG + Intronic
1063624916 10:7679903-7679925 TAGGACAGTACCAAGGGGATGGG + Intergenic
1063630198 10:7726283-7726305 TGGAAATGTACCAATAGAATAGG + Intronic
1064556932 10:16556291-16556313 TGAAATAGCATCAATAGGATTGG + Intergenic
1064867932 10:19903228-19903250 TGGAATAGTGTCAATAGCATTGG + Intronic
1064907848 10:20367044-20367066 TGGAATAGTGTCCATAGGATTGG + Intergenic
1065079675 10:22115645-22115667 TGGCATAGTGTCAATAGGATTGG - Intergenic
1065462719 10:25985782-25985804 TGGAATAGTATCAATAGGATTGG - Intronic
1065465117 10:26011700-26011722 TGGAATAGTTTCAGTGGGATTGG - Intronic
1065499996 10:26370747-26370769 TGGAATAGTCTCAATAGGATTGG + Intergenic
1065894307 10:30148898-30148920 TGGAATAGTGTGAATAGGATTGG + Intergenic
1066097905 10:32090345-32090367 TGAAATAGTCTCAATAGGATTGG + Intergenic
1066651322 10:37658395-37658417 TGGAATAGTGTCAGTAGGATTGG - Intergenic
1066742886 10:38576464-38576486 TGGAATAGTACAGATGCGAACGG + Intergenic
1066767272 10:38814117-38814139 TGGAATATAACCAAATGGATAGG - Intergenic
1066769268 10:38830836-38830858 TGGAATAGAATCAAATGGATTGG + Intergenic
1067016825 10:42763222-42763244 TGGAATAGTTTGAATAGGATTGG - Intergenic
1067034823 10:42906116-42906138 TGGAATAGTGTCAATAGGATTGG - Intergenic
1067368197 10:45656273-45656295 TGGAATAGTTTCAGTAGGATTGG - Intronic
1067493850 10:46743559-46743581 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1067600808 10:47596846-47596868 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1068238244 10:54266869-54266891 TGGAATAGTTTCAGTAGGATTGG - Intronic
1068271211 10:54728022-54728044 TGGAATAGTTTCAGTAGGATTGG - Intronic
1068924656 10:62523251-62523273 TGGAATAGTGTCAATAGGATTGG + Intronic
1069052958 10:63813354-63813376 TGGAATAGTTTCAGTGGGAATGG + Intergenic
1069113208 10:64472033-64472055 TGGAATAGTGTCAATAGGAATGG - Intergenic
1069155129 10:65019838-65019860 TGGAATTGTTTCAATAGGATTGG - Intergenic
1069193167 10:65515652-65515674 TGGAATAGTTTGAATAGGATTGG + Intergenic
1069218163 10:65848908-65848930 TGGAATAGTGTCAATAGGATTGG - Intergenic
1069228253 10:65971749-65971771 TGGAATAGTTTCAGTAGGATTGG - Intronic
1069228829 10:65980420-65980442 TGGAATAATGTCAATCGGATTGG - Intronic
1069340876 10:67407006-67407028 TGGAATAGTTTCAATAGGAATGG - Intronic
1069648499 10:70023434-70023456 TGGAATAGTGTCAATAAGATTGG - Intergenic
1070433722 10:76367306-76367328 TGGAATAGTGTCAAAAGGATTGG + Intronic
1070465186 10:76714890-76714912 TGGAATAATGTCAATAGGATTGG - Intergenic
1071015555 10:80993256-80993278 TGGAATAGTGTCAATAGAATTGG + Intergenic
1071019275 10:81032706-81032728 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1071045712 10:81373592-81373614 TGGAATAGTGTCAATAGGATTGG + Intergenic
1071062838 10:81593409-81593431 TGGAATAGTGTCAATAGGACTGG - Intergenic
1071063078 10:81597143-81597165 TGGAATATTTTCAATGGGAATGG - Intergenic
1071652348 10:87404712-87404734 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1071812048 10:89193134-89193156 TGGAATAGTGTCAATAGGATTGG + Intergenic
1071843747 10:89500228-89500250 TGGAATAGTGTCAACAGGATTGG - Intronic
1071910927 10:90232406-90232428 TGGAATAGTGTCAATAGAATTGG - Intergenic
1072381485 10:94876419-94876441 TGGAATAGTGTCAATAGAATTGG + Intergenic
1072768984 10:98120850-98120872 TGGAATAGTGTCAATAGGAATGG + Intergenic
1072839606 10:98756765-98756787 TGGAATAGTTTCAGTGTGATTGG - Intronic
1072885611 10:99270577-99270599 TGGAATAGTGTCAGTAGGATTGG - Intergenic
1073242498 10:102067405-102067427 TGCAAAAGGAACAATGGGATCGG + Exonic
1073900192 10:108211969-108211991 TGGAATACTGTCAATAGGATTGG + Intergenic
1074016424 10:109539148-109539170 TGGAATAGTTTCAAAAGGATTGG + Intergenic
1074037062 10:109750545-109750567 TGGAATAGTTTCAGTTGGATTGG + Intergenic
1074984573 10:118646035-118646057 TGGAATAGTGTCAGTAGGATTGG + Intergenic
1075333279 10:121590603-121590625 TGAAATAGTAGCAGTGGGGTTGG - Intronic
1076376166 10:129987423-129987445 TGGAATAGTGTCAATAGGATAGG - Intergenic
1076665253 10:132085125-132085147 TGGAATAGTGTCAATAGGATTGG + Intergenic
1077748651 11:4938032-4938054 AGGAATAGTCCCAAAGTGATGGG + Intronic
1077833952 11:5907145-5907167 TGGAATAGTGTCAATAGGATTGG + Intronic
1077841407 11:5979271-5979293 TGGAATAGTTTCACTGGGATTGG + Intergenic
1078288933 11:9986864-9986886 TGGAATAGTGTCAAAAGGATTGG - Intronic
1078305143 11:10176779-10176801 TGGAATAGTTTCAGAGGGATTGG - Intronic
1078384553 11:10877255-10877277 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1078684338 11:13514102-13514124 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1078694450 11:13616859-13616881 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1078706922 11:13752920-13752942 TGAAATAGTGTCAATAGGATTGG - Intergenic
1078842172 11:15088248-15088270 TGGAATAGTTTCAATAGAATTGG + Intergenic
1079178392 11:18165623-18165645 TGGAATAGTTTCAGTAGGATTGG - Intronic
1079179774 11:18180867-18180889 TGGAATAGTGTCAATAGGATTGG - Intronic
1079430248 11:20382765-20382787 TGGAATAGGACTAGTGTGATGGG - Intronic
1079523725 11:21359552-21359574 TGGAATAGTTTCAGTGAGATTGG + Intronic
1079722903 11:23841824-23841846 TGGAATAGTTTGAATAGGATTGG + Intergenic
1079805756 11:24928780-24928802 TGGAATAGTGCAAATAAGATTGG + Intronic
1079856118 11:25607464-25607486 TGGAATAGTGTCAATAAGATTGG + Intergenic
1079951887 11:26816061-26816083 TGGAATAGTGTCAATAGGATTGG + Intergenic
1080402588 11:31950440-31950462 TGGAATAGTGTCAAAAGGATTGG - Intronic
1080585592 11:33679408-33679430 TGGAATAGTGTCAATAGGATTGG + Intergenic
1080799449 11:35596556-35596578 TGGAATAGTGTCAACAGGATTGG + Intergenic
1080863586 11:36172880-36172902 TGTAATAGTTTCAGTGGGATTGG + Intronic
1081001900 11:37684156-37684178 TGGAATAGTTTGAATAGGATAGG - Intergenic
1081326410 11:41750758-41750780 TGCAATAGTGTCAATAGGATTGG + Intergenic
1082724069 11:56714229-56714251 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1083005512 11:59341457-59341479 TGGAATAGTGTCAATAGGATTGG + Intergenic
1083046384 11:59739601-59739623 TGGAATAGTGTCAATAGGATTGG + Intronic
1084220819 11:67677041-67677063 TGGAATAGTGTCAAAAGGATTGG - Intronic
1085222384 11:74885654-74885676 TGGAATAGTTTCAATAGGAATGG - Intronic
1085748206 11:79133440-79133462 TGGAATAGTGTCAAAAGGATTGG - Intronic
1085917456 11:80906612-80906634 TGGAATAGTGTCAATAGGATTGG - Intergenic
1086264928 11:84986374-84986396 TGGAATAGTGTCAATAGGGTTGG - Intronic
1086297873 11:85391377-85391399 TGGAATAGTACCAATGGGATTGG - Intronic
1086536980 11:87858728-87858750 TGGACTGGTAACAATGGCATAGG + Intergenic
1086792366 11:91058501-91058523 TGGAATAGTTTCAATAGGAATGG - Intergenic
1086824462 11:91478631-91478653 TTGAATAGTATCAGTAGGATTGG - Intergenic
1086844704 11:91734024-91734046 TGGAATAGTGTCAGTAGGATTGG - Intergenic
1087652356 11:100882650-100882672 TGGAATAGTGTCAATAGGATTGG + Intronic
1087688658 11:101294367-101294389 TGGAATAGTGTCAATACGATTGG + Intergenic
1087690248 11:101312610-101312632 TGGGATAGTATCAGTAGGATTGG + Intergenic
1087865935 11:103226764-103226786 TTGAATAGTGTCAATAGGATTGG + Intronic
1087933581 11:104005672-104005694 GGGGATAATACCAATGGCATGGG - Intronic
1088077504 11:105869036-105869058 TGGACTAGTGCAAATGGAATTGG + Intronic
1088179795 11:107096206-107096228 TGGAATAGTGTCAATAGAATTGG - Intergenic
1088372193 11:109103443-109103465 TGGAATAGTGTCAATAAGATTGG + Intergenic
1088413244 11:109559660-109559682 TGGAATAGTGTCAACAGGATTGG + Intergenic
1088525697 11:110751379-110751401 TGGAATAGTTTCAATAGGACTGG + Intergenic
1088962952 11:114688639-114688661 TGGAATAGTTTCAGTAGGATTGG + Intronic
1089107671 11:116027227-116027249 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1089267486 11:117275825-117275847 TGGAATAGTTCCAGTAGGATTGG - Intronic
1090114932 11:123959120-123959142 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1090483492 11:127089129-127089151 TGGAATAGTGTCAATAGGATTGG - Intergenic
1090518479 11:127453330-127453352 TGAACTAGAAACAATGGGATGGG - Intergenic
1090986151 11:131767914-131767936 TAGGATAGGACCAATGGGATGGG + Intronic
1091925048 12:4339485-4339507 TGGAATAGTTTCAGTAGGATTGG - Intronic
1091957375 12:4658102-4658124 TGGATCAGTCCCTATGGGATGGG + Intronic
1092303560 12:7276292-7276314 TGGAATAGTGTCAATAGGATTGG + Intergenic
1092316352 12:7418966-7418988 TGGAATAGTGTCAATAGGATTGG - Intronic
1092399412 12:8161356-8161378 TGGAATAGTGTCAAAAGGATTGG + Intronic
1092440913 12:8502073-8502095 TAGAACAGGACAAATGGGATTGG - Intergenic
1092579591 12:9824059-9824081 TGGAATAGTTTCCATGGGAATGG - Intergenic
1092906990 12:13110003-13110025 TGGAATAGTCTCAGTAGGATTGG + Intronic
1093001748 12:14004643-14004665 TGGAATAGTGTCAATAAGATTGG + Intergenic
1093136060 12:15452432-15452454 TGGAATAGTGTCAACAGGATTGG - Intronic
1093278151 12:17154458-17154480 TGAAATAGTGTCAATAGGATTGG - Intergenic
1093290831 12:17319578-17319600 TGGAATAGTGTCAATAAGATTGG + Intergenic
1093389888 12:18605470-18605492 TGGAATAGTGTCAAAAGGATTGG - Intronic
1093488415 12:19678202-19678224 TGGAATAGTGTCAAAAGGATTGG + Intronic
1093720867 12:22440547-22440569 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1093948685 12:25139299-25139321 TGGAATAGTGTCAATAGGATTGG - Intronic
1093951874 12:25171559-25171581 TGGAATAGTGTCAATAGAATTGG - Intronic
1093991719 12:25596163-25596185 TGGAATAGTGTCAACAGGATTGG - Intronic
1093995257 12:25634273-25634295 TGGAATAGTGTCAATAGGATTGG - Intronic
1094263159 12:28524653-28524675 TAGAATAGTGTCAATAGGATTGG + Intronic
1094721725 12:33072236-33072258 TGGAATAGTGTCAATAGGATTGG + Intergenic
1095687707 12:45053992-45054014 TGGAATAGTGTCAATAGGATTGG - Intergenic
1095973540 12:47923108-47923130 AGGAATAGTTCCAATAGGTTTGG - Intronic
1096032161 12:48428755-48428777 TGGAATGGTGTCAATAGGATTGG - Intergenic
1096424168 12:51487050-51487072 TGGAAAGGTTCCAAAGGGATAGG + Intronic
1097385580 12:58946680-58946702 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1097412906 12:59277635-59277657 AGAAATAGTACCACTGTGATTGG - Intergenic
1097650256 12:62289137-62289159 TGGAACAGTTTCAGTGGGATTGG + Intronic
1097660036 12:62419999-62420021 TGGAATGGTGTCAATAGGATTGG - Intergenic
1097906699 12:64927230-64927252 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1097916786 12:65029416-65029438 GGGAATAGTTTCAGTGGGATAGG + Intergenic
1098201941 12:68065058-68065080 TGAAATAGTTTCAGTGGGATAGG + Intergenic
1098274637 12:68801001-68801023 TGGAATAGTAGCAATGATAGTGG - Intergenic
1098399568 12:70059512-70059534 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1098437047 12:70479006-70479028 TGGAATAGTTGCAGTAGGATTGG + Intergenic
1098499914 12:71179601-71179623 TGGAGTAGTTTCAGTGGGATTGG - Intronic
1098960461 12:76734822-76734844 TAGAATAGTATCAAAAGGATTGG + Intergenic
1099042243 12:77670381-77670403 TGGAATAGTGTCAATAGGATTGG - Intergenic
1099353785 12:81608347-81608369 TGGAATAGTTTCAGTAGGATTGG + Intronic
1099516746 12:83606151-83606173 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1099559232 12:84151489-84151511 TAGAATAGTTTCAATAGGATTGG + Intergenic
1099609541 12:84850283-84850305 TGGAATAGTGCCCATGAGATTGG - Intergenic
1099777137 12:87148182-87148204 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1100321465 12:93497153-93497175 GGGAATAGTATCAGTAGGATTGG - Intronic
1100630336 12:96382451-96382473 TGGAATAGTTTCAGTAGGATTGG - Intronic
1100696951 12:97104856-97104878 TGGAATAGTGTTAATAGGATTGG + Intergenic
1101290667 12:103364918-103364940 TGGAATACTGTCAATAGGATTGG - Intronic
1101544271 12:105696724-105696746 TGAAATAGTGTCAATAGGATTGG + Intergenic
1102109422 12:110353387-110353409 TGGACTAGTACCAAACAGATTGG + Intergenic
1103162929 12:118745261-118745283 TGGAATAGGACCTATGGAATAGG - Intergenic
1103519547 12:121528927-121528949 TGGAATAGTGTCAACAGGATTGG - Intronic
1104181027 12:126380949-126380971 TGGAATAGTGTCAATAGGGTTGG - Intergenic
1104600477 12:130150084-130150106 TGGATTAGTTCCAATTGGACAGG - Intergenic
1104741726 12:131181318-131181340 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1105314768 13:19247811-19247833 TGGAATAGTGTCAATAGGATTGG - Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105598592 13:21864025-21864047 TGGAATAGTTTCAATAGGATTGG + Intergenic
1105776236 13:23663563-23663585 TGGAATAGTTTCAGTGGGAATGG + Intronic
1105873462 13:24531304-24531326 TGGAATAGTATCAGTAGAATTGG - Intergenic
1105990110 13:25611690-25611712 TGGAATTGTGTCAATAGGATTGG + Intronic
1106325703 13:28686681-28686703 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1106377986 13:29207979-29208001 TGAAATAGTGTCAATAGGATTGG + Intronic
1106572870 13:30944008-30944030 TGGAATAGTTTCAGTAGGATTGG + Intronic
1106937865 13:34744152-34744174 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1106958577 13:34971896-34971918 TGGAATAGTTTCAATAGGAATGG + Intronic
1107417267 13:40212197-40212219 TGGAGTAGACCCAATAGGATTGG - Intergenic
1107701630 13:43054456-43054478 TGGAATATTTTCAATAGGATTGG + Intronic
1107961055 13:45558984-45559006 TGGAATAGTGTCAATAGGATTGG + Intronic
1108111293 13:47076226-47076248 TGGAATACTTTCAATAGGATTGG - Intergenic
1108189304 13:47921093-47921115 TGGAATAGTGTCAATAGGATCGG - Intergenic
1108624679 13:52216157-52216179 TGGAATAGTTTCAAAAGGATTGG - Intergenic
1109125417 13:58511677-58511699 TGGAATAGTGTGAATAGGATTGG - Intergenic
1109201073 13:59431704-59431726 TGGAAGAGTGTCAATAGGATTGG + Intergenic
1109281392 13:60360348-60360370 TGGAATAGTTCCAATAGCATTGG - Intergenic
1109508091 13:63333449-63333471 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1109620943 13:64904214-64904236 TGGAATAGTGTCAGTGGAATTGG - Intergenic
1109631631 13:65056455-65056477 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1109671903 13:65619939-65619961 TGGAATAGTGTCAATAGGATTGG - Intergenic
1109975906 13:69831537-69831559 TGGAATAGTTTCAATAGAATTGG - Intronic
1110182097 13:72629559-72629581 TGGAATAGTGTCAATAGGATTGG - Intergenic
1110289378 13:73786436-73786458 TGAAATAGTACCAGTGGGTTAGG - Intronic
1110497153 13:76181490-76181512 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1110756029 13:79175252-79175274 TGGAATAGTGTCAATAGGATTGG - Intergenic
1110793372 13:79609808-79609830 TGGAATAGTGTCAATAGGATTGG + Intergenic
1110881841 13:80581232-80581254 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1111157301 13:84344702-84344724 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1111165474 13:84452368-84452390 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1111364934 13:87230647-87230669 TGGAATAGTTTGAATAGGATTGG + Intergenic
1111871626 13:93840020-93840042 TGGAATAGTGTCAAAAGGATTGG + Intronic
1112077927 13:95933135-95933157 TGGAATAGTTTCAGTAGGATTGG + Intronic
1112873239 13:104001546-104001568 GGGAATAGTACCAAAGACATAGG - Intergenic
1112945604 13:104923232-104923254 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1112958678 13:105093570-105093592 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1113330355 13:109320598-109320620 TGGAATAGTATCAAAAAGATTGG - Intergenic
1113534635 13:111055626-111055648 TGGAATAGTGTCAATGGGATTGG + Intergenic
1113637866 13:111933392-111933414 TGGAATAGTGTCGATAGGATTGG + Intergenic
1113845289 13:113385070-113385092 TGTAATAGTGTCAATAGGATTGG + Intergenic
1114589521 14:23847746-23847768 TGGAATAGTTTCAATAGGAATGG + Intergenic
1114691883 14:24590756-24590778 TGGAATAGTATCAAAAGGATTGG + Intergenic
1114926961 14:27414552-27414574 TTGAATAGTAGCATTGGTATAGG + Intergenic
1115350349 14:32387900-32387922 TGGAATAGTGTCAATAGGATTGG + Intronic
1115392943 14:32874177-32874199 TGGAATAGTGTCAATAGGATTGG + Intergenic
1115526893 14:34289965-34289987 TGGAATAGTGTCAAAAGGATTGG + Intronic
1115958980 14:38813343-38813365 TGGAATAGCGTCAATAGGATTGG - Intergenic
1115970143 14:38936021-38936043 TGGAATAGTGTCAATAGGATTGG - Intergenic
1115997330 14:39208138-39208160 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1116077961 14:40136105-40136127 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1116335791 14:43654723-43654745 TGGAATAGTGTCAATAGGATTGG - Intergenic
1116431433 14:44849596-44849618 TGGAATAGTTTCAATAGAATTGG + Intergenic
1116484111 14:45426272-45426294 TGGAATAGTTTCAAGAGGATTGG + Intergenic
1116580401 14:46633853-46633875 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1116652364 14:47609805-47609827 TGGAATAGTGTCAATAGGATTGG - Intronic
1116782789 14:49254504-49254526 TGGAATAGTTCCAGTAGGAATGG - Intergenic
1117113058 14:52478752-52478774 TGGAATAGTGTCAATAGGATTGG - Intronic
1117182526 14:53206136-53206158 TGGAATAGTGTCAATAGGATTGG - Intergenic
1117317558 14:54587939-54587961 TGGAATAGTGTCAATAGGATTGG + Intronic
1117929476 14:60824950-60824972 TGGAATTGATCCAATGGGGTGGG - Intronic
1118061805 14:62147372-62147394 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1118139874 14:63068912-63068934 TGGAATAGTGTCAATAGGATTGG + Intronic
1118196874 14:63635070-63635092 TGGAATAGTGTCAAAAGGATTGG - Intronic
1118531836 14:66715030-66715052 TGGAATAGTATCAATAGGATAGG + Intronic
1119364172 14:74077595-74077617 TGGATTAGTTCCCATGGGAATGG - Intronic
1120471890 14:84936099-84936121 TGGAATAGTGTCAGTAGGATTGG - Intergenic
1120489884 14:85164091-85164113 TGGAATAGTGTCAATAGGATTGG - Intergenic
1120723511 14:87913152-87913174 TGGAATAGTTTCAATAGGAATGG + Intronic
1120776435 14:88442838-88442860 TGGAATAGTGTCCATAGGATTGG + Intronic
1120785604 14:88532199-88532221 TGGAATAGTTTCAGTAGGATTGG - Intronic
1120995199 14:90412295-90412317 TGCAATAGCACCAATGGGTGGGG - Intergenic
1121503182 14:94455573-94455595 TTGAATAGTATCAACAGGATTGG + Intergenic
1121575715 14:94984773-94984795 TGGAGTAGTGTCAATAGGATTGG - Intergenic
1122396975 14:101440795-101440817 TGGAAAAACACCAATTGGATGGG + Intergenic
1124381021 15:29165758-29165780 TGGAATAGTGTCAAAAGGATTGG - Intronic
1124858855 15:33418231-33418253 TGGAATAGTTTCAGTAGGATTGG + Intronic
1125272901 15:37959293-37959315 TGGAATAGTTTGAATAGGATTGG - Intronic
1125371273 15:38980115-38980137 TGGAATAGTTCCAGTAGGATTGG + Intergenic
1126060226 15:44773736-44773758 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1126107182 15:45154271-45154293 TGGACTAGTTCCAGTGGAATAGG + Intronic
1126287547 15:47030803-47030825 GGGAATAGTTTCAATAGGATTGG - Intergenic
1126566210 15:50102680-50102702 TGGAATAGTGTCAAAAGGATTGG - Intronic
1126977568 15:54201252-54201274 TGGAATAGTGTCAATAGGATTGG - Intronic
1126997149 15:54457430-54457452 TGGAATAGTTTGAGTGGGATTGG + Intronic
1127003349 15:54536421-54536443 TGGAATAGTTTCAATAGGATTGG - Intronic
1127007909 15:54591342-54591364 TGGAATAGTGTCAAAAGGATTGG + Intronic
1127036223 15:54920682-54920704 TGGAATAGCGTCAATAGGATTGG + Intergenic
1127050447 15:55077869-55077891 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1127097109 15:55523485-55523507 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1127226704 15:56938560-56938582 TGGAATAGTGTGAATAGGATTGG + Intronic
1127573686 15:60269228-60269250 TGGAATAGTGTCAACAGGATTGG + Intergenic
1128415354 15:67440306-67440328 TGGAATAGTGTCAAAAGGATTGG - Intronic
1129096606 15:73215835-73215857 TGGAATAGTGTCAAAAGGATTGG + Intronic
1130405913 15:83601749-83601771 TAGAATAGTGTCAATAGGATTGG + Intronic
1130749481 15:86695146-86695168 TGGAATAGTGTCAATAGGATTGG + Intronic
1131326563 15:91453082-91453104 TGGAATAGTGTCAATAGGATTGG + Intergenic
1131722890 15:95189825-95189847 TGGAATAGTTCCAGTAGGATTGG + Intergenic
1132033690 15:98461065-98461087 TGGAATAGTGTCAATAGGATTGG - Intronic
1132254046 15:100359139-100359161 TGGAATAGTGTCAACAGGATTGG - Intergenic
1132259854 15:100414032-100414054 TGGAATAGTTTCAGTAGGATTGG - Intronic
1132615064 16:836449-836471 TGGAATAGAAACAGTGGGAGTGG + Intergenic
1133716524 16:8454856-8454878 TGGAATAGTGTCAGTAGGATTGG - Intergenic
1134256527 16:12616522-12616544 TTGAAAAGTAGCAATGGGAGGGG - Intergenic
1135195083 16:20387554-20387576 TGGAATGGTACCAGAGGGTTTGG + Intronic
1135871176 16:26151991-26152013 TGGAATTCTACAAATGGAATGGG - Intergenic
1135901934 16:26468344-26468366 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1135917598 16:26619590-26619612 TGGAATAGTGTCAATAGAATTGG + Intergenic
1136273525 16:29163617-29163639 TGGAATAGTTTCAATAGGATTGG - Intergenic
1137224146 16:46486205-46486227 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1138000781 16:53277195-53277217 TGGAATAGTGTCAAAAGGATTGG - Intronic
1138192394 16:55025366-55025388 TGGAATAGTGTCAATAGGATTGG - Intergenic
1138444909 16:57057701-57057723 TGGAAGAGGACCAAGAGGATGGG + Intronic
1138913470 16:61431858-61431880 TGGAATAGTAGCAATGAAAGTGG - Intergenic
1139987614 16:70912683-70912705 TGGAATAGTGTCAATAGGATGGG + Intronic
1140064269 16:71597008-71597030 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1140215154 16:73001078-73001100 TGGAATAGGACAAATGTGATAGG + Intronic
1140548038 16:75830724-75830746 TGGAATAGTGTCAGTAGGATTGG + Intergenic
1142048028 16:87938256-87938278 TGAAATGGAACCCATGGGATTGG + Intergenic
1142077064 16:88125364-88125386 TGGAATAGTTTCAATAGGATTGG - Intergenic
1142910506 17:3086094-3086116 TGTAATAGTGTCAATAGGATTGG + Intergenic
1143991134 17:10963101-10963123 TGGAATAGTGTCAATAGGATTGG - Intergenic
1144139375 17:12333380-12333402 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1145117107 17:20221217-20221239 TGGAATAGTTTGAATAGGATTGG + Intronic
1145338516 17:21933614-21933636 TGGAATAGAACCAAATGGAATGG + Intergenic
1146583681 17:34062957-34062979 TGGAATAGTGTCAAAAGGATTGG - Intronic
1146751089 17:35381361-35381383 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1147462849 17:40585652-40585674 TGGAATAGTGTCAAGAGGATTGG + Intergenic
1148936793 17:51169608-51169630 TGGAATAGGATCAGTGGGAAGGG - Intronic
1149122114 17:53181940-53181962 TGGAATAATGCCAATAGGATTGG + Intergenic
1149196635 17:54129429-54129451 TGGAATAGTATCAGAGGGAATGG + Intergenic
1149221674 17:54421761-54421783 TGAAATAGTGTCAATAGGATTGG - Intergenic
1149410611 17:56402246-56402268 TGGAATAGTGACAAAAGGATTGG + Intronic
1150093111 17:62347483-62347505 TGGAATGGTGTCAATAGGATTGG + Intergenic
1150895991 17:69211532-69211554 TGAAATAGTGTCAATAGGATAGG + Intronic
1151069910 17:71197295-71197317 TGGAATAGTTTCAGTGGGAATGG - Intergenic
1151079141 17:71308336-71308358 TGGAATAGTGTCAGTAGGATTGG - Intergenic
1151254801 17:72868217-72868239 TGGAATAGTTAGCATGGGATGGG - Intronic
1153065750 18:1042951-1042973 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1153071611 18:1112403-1112425 TGGAATAATGTCAATAGGATTGG + Intergenic
1153168644 18:2290483-2290505 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1153176029 18:2374320-2374342 TTGAATAGTGTCAATAGGATTGG + Intergenic
1153221595 18:2867248-2867270 TGGAATAGTGTCAATAGGATTGG + Intronic
1153371701 18:4324455-4324477 TGGAATAGTTTTAATGGGAATGG - Intronic
1153562991 18:6390919-6390941 TGGAATAGTTTCAGTAGGATTGG - Intronic
1153869772 18:9307262-9307284 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1153965633 18:10179005-10179027 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1154090283 18:11352674-11352696 TGGAATAGTGTCAGTAGGATTGG - Intergenic
1154298209 18:13169423-13169445 TGGAATAGTGTCAATAGGATTGG - Intergenic
1155115466 18:22761972-22761994 TGGAATAGTAACAGAGGGAATGG - Intergenic
1155311311 18:24526661-24526683 TGGAATAATCCCAATGGTATGGG + Intergenic
1155641167 18:28017168-28017190 TGGAATAGTGTCAATAGGGTTGG + Intronic
1155768457 18:29668078-29668100 TGGAATAGTTTCAGTAGGATGGG - Intergenic
1155827595 18:30467581-30467603 TGGAATAGTGTAAATAGGATTGG - Intergenic
1155848115 18:30734533-30734555 TGGAATAGTATCAAAAGGAATGG - Intergenic
1156010976 18:32497611-32497633 TGGAATAGTGTCAATAGCATTGG + Intergenic
1156427396 18:37029071-37029093 TGGAATAGTTTCAGTAGGATTGG + Intronic
1156469796 18:37370151-37370173 TGGGATAGGACCTATTGGATTGG - Intronic
1156606860 18:38676689-38676711 TGGAATAGTGTCAATAGAATTGG + Intergenic
1156667772 18:39428865-39428887 TGGAGTAGTATCAATAGGATTGG - Intergenic
1156695174 18:39757250-39757272 TGGAATAGTTTCAATAGGAATGG - Intergenic
1156790544 18:40968004-40968026 TAGAATAGTGTCAATAGGATTGG - Intergenic
1156926954 18:42593715-42593737 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1156984817 18:43337730-43337752 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1157218882 18:45810302-45810324 TGGAATAGTGTCAATAGGATTGG - Intergenic
1157507775 18:48242284-48242306 TGGAATAGTTTCAATAGGATTGG - Intronic
1157541144 18:48508573-48508595 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1157933426 18:51848228-51848250 TGAAATAGTGTCAATAGGATGGG + Intergenic
1158146122 18:54314527-54314549 TGGAATAGTTTCAGTAGGATTGG + Intronic
1158331369 18:56366876-56366898 TGGAATAGTATCAAAAGGAATGG + Intergenic
1158756802 18:60335013-60335035 TGGAATAGCATCAAAAGGATTGG - Intergenic
1158948701 18:62471450-62471472 TGGAGTAGTTCAAATAGGATTGG + Intergenic
1159430700 18:68349344-68349366 TGGAATAGTGTCAATAGGATTGG - Intergenic
1159453760 18:68635488-68635510 TGGAATAGTGTCAATAGGATTGG + Intergenic
1159612590 18:70542844-70542866 TGGAATAGTGTCAATAGGATTGG + Intergenic
1159906890 18:74100994-74101016 TGGAATAGTGTCAATAGGATTGG - Intronic
1160219515 18:76963626-76963648 TGGAATAGTGTCAAAAGGATTGG + Intronic
1160440560 18:78887507-78887529 TGGAATAGTTTCAATGGAATTGG - Intergenic
1164174807 19:22762575-22762597 TGGAATAGTGTCAATAGAATTGG - Intronic
1164267766 19:23636846-23636868 TGAAATAGTGTCAATAGGATTGG - Intronic
1164493246 19:28733904-28733926 TTGAATAGTTTCAGTGGGATTGG + Intergenic
925127124 2:1466443-1466465 TGGAGTAGTGTCAATAGGATTGG + Intronic
925530785 2:4859979-4860001 GGGAATAGTAACAGTGGCATGGG - Intergenic
925637610 2:5956078-5956100 TGGAATAGTTTCAGTAGGATTGG + Intergenic
925651974 2:6100400-6100422 TGGAATAGTGTTAATAGGATTGG + Intergenic
925847374 2:8045941-8045963 TGCAAAAGTAACAATGGGTTGGG + Intergenic
926527093 2:13994145-13994167 TGAAATAGTGCCAATAGGATTGG + Intergenic
926565858 2:14472950-14472972 TGGAATAGTATCAGTGGGATTGG - Intergenic
926638500 2:15209379-15209401 TGGAATAGTTGGAATAGGATTGG - Intronic
926673371 2:15596509-15596531 TTGAATGGTAGCAATGGGAAAGG + Intronic
926866717 2:17367534-17367556 TGTAATAGTTTCAATAGGATTGG + Intergenic
926915709 2:17889978-17890000 TGGAATAGTGTCAAAAGGATTGG + Intronic
927036435 2:19182017-19182039 TGGAAAAGTGTCAATAGGATTGG + Intergenic
927355532 2:22168724-22168746 TGCAATAGTGTCAATAGGATTGG - Intergenic
927363206 2:22261664-22261686 TGGAATAGTGTCAATAGGATTGG + Intergenic
928147940 2:28797322-28797344 TGGAATAGTTTCAGTAGGATTGG + Intronic
928734001 2:34264585-34264607 TAAAATAGTGCCAATGGGATTGG - Intergenic
928763153 2:34608533-34608555 TGGAATAGTTTAAATAGGATTGG + Intergenic
928772224 2:34716508-34716530 TGGAATAGTGTCAAAAGGATTGG + Intergenic
928988752 2:37208235-37208257 TGGAATAGTTTCAGTAGGATTGG - Intronic
929009993 2:37431922-37431944 TGGAATAGTGTCAATAGGATTGG + Intergenic
929015991 2:37495534-37495556 TGGAATAGTTTCAGTAGGATTGG + Intergenic
929037046 2:37703764-37703786 TGGAATAGTGTCAAATGGATTGG + Intronic
929281339 2:40083283-40083305 TGGAATAGTTTGAGTGGGATTGG + Intergenic
929398978 2:41557954-41557976 TGGAATAGTGTCAATAGGATTGG - Intergenic
929554695 2:42918642-42918664 TGGAATGGCACCATTTGGATAGG + Intergenic
929752322 2:44728472-44728494 TGGAATAGTTTCAGTAGGATTGG + Intronic
930142910 2:47971314-47971336 TGGAATAGTGTCAAAAGGATCGG - Intergenic
930229791 2:48831706-48831728 AGGAATAGTTCCAATAGGAATGG - Intergenic
930574027 2:53124157-53124179 TGGAATAGTCTCAGTAGGATTGG + Intergenic
930818933 2:55626206-55626228 TGGAAGAGCAGAAATGGGATTGG + Intergenic
931136263 2:59405238-59405260 TGTAATAGTGTCAATAGGATTGG - Intergenic
931136721 2:59411041-59411063 TGGAATAGTGTCAATAGGATTGG + Intergenic
931524851 2:63141672-63141694 TGGAATGGTATCAAAAGGATTGG + Intronic
931532786 2:63235436-63235458 TGGAATAGTTTCAGTAGGATTGG - Intronic
931534015 2:63251874-63251896 TGGAATAGTTTCAGTAGGATTGG - Intronic
931548165 2:63411967-63411989 TGGAGTAGTATCAAAAGGATTGG - Intronic
931549614 2:63428164-63428186 TGGAATAGTTTCAATAGGATTGG - Intronic
931993180 2:67811138-67811160 TGGAATAGTGTCAAAAGGATTGG - Intergenic
932100265 2:68892846-68892868 TGGAATAGTTTCAAAAGGATGGG + Intergenic
932384588 2:71319973-71319995 TGGAATAGTGTCAATAGCATTGG + Intronic
932954351 2:76334222-76334244 TGGAATAGTGTCAATAGTATTGG + Intergenic
933097594 2:78206629-78206651 TGGAATAGTTTCAGTAGGATAGG - Intergenic
933181556 2:79232591-79232613 TGGAATAGTTTCACTGTGATTGG + Intronic
933411056 2:81925586-81925608 TGGAATAGTGTCAACAGGATTGG - Intergenic
933433201 2:82211594-82211616 TGGAATACTGTCAATGGGATTGG + Intergenic
933638810 2:84737380-84737402 TGGAATAGTTTCAGTGGAATTGG + Intronic
933642175 2:84775563-84775585 TGGAATAGTTTCAGTAGGATTGG + Intronic
935467401 2:103415416-103415438 TGGAATAGTGCCAAAAGGATTGG - Intergenic
935610107 2:105014003-105014025 TGGAATAGTGCCAATAGGATTGG + Intergenic
935890958 2:107677421-107677443 TGGAAGAGTACAAATGAGACTGG + Intergenic
936003568 2:108860854-108860876 TGGAATAGTTTCAATAGAATTGG + Intronic
936884803 2:117297448-117297470 TGGAATAGTTTCAGTAGGATTGG + Intergenic
936899038 2:117462985-117463007 TGGAATAGTATCAATAGGATTGG + Intergenic
937058158 2:118957596-118957618 TGGAATAGTGTCAAAAGGATTGG - Intronic
937068951 2:119047205-119047227 TGGAATAGTGTCAAAAGGATTGG + Intergenic
937461234 2:122088537-122088559 TGGAATAGTTTCAGTAGGATTGG + Intergenic
937463838 2:122112071-122112093 TGGAATAAAACCATTGGGAGGGG - Intergenic
937663293 2:124455487-124455509 TGGATTAGTGTCAATAGGATTGG - Intronic
937699262 2:124845538-124845560 TGGAATAGTGTCTATAGGATTGG + Intronic
937781670 2:125845736-125845758 TGGAATAGTGTCAATAGGATTGG + Intergenic
937971727 2:127554634-127554656 TGGAATAGTATCAATAGGATTGG + Intronic
938216272 2:129519414-129519436 TGGAATAGTGTCAATAGGATTGG + Intergenic
938509730 2:131928012-131928034 TGGAATAGTGTCAAAAGGATTGG - Intergenic
938597963 2:132808311-132808333 TGGAATAGTGTCAAAAGGATTGG + Intronic
938702591 2:133892867-133892889 TGGAATAAAATAAATGGGATGGG + Intergenic
939449485 2:142355029-142355051 TGGAATAGTGTCAATAGGATTGG - Intergenic
939538371 2:143461837-143461859 AGCAATAGTTCCAATAGGATTGG + Intronic
939748395 2:146007957-146007979 TTGAATAGTAATAATGGCATGGG + Intergenic
939988265 2:148853534-148853556 TGGAATAATAAAAATGGAATTGG + Intergenic
940056443 2:149517509-149517531 TCGAATAGTGTCAATAGGATTGG - Intergenic
940784699 2:157968534-157968556 TGGAATAGCATGAATAGGATTGG + Intronic
940796539 2:158086055-158086077 TGGAATAGTGTCAACAGGATTGG + Intronic
941050420 2:160726400-160726422 TGGAATAGTTTCAATAGGATTGG - Intergenic
941358258 2:164518959-164518981 TGGAATAGTGTCAATGGGATTGG - Intronic
941593664 2:167450143-167450165 TGGAATAGTGTCAATAGGATTGG + Intergenic
941631166 2:167885839-167885861 TGGAATAGTGTCAATAGGATTGG - Intergenic
941631329 2:167888006-167888028 TGGAATAGTGTCAATAGGATTGG + Intergenic
941679920 2:168386670-168386692 TGGAATAGTGTCAATAGGATTGG - Intergenic
941702407 2:168617820-168617842 TGGAATAGAGTCAATAGGATTGG - Intronic
942260208 2:174152733-174152755 TGGAATAGTATAACTGGAATTGG + Intronic
942726377 2:179012557-179012579 TGGAATAGTGTCAAAAGGATTGG - Intronic
943158360 2:184214211-184214233 TGGAATAATTCCAATAGGATTGG + Intergenic
943167732 2:184351790-184351812 TGGAATAGTGTCAGTAGGATTGG - Intergenic
943297620 2:186158446-186158468 TGGAATAGTTTCAATAGGAATGG - Intergenic
943548958 2:189315019-189315041 TGGAATAGTTGCAAAGGGAATGG - Intergenic
943621032 2:190148559-190148581 TGGAATAGTGTCAAAAGGATTGG + Intronic
943654574 2:190494437-190494459 TGGAATAGTGTCAATAGGATTGG - Intronic
943909576 2:193545839-193545861 TGGAGTAGTGTCAATAGGATTGG - Intergenic
943956964 2:194204486-194204508 TGGAATAGTTTCAGTAGGATTGG + Intergenic
943977786 2:194505898-194505920 TGGAATAGTATCAATAGGATTGG + Intergenic
943996428 2:194771889-194771911 TGCAATAGTGTCAATCGGATGGG + Intergenic
944528597 2:200645623-200645645 TGGAATAGTATCAAAAGGATTGG + Intronic
944602402 2:201316646-201316668 TGGAATAGTGTTAATAGGATTGG - Intronic
945075440 2:206034186-206034208 TGGAATAGTGTCAAAAGGATTGG - Intronic
945286026 2:208082790-208082812 TGGAATAGTGTCAACAGGATTGG - Intergenic
945362663 2:208910433-208910455 TGGAATAGTGTAAATAGGATTGG - Intergenic
945480669 2:210341749-210341771 TGGAATAGTTTCAGTAGGATTGG + Intergenic
945480906 2:210344479-210344501 TGGAATAGTGTCAATAGGATTGG + Intergenic
945536287 2:211021997-211022019 TGGAATAGTGTCAATAGGATTGG + Intergenic
945545341 2:211143404-211143426 TGGAATAGTTTCAGTAGGATTGG + Intergenic
945575979 2:211529438-211529460 TGGAATAGTTTGAATAGGATTGG - Intronic
945826043 2:214721192-214721214 TGGAATAGTGTCAAAAGGATTGG - Intergenic
945861375 2:215126352-215126374 TGGAATAGTTTCAAAAGGATTGG + Intronic
946062223 2:216953130-216953152 TGGAATAGTTCCAGTAGGAGTGG + Intergenic
946570919 2:221023231-221023253 TGGAATAGTGTCAGTAGGATTGG + Intergenic
946802036 2:223428181-223428203 TGGAATACTGCCAATAGGATTGG + Intergenic
947383993 2:229572057-229572079 TGGAAAATTAACAAAGGGATAGG - Intronic
947456768 2:230262006-230262028 TGGAATAGTGTCAAAAGGATTGG + Intronic
947653545 2:231807771-231807793 TGGAACAGTACCAACAGGGTGGG - Exonic
947948989 2:234131417-234131439 GGGAGTAGAACCAATGGGATTGG + Intergenic
947961230 2:234239934-234239956 GGGAATAGACCCAAGGGGATGGG - Intergenic
1169528600 20:6458703-6458725 TGGAATAGTGTCAACAGGATTGG - Intergenic
1169840966 20:9936839-9936861 TGGATTAGTGTCAATAGGATTGG + Intergenic
1169842407 20:9954612-9954634 TGGAATGGTACATATGTGATTGG - Intergenic
1170241206 20:14168792-14168814 TGGAATAGTGTCAATAGGATTGG - Intronic
1170245488 20:14217561-14217583 TGGAATAGTTTCAAAAGGATTGG + Intronic
1170426161 20:16237369-16237391 TGGATTAGTAGCAAAGGCATTGG - Intergenic
1170489188 20:16854300-16854322 TGGAATAGTTTCAATAGGATTGG + Intergenic
1170651116 20:18242836-18242858 TGGAATAGTGTCAATAGGATTGG - Intergenic
1170720740 20:18876232-18876254 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1170726644 20:18934018-18934040 TGGAATAATCTCAATAGGATTGG + Intergenic
1170741328 20:19060020-19060042 TGGAATAATGTCAATAGGATTGG - Intergenic
1171066672 20:22023545-22023567 TGGAATAGTGTCAATAGGATTGG + Intergenic
1171080298 20:22175037-22175059 TGGAATACTGTCAATAGGATTGG + Intergenic
1171160187 20:22915103-22915125 TGGAATAGTGTTAATAGGATTGG + Intergenic
1171922207 20:31157935-31157957 TGGAATGGAATCAATGGGATTGG + Intergenic
1173014975 20:39216535-39216557 TGGATAAGTAGCATTGGGATGGG - Intergenic
1173700435 20:45065539-45065561 TGGAATAGTTTCAGTAGGATTGG + Intronic
1173711622 20:45161994-45162016 TGGAATAGTTTCACTAGGATTGG + Intergenic
1175906865 20:62384774-62384796 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1176658341 21:9609672-9609694 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1176717281 21:10363990-10364012 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1176783751 21:13230554-13230576 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1176906373 21:14506631-14506653 TGGGATAGTGTCAATAGGATTGG - Intronic
1177124555 21:17180406-17180428 TGAAATAGTTTCAATAGGATTGG - Intergenic
1177174155 21:17686093-17686115 TGGAATAGTGTCAATAGGATTGG + Intergenic
1177195227 21:17897369-17897391 TGGAATAGTGTCAATAGGACTGG + Intergenic
1177223344 21:18222012-18222034 TGCATCAGCACCAATGGGATGGG + Intronic
1177301524 21:19251625-19251647 TGGAATAGTATCAGTAGAATTGG - Intergenic
1177579109 21:22996282-22996304 TGGAATAGTGTCAATAGCATTGG - Intergenic
1177749939 21:25268656-25268678 TGGAATAGTGTCACTAGGATTGG - Intergenic
1177847615 21:26309136-26309158 TGGAATAGTGTCAATAGGATTGG - Intergenic
1177856865 21:26409256-26409278 TGGGAAAGTACAAATGGGAGGGG + Intergenic
1177935085 21:27335153-27335175 TGGAATAGTGTCAATAGGATTGG - Intergenic
1177981798 21:27924393-27924415 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1178038495 21:28612012-28612034 TGGAATAGTGTCAATAAGATTGG - Intergenic
1178047984 21:28717167-28717189 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1178104849 21:29306508-29306530 GGGAATAGTACCGCTGTGATTGG + Intronic
1178733153 21:35123893-35123915 TGGAATAGTGTCAATGGGATTGG - Intronic
1178801971 21:35804498-35804520 TGGAATAGTGTCAAAAGGATTGG - Intronic
1178959351 21:37050476-37050498 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1179083857 21:38199355-38199377 TGGAATAGTGTCAATAAGATTGG + Intronic
1179300667 21:40106523-40106545 TGGAATAGTTTCAATAGGAATGG + Intronic
1180298504 22:11016909-11016931 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1180601061 22:17016004-17016026 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1181717314 22:24740849-24740871 TGGAATAGTTTCAGTAGGATTGG - Intronic
1182199065 22:28551317-28551339 TGGAATAGTGTCAATAAGATTGG - Intronic
1182682717 22:32094393-32094415 TGGAATAGTGTCAATAGGATCGG + Intronic
1182977004 22:34632443-34632465 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1183296454 22:37032607-37032629 TGGAATTTAACCAATGGGTTTGG + Intergenic
1184618845 22:45658313-45658335 TGGAATTATACCAAATGGATAGG + Intergenic
949727491 3:7066611-7066633 TGGAATAGTGTCAAAAGGATTGG - Intronic
949749587 3:7335989-7336011 TGGAATAGTTTCAATAGGATTGG - Intronic
949799442 3:7887476-7887498 TGGAATAGTGTCAATAGGACTGG - Intergenic
949814543 3:8044137-8044159 TGGAATAATGCCAAAAGGATTGG - Intergenic
950593974 3:13962097-13962119 TGGAATAGTTTCAGTAGGATTGG + Intronic
950598944 3:14013974-14013996 TGAAATAGCATCAATAGGATTGG + Intronic
950820006 3:15746748-15746770 TGGAAAAGTATCAATAGGACTGG + Intronic
951184089 3:19691936-19691958 TGGAATAGTGTCAATAGAATTGG - Intergenic
951294819 3:20921011-20921033 TGGAATAGTGTCAATAAGATTGG - Intergenic
951404739 3:22281794-22281816 TGGAATAGTGTCAATAGGATTGG + Intronic
951690743 3:25393442-25393464 TGTAATAGTTTCAATAGGATTGG + Intronic
951750001 3:26024362-26024384 TGGAGTAGTGTCAATAGGATTGG + Intergenic
952083154 3:29785108-29785130 TGGAATAGTGTCAATAGGACTGG - Intronic
952097136 3:29967244-29967266 TGGAATAGTGTCAAAAGGATTGG + Intronic
952601782 3:35092165-35092187 TGGAATAGTGTCAATAAGATTGG - Intergenic
952689569 3:36189003-36189025 TGGAATAGTGTCAATAGGATTGG + Intergenic
952714637 3:36467397-36467419 TGGAATAGTGTCAATAGGATTGG + Intronic
952732779 3:36656768-36656790 TGGAATGGTGTCAATAGGATTGG - Intergenic
953185569 3:40634887-40634909 TGGAATAGTGTCAATAGGATTGG - Intergenic
953723599 3:45378098-45378120 TGGAATAGTGTCAAAGGGATTGG + Intergenic
953822333 3:46218411-46218433 TGGAATAGTGTCAGTAGGATTGG - Intronic
954947458 3:54439123-54439145 TGCCATAGGATCAATGGGATAGG - Intronic
955450486 3:59061398-59061420 TGGAATAGTGTCAATAGGATTGG + Intergenic
956507363 3:69956637-69956659 AGGAATAGAACCAAAGGGAGAGG - Intronic
957331233 3:78767171-78767193 TGGAATAGTGTCAAAAGGATTGG + Intronic
957332088 3:78778387-78778409 TGGAATAGTTTCAGTGGGAATGG + Intronic
957613512 3:82498922-82498944 TGGAATAGTTTCAATAAGATTGG - Intergenic
957721320 3:84003609-84003631 TGGAATAGTTTCAGTAGGATTGG + Intergenic
957772377 3:84710994-84711016 TGGAATAGTTTCAATAGGATTGG - Intergenic
957907222 3:86573026-86573048 TGGAATAGTTTCAATAGGATTGG + Intergenic
957921463 3:86753842-86753864 TGGAATAGTTTCAGTAGGATTGG + Intergenic
957971974 3:87393846-87393868 TGGGATAGTGTCAATAGGATTGG - Intergenic
958014101 3:87917807-87917829 TGGAATAGTGTCAATAGGATTGG - Intergenic
958064274 3:88522890-88522912 TGGAATAGTGTCAATAGTATTGG + Intergenic
958088024 3:88837772-88837794 TGGAATAGTGTCAAAAGGATTGG + Intergenic
958113176 3:89177461-89177483 TGAAATCTTACCAATGGGAGAGG - Intronic
958480506 3:94640267-94640289 TGGAATAGTGTCAAAAGGATTGG + Intergenic
958490313 3:94764514-94764536 TGGAATAGTGTCAAAAGGATTGG + Intergenic
958726035 3:97907299-97907321 TGGAATAGTTTCAAAAGGATTGG + Intronic
958775350 3:98476274-98476296 TGGAACAGTTCCAATAAGATTGG + Intergenic
958882796 3:99691871-99691893 GAGAATGGTACCAAAGGGATAGG + Intronic
959009456 3:101058110-101058132 TGGAATAGTGTCAATAGGATTGG + Intergenic
959039818 3:101408372-101408394 TCGAATAGTGTCAATAGGATTGG - Intronic
959362188 3:105407142-105407164 TGGAATAGTGTCATTAGGATTGG - Intronic
959424101 3:106164847-106164869 TGGAATAATATCAATAAGATTGG - Intergenic
959717512 3:109449481-109449503 TGGAATAGTTTCAGTAGGATTGG - Intergenic
959730921 3:109601252-109601274 TGGAATAGTATCAATAGGATTGG + Intergenic
959756684 3:109907826-109907848 TGGAATAGTGTCAAAAGGATTGG + Intergenic
959757142 3:109912044-109912066 TGGAATAGTGTCATTAGGATTGG + Intergenic
959802255 3:110509312-110509334 TGGAATAGTGTCAATAGGGTAGG + Intergenic
959875431 3:111376768-111376790 TGGAATAGCATCAATAGTATTGG - Intronic
960015362 3:112881791-112881813 TGGAATAGTTTCAATAGGATTGG + Intergenic
960033106 3:113074750-113074772 TGGAATAGTGTCAATAGGATTGG + Intergenic
960152747 3:114267340-114267362 CGGAATAGTTCCAGTAGGATTGG + Intergenic
960512521 3:118568233-118568255 TGGAATAGTGTCAAAAGGATTGG + Intergenic
960516829 3:118611411-118611433 TGGAATAGTGTCAACAGGATTGG - Intergenic
960560254 3:119075415-119075437 TGGAATAGTTTCAGTAGGATTGG - Intronic
960778517 3:121290493-121290515 TGGAATAGTTTCAATAGGATTGG - Intronic
960917491 3:122711636-122711658 TGGAATAGTTTCAGTAGGATTGG + Intronic
960929778 3:122835148-122835170 TGGAATAGTTTCAGTAGGATTGG - Intronic
962013246 3:131414367-131414389 TGCAATAGTGTCAATAGGATTGG - Intergenic
962503088 3:136015370-136015392 TGGAATAGTTTCAATAGGATTGG + Intronic
962504612 3:136033439-136033461 TGGAATAGTGTCAATAGGATTGG + Intronic
962530160 3:136272411-136272433 TGGAATAGTTTCAGTAGGATTGG + Intronic
962600031 3:136984669-136984691 AGGAATAGGACCATTGGAATGGG + Intronic
962984797 3:140525515-140525537 TGGAATAGTTTCAGTAGGATTGG - Intronic
962994172 3:140608819-140608841 TGGAATAGTTTCAGTAGGATTGG - Intergenic
963176376 3:142302112-142302134 TGGAATAGTGTCAGTAGGATTGG - Intergenic
963455736 3:145544285-145544307 TGGAATAGTTTCAGTAGGATTGG + Intergenic
964146981 3:153475520-153475542 TGGAATAGTGTCAATCGGATTGG + Intergenic
964160938 3:153644219-153644241 TGGAATAGTGTCAAAAGGATTGG - Intergenic
964189914 3:153989622-153989644 TGGAATAGTGTCAATAGGATTGG - Intergenic
964226733 3:154411787-154411809 TGGAATAGTGTCAATAGGACTGG - Intronic
964331998 3:155613238-155613260 TGGAATAGTGTCAATAGGATTGG - Intronic
964342542 3:155722874-155722896 TGGAATGGTGTCAATAGGATTGG + Intronic
964393896 3:156225008-156225030 TGGAATAGTGTCAATAGGATTGG - Intronic
964565185 3:158042555-158042577 TGGAATAGTTTCAGTAGGATTGG - Intergenic
964644125 3:158940038-158940060 TGGAATAGTTTCAATAGGATTGG - Intergenic
964916041 3:161843250-161843272 TGGAATAGTGTCAAAAGGATTGG + Intergenic
964947359 3:162242560-162242582 TGGAACAGCCCCAATGGGAGTGG - Intergenic
965013638 3:163128410-163128432 TGGAATAGTGTAAATAGGATCGG - Intergenic
965249644 3:166326708-166326730 TGGAATAGCTTCACTGGGATTGG + Intergenic
965745706 3:171923380-171923402 TAGAATAGTGTCAATAGGATTGG - Intronic
965874093 3:173296324-173296346 TGGAATAGTGCCAATAGGATTGG + Intergenic
966117397 3:176482038-176482060 TGGAATAGTGTCAAAAGGATTGG + Intergenic
966153315 3:176889999-176890021 TGGAATAGTGTCAATAGAATTGG - Intergenic
966512408 3:180778642-180778664 TGGAATAGTTTCAGTAGGATTGG + Intronic
966514172 3:180798994-180799016 TGGAATAGTGCCAATAAGATTGG - Intronic
967203580 3:187098457-187098479 TGGAATAGTTTCAGTAGGATTGG - Intergenic
967257229 3:187605914-187605936 TGGAATAGTGACAAAAGGATTGG + Intergenic
967389364 3:188940421-188940443 TGGCATAGTACTGATGGAATAGG + Intergenic
967400055 3:189050520-189050542 TGGAATAGTGTCAAAAGGATTGG - Intronic
967434299 3:189426603-189426625 AGGAATAGTTTCAATAGGATTGG + Intergenic
967643262 3:191894319-191894341 TGGTATATTTCCTATGGGATTGG + Intergenic
967651801 3:191994834-191994856 TGGAATAGTGTCAATAGGATGGG - Intergenic
967741294 3:193005285-193005307 TGGAATAGTGTCAACAGGATTGG + Intergenic
967750170 3:193104733-193104755 TGGAATAGTTCCAGTAGGAATGG + Intergenic
967958418 3:194897728-194897750 TGGAATAGTGTCAATATGATTGG + Intergenic
968125246 3:196154296-196154318 TGGAATAGTTTCAGTAGGATTGG + Intergenic
968260074 3:197314404-197314426 TGGAATAGTTTCAGTAGGATTGG + Intergenic
970217179 4:13771759-13771781 TGGAATAGTGTCAAAAGGATTGG + Intergenic
970491270 4:16576668-16576690 TGGAATAGTTTCAGTAGGATTGG - Intronic
970996409 4:22272268-22272290 TGGAATAGTGTCAAAAGGATTGG - Intergenic
971062014 4:22982701-22982723 TGGAATAGTTTCAGTAGGATTGG - Intergenic
971106316 4:23527982-23528004 TGGAATAGTTTCACTGGGAATGG - Intergenic
971182827 4:24346333-24346355 TGGAATAGTGTCAAAAGGATTGG + Intergenic
971435032 4:26611745-26611767 TGGTATAGTGCCAATAGGAAAGG + Intronic
971554695 4:27998994-27999016 TGACATAGTATCAATAGGATTGG + Intergenic
971900782 4:32655349-32655371 TGGAATAGTGTCAAGAGGATTGG + Intergenic
971938277 4:33182069-33182091 TGGAATAGTGTCAATAGAATTGG + Intergenic
972131952 4:35848168-35848190 TGGAATAGTTTCAGTAGGATTGG + Intergenic
972188786 4:36565480-36565502 TGGAATAGTGTCAATAGGATTGG + Intergenic
972806746 4:42536538-42536560 TGGAATAGTGTCAATAGGATTGG - Intronic
972827062 4:42771202-42771224 TGGAATAGTGTCAATAGGATTGG - Intergenic
973179296 4:47248558-47248580 TGGAATAGTGTCAAAAGGATTGG + Intronic
973342740 4:49022601-49022623 TGGAATAGTGTCAGTAGGATTGG + Intronic
973787351 4:54345046-54345068 TGGAATAGTGTCAAAAGGATTGG - Intergenic
973831225 4:54761407-54761429 TGGAATAGTGTCAATGGGATTGG + Intergenic
974133189 4:57781749-57781771 TGGAATAGTTTCAGTAGGATTGG + Intergenic
974234558 4:59164362-59164384 TGGAATAGTTTCAGTAGGATTGG - Intergenic
974472349 4:62334984-62335006 TGGAATAGTTTCAGTAGGATTGG - Intergenic
974490240 4:62555557-62555579 TGGAGTAGTTTCAATAGGATTGG + Intergenic
974656698 4:64833133-64833155 TGGAATAGTGTCAATAGGATTGG + Intergenic
974801544 4:66824994-66825016 TGGAATAGTGTCAACAGGATTGG + Intergenic
975153805 4:71048653-71048675 TGGAATAGTACCATTAGAAATGG - Intergenic
975204393 4:71627782-71627804 TGGAATAGTGTCAATAGGATTGG - Intergenic
975243530 4:72091382-72091404 TGGAATAGTGTCAATAGGATTGG + Intronic
975410911 4:74048511-74048533 TGGAATAGTTTCAAGTGGATTGG + Intergenic
975510059 4:75184489-75184511 TGGAATAGTGTCAATAGGATTGG - Intergenic
975517586 4:75263760-75263782 TGGAATAGTGTCAAAAGGATTGG - Intergenic
975752940 4:77542915-77542937 GGGAATAGTTTCAGTGGGATTGG + Intronic
975943087 4:79671549-79671571 TGGAATAGTGTCAATAGGATTGG - Intergenic
975967319 4:79989570-79989592 TGGAATAGTTTCAGTAGGATTGG - Intronic
976105115 4:81608328-81608350 TGGAATAGTACCTATATCATAGG + Intronic
976157454 4:82162117-82162139 TGGAATAGTGTCAATAGGATTGG - Intergenic
976455401 4:85240917-85240939 TGGAATAGTGTCAAAAGGATTGG + Intergenic
976556487 4:86456745-86456767 TGGAATAGTGTCAATCGAATTGG - Intronic
976562464 4:86517831-86517853 TGGAATAGTTTCAGTAGGATTGG + Intronic
976657475 4:87504364-87504386 TAGAATATTAACAATGGAATGGG + Intronic
976791524 4:88884097-88884119 TGGAATAGTGTCAATAGGATTGG - Intronic
976856763 4:89613367-89613389 TGGAATAGTGTCAAAAGGATTGG - Intergenic
976888138 4:90010962-90010984 TGGAATAGTGTCAATAGGATTGG - Intergenic
977084131 4:92572875-92572897 TGGAATAGTATCAGTAGGAATGG + Intronic
977474209 4:97484649-97484671 TGGAATAGTGTCAAAAGGATTGG - Intronic
977513643 4:97993638-97993660 TGGGATAGTATCAATAGGATTGG + Intronic
977549607 4:98426807-98426829 TGGAATAGTGTCAATAGGATTGG - Intronic
977552143 4:98453356-98453378 TGGAATAGTGTCAATAGTATTGG + Intergenic
977635803 4:99296852-99296874 TGGAATAGTGTCGATAGGATTGG - Intergenic
977904355 4:102458446-102458468 TGGAATAGTGTCAGTAGGATTGG - Intergenic
978090025 4:104703682-104703704 TGGCAAGGTACCAGTGGGATAGG + Intergenic
978226620 4:106342827-106342849 TGGAATAGTCTCAGTAGGATTGG + Intronic
978253885 4:106669647-106669669 TGGAATAGTTTCAATAGAATTGG + Intergenic
978298620 4:107239136-107239158 TGGAATAGTTTCAGTAGGATTGG - Intronic
978316650 4:107445188-107445210 TGGAATAGTGTCAATAGGACTGG + Intergenic
978537845 4:109781597-109781619 TGGAATAGTGTCAAAAGGATAGG - Intronic
978629209 4:110723746-110723768 TGGAATAGTGTCAATAGGGTTGG + Intergenic
978757606 4:112320593-112320615 TGGAATAGTTTCAATAGGATTGG + Intronic
978999154 4:115196293-115196315 TGGAATAGTGTCAAAAGGATTGG + Intergenic
979061655 4:116069120-116069142 TGGAATTGTGTCAATGGGATTGG - Intergenic
979158264 4:117425869-117425891 TGGAATAGTTTCACTGGGAATGG + Intergenic
979195108 4:117911909-117911931 TGGAATAGTTTGAATAGGATTGG + Intergenic
979268086 4:118726619-118726641 TGGAAAAGGGCCAATGGGAAAGG + Intronic
979498848 4:121415702-121415724 TGGAATAGTGTCAATAGGATTGG + Intergenic
979570479 4:122217764-122217786 TGGAATAGTTTCAGTAGGATTGG + Intronic
979706967 4:123731791-123731813 TGGAATAGTTTCAGTAGGATTGG + Intergenic
979794645 4:124831623-124831645 TGGAATAGTGTCAAAAGGATTGG + Intergenic
979984751 4:127299955-127299977 TGGAATAGTGTCAATAGAATTGG - Intergenic
979995715 4:127428419-127428441 TGGAATAGTGTCAAAAGGATTGG - Intergenic
980086921 4:128400689-128400711 TGGAATAGTGTCAAAAGGATTGG + Intergenic
980523889 4:133964406-133964428 TGGAATAGTGTCAATAGGATTGG - Intergenic
980536520 4:134130616-134130638 TGTAATAGTGTCAATAGGATTGG - Intergenic
980693936 4:136331442-136331464 TGGAATAGTTTCAGTAGGATTGG - Intergenic
981461677 4:145020023-145020045 TGGAATAGTGTCAGTAGGATCGG - Intronic
981738731 4:147980587-147980609 TGGAATTGTTCCAGTAGGATTGG + Intronic
981760511 4:148189577-148189599 TGGAATAGTGTCAAAAGGATTGG + Intronic
981795618 4:148591582-148591604 TGGAATATTGTCAATAGGATTGG + Intergenic
981825132 4:148931692-148931714 TGGAATAGTGTCAAAAGGATTGG - Intergenic
982189468 4:152839333-152839355 TGGAATAGTGTCAAAAGGATTGG + Intronic
982299237 4:153861954-153861976 TGGAATAGTGTCCATAGGATTGG + Intergenic
982531699 4:156552849-156552871 TGGAATAGTGTCAACAGGATTGG + Intergenic
982630929 4:157828166-157828188 TGGAATAGTGTCAATAGCATTGG - Intergenic
982679820 4:158415689-158415711 TGGAATAGTGTCAAAAGGATTGG + Intronic
982784926 4:159525648-159525670 TGGAATATTACAAATGGAAAAGG - Intergenic
982830056 4:160047947-160047969 TGGAATAGTGTAAATAGGATTGG - Intergenic
982960132 4:161825444-161825466 TGGGATAGTATCAATAGGATTGG + Intronic
982992069 4:162289281-162289303 TGGAATGGTGTCAATAGGATTGG - Intergenic
983086537 4:163452168-163452190 TGTAATAGTTTCAATAGGATTGG - Intergenic
983277773 4:165639160-165639182 TGGAATAGTGTCAGTAGGATTGG - Intergenic
983544575 4:168949670-168949692 TGGAATAGTGTCAAAAGGATTGG + Intronic
983546772 4:168973325-168973347 TGGAATAGTTTCAGTAGGATTGG + Intronic
983611498 4:169650450-169650472 TAGAATACTACCAATGTTATTGG - Intronic
983962796 4:173774831-173774853 TGGAATGGTTTCAATAGGATTGG + Intergenic
984066804 4:175058256-175058278 TGGAAAAGTGCCAGTAGGATTGG - Intergenic
984266374 4:177501987-177502009 TGGAATAGTGTCAAAAGGATTGG + Intergenic
984331760 4:178329753-178329775 TGGAAAAGTACAAGTGGGAAAGG + Intergenic
985093194 4:186385022-186385044 TGGAATAGTGTCAAAAGGATTGG - Intergenic
985107981 4:186517336-186517358 TGGAATAGTGTCAATAGGATTGG + Intronic
985240433 4:187925694-187925716 TGGAATAGAGTCAATAGGATTGG + Intergenic
985356024 4:189120251-189120273 TGGAATAGTGTCAATAGGATTGG - Intergenic
985417070 4:189746402-189746424 TGGAATAGTTTCAGTAGGATTGG - Intergenic
986047773 5:4056916-4056938 TAGAATAGTGTCAATAGGATTGG - Intergenic
986845958 5:11753724-11753746 TGGAATAGTTTCAGTAGGATTGG + Intronic
987176464 5:15315693-15315715 TGGAATAGTGTCAATAGGATTGG - Intergenic
987563812 5:19558736-19558758 TGGAATAGTGTCAATAGGATTGG - Intronic
987846441 5:23293173-23293195 TGGATTAGTGTCAATAGGATTGG + Intergenic
988010847 5:25482399-25482421 TTGCATAGTAACAATGGCATTGG - Intergenic
988069003 5:26263091-26263113 TGGAATAGTTCCAGTAGAATTGG + Intergenic
988122674 5:26987348-26987370 TAGAATAGTATGAATGTGATTGG + Intronic
988141003 5:27240105-27240127 TGGAATAGTTCCAGTGGAATTGG + Intergenic
988149072 5:27352378-27352400 TGGAATAGTAATAGTGGGGTTGG + Intergenic
988355440 5:30167967-30167989 TGGAATAGTGTCAATAAGATTGG - Intergenic
988420836 5:31004178-31004200 TGGAATAGTGTCAATAGGATTGG + Intergenic
988902521 5:35748761-35748783 TGGAATAGTATCAAAAGGATTGG - Intronic
989028761 5:37095021-37095043 TGGAATAGTGTCAATAGGATTGG - Intergenic
989030304 5:37111558-37111580 TGGATTAGTGCCAAAGGGAAGGG + Intronic
989070340 5:37503666-37503688 TGGAATAGTTTCAGTAGGATTGG + Intronic
989431372 5:41359269-41359291 TGGAGTAGTGTCAATAGGATTGG + Intronic
989533514 5:42536717-42536739 TGGAATAGCATCAAAAGGATTGG + Intronic
989561893 5:42861692-42861714 TGGAATAGTGTCAACAGGATTGG + Intronic
989694094 5:44179217-44179239 TGGAATAGTCTCAATAGGATTGG + Intergenic
990233629 5:53742448-53742470 TGGAATAGTGTCAAAAGGATTGG - Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990573191 5:57099653-57099675 TGGAATAGTGTCAATAGGATTGG - Intergenic
990712543 5:58601397-58601419 TGGAATAGTATCAAAAGGATTGG + Intronic
990775847 5:59304949-59304971 TGGAATAGTGTCAAAAGGATTGG + Intronic
990891470 5:60655176-60655198 TGAAATAGTGTCAATAGGATTGG + Intronic
990903058 5:60774072-60774094 TGGAATAGTTTCAGTAGGATTGG - Intronic
991233466 5:64364626-64364648 TGGAATAGTTTCAGTGGGAATGG + Intronic
991415646 5:66389659-66389681 TGGAATAGTTTCAATAGGACTGG - Intergenic
991922963 5:71675507-71675529 TGGAATAGTTTCAGTAGGATTGG + Intergenic
991924168 5:71687506-71687528 TGGAATGGTGTCAATAGGATTGG - Intergenic
992220808 5:74570874-74570896 TGGAATAGTTTCATTAGGATTGG + Intergenic
992339799 5:75811386-75811408 TGGAATAGTGTCAATAGGATCGG + Intergenic
992345594 5:75873993-75874015 TGGAATAGTTTCAATAGGAATGG - Intergenic
992520622 5:77546711-77546733 TGGAATAGTGTCAATAGGATTGG - Intronic
992725246 5:79600329-79600351 TGGAATAGTTTTAATAGGATTGG + Intergenic
992898970 5:81273808-81273830 TGGAATAGTGTCAATAGGATTGG - Intergenic
993104005 5:83578043-83578065 TGGAATAAGACCAAAGTGATAGG - Intronic
993138909 5:84005267-84005289 TGGAATAATATCAGTGGGATTGG - Intronic
993233896 5:85277927-85277949 TGGAATAGTATCAGTAAGATTGG - Intergenic
993246135 5:85455391-85455413 TGGAATAGTTTCAATAGAATTGG + Intergenic
993277554 5:85879958-85879980 TGGAATAGTGTCAAAAGGATTGG + Intergenic
993883595 5:93391655-93391677 TGGAATAGTGTCAAAAGGATGGG + Intergenic
993917351 5:93759334-93759356 TGGAATAGTGTCAAAAGGATTGG - Intronic
993920632 5:93796353-93796375 TGGTATAGCACTAATGTGATTGG + Intronic
993933809 5:93975869-93975891 TGTAATAGTTTCAATGGGATTGG - Intronic
993948281 5:94141097-94141119 TGGAATAGTGTCAATAAGATTGG + Intergenic
993965071 5:94350368-94350390 TGGAATAGTGTCAAAAGGATTGG - Intronic
994051023 5:95362554-95362576 TGGAATGGTGTCAATAGGATTGG + Intergenic
994304310 5:98183807-98183829 TGGAATAGTGTCAATAGGGTTGG - Intergenic
994496881 5:100523809-100523831 TGGAATAGTGTGAATAGGATTGG - Intergenic
994527296 5:100922428-100922450 TGGAATAGTATCAATAGGATTGG + Intergenic
994555310 5:101292161-101292183 TTGAATAGTGTCAATAGGATTGG + Intergenic
994636343 5:102348940-102348962 TGGAATAATTTCAATAGGATTGG - Intergenic
994823511 5:104682574-104682596 TGGAATAGTGTCAATAGGATTGG - Intergenic
994925048 5:106104942-106104964 TAGAATAGTGTCAATAGGATTGG - Intergenic
995317629 5:110794127-110794149 TGGAATAGTGTCAATAGGATTGG + Intergenic
995375162 5:111465792-111465814 TGGAATAGTGTCAATAGGATTGG - Intronic
995699698 5:114920787-114920809 TGGAATAGTGTCAATAGGATTGG - Intergenic
995818117 5:116194756-116194778 TGGAATAGTATCAAAAGGATTGG - Intronic
996011047 5:118482273-118482295 TGGAATAGTGTCAAAAGGATTGG - Intergenic
996279706 5:121714249-121714271 TGGAACAGTGTCAATAGGATTGG - Intergenic
996400452 5:123056315-123056337 TGGAATAGTTTCAGTAGGATTGG - Intergenic
996495032 5:124145462-124145484 TGGAATAATGTCAATAGGATTGG + Intergenic
996561527 5:124834832-124834854 TGGAATAGTGTCAATAGAATTGG - Intergenic
996616148 5:125443479-125443501 TGGAATAGTGTCGATAGGATTGG - Intergenic
996697318 5:126412662-126412684 TGGAATAGTTTCAGTAGGATTGG + Intronic
996779923 5:127174045-127174067 TGGAATAATATCGATAGGATTGG + Intergenic
997105680 5:131016654-131016676 TGGCATAGTGTCAATAGGATTGG + Intergenic
997763659 5:136476433-136476455 TGGAATAGTGCCAATGGGATTGG + Intergenic
997765274 5:136496929-136496951 TGGAATAGTGTCAATAGGATTGG + Intergenic
998991382 5:147821637-147821659 AGGAACAGCACCAAAGGGATGGG - Intergenic
999350790 5:150869532-150869554 TGGAATAGTTTCAATAGGACTGG + Intronic
999416575 5:151402541-151402563 TGGAATAGTTTCAGTAGGATTGG + Intergenic
999484400 5:151980720-151980742 TGGAATAGTGTCAAAAGGATTGG + Intergenic
999666053 5:153914645-153914667 TGGAATAGTTTCAATAGGAGTGG + Intergenic
999677428 5:154018499-154018521 TGAAATAGTATCAATAGGATTGG - Intronic
999800986 5:155035924-155035946 TGGAATAGTGTCAATAGGATTGG + Intergenic
999839209 5:155406447-155406469 TGGAATAGTGTCACTAGGATTGG - Intergenic
999930534 5:156428088-156428110 TGGAATACTGTCAATAGGATTGG + Intronic
1000238065 5:159381816-159381838 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1000511326 5:162187066-162187088 TGGAATAGTGTCAATAGGATTGG + Intergenic
1000688606 5:164285725-164285747 TGGAATAGTGTCAATAAGATTGG + Intergenic
1000780051 5:165468941-165468963 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1000861900 5:166465755-166465777 TGGAATAGTGTCAATAGGATTGG + Intergenic
1000943186 5:167388071-167388093 TGGAATAGTGTCAATAGGATTGG + Intronic
1001166963 5:169378022-169378044 TGGAATAGTGTCAATAGGATTGG - Intergenic
1001176882 5:169477878-169477900 TGGAATAGTGTCAATAGGATTGG + Intergenic
1001290996 5:170460276-170460298 TGGAATAGTGTCAGTAGGATTGG - Intronic
1001693489 5:173650881-173650903 TGGAATAGCGTCAATAGGATGGG + Intergenic
1001733431 5:173978060-173978082 TGGAATAGTGTCAATAGTATTGG + Intronic
1002814189 6:663380-663402 TGGAATAGTGTCAAAAGGATTGG - Intronic
1002849075 6:976105-976127 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1003029129 6:2586120-2586142 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1003297187 6:4840964-4840986 TGGAATAGTGTCAATAGGATTGG + Intronic
1003451170 6:6233536-6233558 TGGAATAGTGTCAAAAGGATTGG - Intronic
1003711692 6:8599513-8599535 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1004599662 6:17136133-17136155 TGGAATAGTTTCAGTGGAATTGG - Intergenic
1004711667 6:18177022-18177044 TGGAATAGTGTCAAAAGGATTGG + Intronic
1004777847 6:18868723-18868745 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1004793468 6:19054899-19054921 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1004888826 6:20078021-20078043 TGGAATACTGTCAATAGGATTGG - Intergenic
1005038837 6:21583261-21583283 TGGAATAGTGTCAGTAGGATTGG + Intergenic
1005072794 6:21877778-21877800 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1005435429 6:25805965-25805987 TGGAATAGTTTCAGTAGGATTGG - Intronic
1005691255 6:28308304-28308326 TGGAATAGTGTTAATAGGATTGG + Intergenic
1005700447 6:28395452-28395474 TAGAATAGTAGCAGTGGGAGTGG - Intronic
1005760728 6:28965302-28965324 TGGAATAGCGTCAATAGGATTGG - Intergenic
1005919361 6:30385751-30385773 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1005930040 6:30476395-30476417 TGGAATAGTGTCAGTGGTATAGG - Intergenic
1006199251 6:32272064-32272086 TGGAATAGTGTCAATAGGATTGG - Intergenic
1006274637 6:32993078-32993100 TGGAATAGTTTCAATAGGATTGG + Intergenic
1006286538 6:33100047-33100069 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1007134021 6:39503944-39503966 TGGAATAGTTTCAGTGGGAATGG - Intronic
1008042003 6:46812024-46812046 TGGAATAGTGTCACTAGGATTGG + Intronic
1008190506 6:48451093-48451115 TGAAATAGTGTCAATAGGATTGG - Intergenic
1008208938 6:48697494-48697516 TGGAATAGTTTCAGTGGGATTGG - Intergenic
1008231786 6:48991722-48991744 TGGAATAGTGTCAATAGGATTGG - Intergenic
1008781503 6:55111737-55111759 TGGAATAGTATCAACAGGATTGG - Intronic
1009034630 6:58101730-58101752 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1009045627 6:58234205-58234227 TGGAATAATTTCAATAGGATTGG + Intergenic
1009210105 6:60852228-60852250 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1009221445 6:60988525-60988547 TGGAATAATTTCAATAGGATTGG + Intergenic
1009621350 6:66081937-66081959 TGGAATAGTTTCAATGGGAATGG + Intergenic
1009675650 6:66816307-66816329 TGGAATCGTACATATGGGAATGG - Intergenic
1009799975 6:68524696-68524718 TAGAATAGTATCAGTAGGATTGG + Intergenic
1009969313 6:70609771-70609793 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1010008705 6:71025766-71025788 TGGAATAGTGTCAATAGGATTGG + Intergenic
1010015265 6:71098073-71098095 TGGAATAGTTTCCATAGGATTGG + Intergenic
1010045592 6:71439475-71439497 TGGAATAGTGTCAATAGGATTGG - Intergenic
1010076079 6:71800249-71800271 TGGAATAGTGTCAATAGGATTGG + Intergenic
1010181609 6:73092960-73092982 TGGAATAGTGTCAATAGGACTGG + Intronic
1010458914 6:76090711-76090733 TGGAATAGTGTCAATGGGATTGG + Intergenic
1010531159 6:76968681-76968703 TGGAATAGTTTCACTAGGATTGG - Intergenic
1010647563 6:78410109-78410131 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1010707439 6:79131706-79131728 TGGAATAGTGTCAATAGGATTGG + Intergenic
1010817245 6:80373001-80373023 TGGAATAGTGTCAATAGGATTGG + Intergenic
1010862786 6:80934328-80934350 TAGAATAGTATCAATAGGATTGG + Intergenic
1011132839 6:84069646-84069668 TGGAATAGTGTCAAAAGGATTGG + Intronic
1011321670 6:86101489-86101511 TGGAACAGTCTCAATAGGATTGG + Intergenic
1011328792 6:86180721-86180743 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1011365763 6:86580433-86580455 TGGAATAGTGTCAATAGGATTGG + Intergenic
1011394909 6:86896433-86896455 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1011564592 6:88661758-88661780 TGGAATAGTTTCAGTAGGATTGG - Intronic
1011619845 6:89232577-89232599 TGGAATAGTGCCAATAGGATTGG + Intergenic
1011696381 6:89917460-89917482 GGGAATAGCAGCAATGGGCTAGG + Intergenic
1011789428 6:90882359-90882381 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1011923701 6:92615162-92615184 TGGAATAGTGCCAATAGGATTGG + Intergenic
1011965551 6:93153104-93153126 TGGAATAGTGTCAATAGGATTGG + Intergenic
1012183429 6:96183996-96184018 TGGAATAGTCTCAATAGGATTGG + Intronic
1012208098 6:96486306-96486328 TGGAATAGTGTCAATAGGATTGG + Intergenic
1012538034 6:100323088-100323110 TGGAATAGTTCCAGTAGAATTGG + Intergenic
1012717276 6:102691519-102691541 TGGAATAGTGTCAACAGGATTGG + Intergenic
1012786491 6:103635044-103635066 TGGAATAATGTCAATAGGATTGG - Intergenic
1012800722 6:103824013-103824035 TGGAATAGTTGGAGTGGGATTGG - Intergenic
1012806855 6:103905488-103905510 TGGAATAGTCAGAGTGGGATTGG + Intergenic
1012810649 6:103953029-103953051 TGGAATACTTTCAATAGGATTGG - Intergenic
1012870123 6:104662787-104662809 TGGAATAGTATCAGTAGGATTGG - Intergenic
1012883496 6:104818476-104818498 TGGAATAGTTTGAATGGGAATGG - Intronic
1012923030 6:105239162-105239184 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1013536463 6:111067223-111067245 AGGAATAGTACCTAAGTGATTGG - Intergenic
1013852354 6:114531505-114531527 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1013985264 6:116184442-116184464 TGAAATAGTGTCAATTGGATTGG + Intronic
1014278331 6:119413285-119413307 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1014285336 6:119490755-119490777 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1014306667 6:119751388-119751410 TGGAGTCGTTCCAGTGGGATTGG + Intergenic
1014421282 6:121248892-121248914 TGGAATAGTTTCAGTAGGATTGG - Intronic
1014566828 6:122959511-122959533 TGAAATAGTATCAATAGAATTGG - Intergenic
1014973346 6:127846726-127846748 TGGAATAGTTTCAGTAGGATTGG - Intronic
1015196702 6:130531418-130531440 TGGAATAGTGTCAATAGGATTGG - Intergenic
1015222445 6:130819849-130819871 TGGAAAAGTGTCAATGGGATTGG - Intergenic
1015257332 6:131193608-131193630 TGGAGTAGTTTCAATAGGATTGG + Intronic
1015348131 6:132183679-132183701 TGGAATAGTGTCAATAGGATTGG - Intergenic
1015663020 6:135597287-135597309 TGAAATAGCATCAATAGGATTGG + Intergenic
1015849407 6:137556367-137556389 TGGAATAGTGTCAATAGGATTGG + Intergenic
1016496788 6:144672210-144672232 TGGAATAGTGTCAATAGGATTGG + Intronic
1016696923 6:147006996-147007018 GGGAATAGTTTCAATAGGATTGG - Intergenic
1017214654 6:151896236-151896258 TGGAATAGTGTCAATAGGATTGG + Intronic
1017221620 6:151972241-151972263 TGGAATAGTTTCAGTAGGATTGG - Intronic
1018168468 6:161123780-161123802 TGGAATAGTGTCGATAGGATTGG + Intergenic
1018353243 6:162985143-162985165 TGGAATAGTGTCAATATGATTGG - Intronic
1018555572 6:165046840-165046862 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1018597050 6:165492295-165492317 TGGAATAGTGTCAACAGGATTGG - Intronic
1018665967 6:166138562-166138584 TGGAATAGTATCAACAGGATTGG - Intergenic
1018755553 6:166846298-166846320 TGGAATAGTGTCAATAGGCTTGG - Intronic
1019865502 7:3706319-3706341 TGGAATAGTTTCAGTAGGATTGG + Intronic
1020348767 7:7194727-7194749 TGGGATAGTGTCAATAGGATTGG + Intronic
1020455581 7:8370390-8370412 TGGAATAGTTTCAATAGGATTGG + Intergenic
1020608843 7:10370333-10370355 TGGAATAGTGTCAATAAGATTGG - Intergenic
1020635195 7:10688139-10688161 TAGAATAGTGTCAATAGGATTGG - Intergenic
1020861086 7:13492688-13492710 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1021042399 7:15878106-15878128 TGGAACAGTTTCAATGGAATGGG + Intergenic
1021339999 7:19453361-19453383 TGGAATAGTGTCAATAGGATTGG + Intergenic
1021473803 7:21037255-21037277 TGGAGTAGTGTCAATAGGATTGG + Intergenic
1021641296 7:22739589-22739611 TGGAATAGTATGAGTAGGATTGG - Intergenic
1021791047 7:24205854-24205876 TGGAATTGAAGCCATGGGATGGG + Intergenic
1021929152 7:25562334-25562356 TTGAATAGTAGCCATGGGAAAGG - Intergenic
1022295637 7:29049603-29049625 TGGAATAGTATTAAAAGGATTGG - Intronic
1023211648 7:37812005-37812027 TGGAATAGTTTCAGTGGGAGTGG - Intronic
1023692811 7:42809303-42809325 TTGAATAGTGTTAATGGGATTGG - Intergenic
1023701567 7:42896678-42896700 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1024165746 7:46728133-46728155 TGGAATAGTATCAATAAGAATGG - Intronic
1024175023 7:46830760-46830782 TGGAATAGTATCAATAGGATTGG - Intergenic
1024304764 7:47919460-47919482 TGGAATAGTGTCAATAGGATTGG - Intronic
1024327730 7:48124084-48124106 TGGAATAGTGTCAATAGGATTGG + Intergenic
1024367037 7:48532555-48532577 TAGAATAGTGTCAATAGGATTGG + Intronic
1024452754 7:49566656-49566678 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1024621862 7:51166542-51166564 TGGAATAGTTTGAATAGGATTGG - Intronic
1025772009 7:64517535-64517557 TGGAATAGTGTCAATAGGATTGG - Intergenic
1025773199 7:64532612-64532634 TGGAATAGTGTCAATAGGATTGG - Intronic
1025794512 7:64726216-64726238 TGGAGTAGTGTCAATAGGATTGG + Intergenic
1025857623 7:65296822-65296844 TGGAATAGTGTCAATAGGATTGG + Intergenic
1027328687 7:77068253-77068275 TGGAATAGTGTCAATAGGATTGG + Intergenic
1027350070 7:77302735-77302757 TGGAATAGTGTCAAAAGGATTGG + Intronic
1027562914 7:79754675-79754697 TGGAATAGTATCAATAGGATTGG + Intergenic
1027699522 7:81452490-81452512 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1027732974 7:81899382-81899404 TGGAATAGTGTCAATAGGATTGG + Intergenic
1027838332 7:83275246-83275268 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1027980383 7:85212136-85212158 TCTAATAGTACAAATGGTATAGG + Intergenic
1028198076 7:87930347-87930369 TGGAATAGTGTCAATAGGATTGG - Intergenic
1028250674 7:88536332-88536354 TGGAATAATGTCAATAGGATTGG + Intergenic
1028261949 7:88677363-88677385 TGGAATAGTATCAATAGCATTGG - Intergenic
1028644779 7:93083364-93083386 TGGAATAGTTTCAATAAGATTGG - Intergenic
1028787261 7:94809636-94809658 TGGAATAGTTCCAAGAAGATTGG - Intergenic
1028792619 7:94870092-94870114 TGGAATAGTGCCAATTGAATTGG + Intergenic
1028818588 7:95178965-95178987 TGGAATTGTGTCAATAGGATTGG - Intronic
1028936584 7:96471298-96471320 TGTAATAGTGTCAATAGGATTGG + Intergenic
1028993126 7:97071711-97071733 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1029787079 7:102803119-102803141 CGGAATAGTGTCAATAGGATTGG - Intronic
1029806199 7:102999468-102999490 TGGAATAGTTTCAATAGAATTGG + Intronic
1030326036 7:108219294-108219316 TGGAATAGTGTCAAAAGGATTGG - Intronic
1030390154 7:108917899-108917921 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1030440742 7:109585859-109585881 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1030575137 7:111276499-111276521 TGGAATAGTTCCAAGAGGATTGG + Intronic
1030972593 7:116078772-116078794 TGGAATAGTGTCAGTAGGATGGG - Intronic
1030990668 7:116295863-116295885 TGGAATAGTTTCAATAGGGTTGG - Intronic
1031066331 7:117109633-117109655 TGGAATAGGGTCAATAGGATTGG - Intronic
1031139164 7:117922450-117922472 TGGACTAGTGTCAATAGGATTGG - Intergenic
1031261623 7:119528248-119528270 TGGAATAGTGTCAATAGAATTGG - Intergenic
1031740277 7:125420954-125420976 TGGAATAGTGTCAATAGGATTGG - Intergenic
1031760964 7:125712757-125712779 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1031879511 7:127180436-127180458 TGGAATAGTGTCAAAAGGATTGG - Intronic
1031888759 7:127269439-127269461 TGGAATAGTTTCAATAGGAATGG + Intergenic
1032290330 7:130583900-130583922 TGGAATAGTTTCAAAAGGATTGG - Intronic
1032604999 7:133340579-133340601 TGGATTAGTGTCAATAGGATTGG + Intronic
1032922347 7:136563847-136563869 TGGAATAGTGTCAATAGGATTGG + Intergenic
1033022858 7:137744484-137744506 TGGAAGAGTATCAGTAGGATTGG - Intronic
1033027104 7:137785562-137785584 CGGAATAGTGTCAATAGGATTGG - Intronic
1033623224 7:143081488-143081510 TGGAATAGTGTCAATAGGATTGG - Intergenic
1033721679 7:144066293-144066315 TGGAATAGTGTCAAAAGGATGGG + Intergenic
1034247516 7:149658890-149658912 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1034366572 7:150554719-150554741 TGGAATAGTTTCAGTGGGAATGG - Intergenic
1035138723 7:156735301-156735323 TTGAATTCTACCAATGTGATGGG + Intronic
1035151508 7:156877340-156877362 TGGAATAGTGTCGATAGGATTGG - Intronic
1037154321 8:15681227-15681249 TGGAATAGTTTCAGTAGGATTGG + Intronic
1037293632 8:17378085-17378107 TAGAATACTACCATTGAGATGGG + Intronic
1037337967 8:17810159-17810181 TGGAATAGTTTCAATAGCATTGG - Intergenic
1037560303 8:20067744-20067766 TGGAATAGTGTCAATAGGATTGG + Intergenic
1037713318 8:21373413-21373435 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1037865047 8:22436733-22436755 TGGGAAAGCACCAATGCGATGGG + Intergenic
1038121523 8:24621870-24621892 TGGAATAGTGTCAATAGGATTGG - Intergenic
1039000875 8:32978991-32979013 TGGAATAGTGTCAATAGAATTGG - Intergenic
1039030387 8:33302760-33302782 TGGAATAGTGTCAATAGAATTGG - Intergenic
1039264758 8:35812622-35812644 TGGAATAGTTTCAGTGGGAATGG - Intergenic
1039653439 8:39371206-39371228 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1039810229 8:41040883-41040905 TGGAATAGTGTCAATAAGATTGG + Intergenic
1040442539 8:47459193-47459215 TGTAATAGTGTCAATAGGATTGG + Intronic
1040820422 8:51550274-51550296 TGGAATAGTTTCAGTAGGATTGG - Intronic
1041150596 8:54929019-54929041 TGGAATAGTGTCAATAGGATTGG - Intergenic
1041295260 8:56350639-56350661 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1041611695 8:59857621-59857643 TGGAATAGTTTCAATAGGAATGG - Intergenic
1041897415 8:62941338-62941360 TGGAATAGTGTCAATAGTATTGG - Intronic
1042088898 8:65137042-65137064 TGGAATAGTGTCAATAAGATTGG - Intergenic
1042160857 8:65893529-65893551 TGGAATAGTGTCAGTAGGATTGG - Intergenic
1042572273 8:70178508-70178530 TGGAACAGTGACACTGGGATGGG + Intronic
1042770678 8:72378019-72378041 TGGAATAGTTTCCATAGGATTGG - Intergenic
1043121379 8:76329483-76329505 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1043556401 8:81435514-81435536 TGGAACAGTGTCAATAGGATTGG + Intergenic
1043568533 8:81574505-81574527 TAGAATAGTGTCAATAGGATCGG + Intergenic
1043628190 8:82290876-82290898 TGGAATAGTGTCAGTAGGATTGG + Intergenic
1043642125 8:82467530-82467552 TGGAATAGAGTCAATAGGATTGG - Intergenic
1043672060 8:82898808-82898830 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1043679169 8:83000205-83000227 TTGAATAGTGTCAATAGGATTGG - Intergenic
1043717315 8:83503850-83503872 TGGAATAGTTTCGGTGGGATTGG + Intergenic
1043819633 8:84846566-84846588 TGGAATAGTTTCAGTTGGATTGG + Intronic
1043876094 8:85488098-85488120 TGGAATAGTGTCAATAGGATTGG + Intergenic
1043967783 8:86498347-86498369 TGGAATAATTTCAATAGGATTGG - Intronic
1043988167 8:86718606-86718628 TAGAATAGTGTCAATAGGATTGG - Intronic
1044227894 8:89740115-89740137 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1044292160 8:90485431-90485453 TGGAAGAGTGGCAATAGGATTGG - Intergenic
1044368056 8:91373777-91373799 TGGAATAGTTTCAATGAGCTTGG + Intronic
1044657066 8:94559442-94559464 TGGAATAGTTTCAATAGGATTGG + Intergenic
1044907525 8:97020810-97020832 TGGAATAGTGTCAATAGAATTGG - Intronic
1044947598 8:97404916-97404938 TGGAATAGTGTCAGTAGGATTGG + Intergenic
1045121920 8:99047080-99047102 TGGAATACTGTCAATAGGATTGG + Intronic
1045671300 8:104556703-104556725 TGGAATAGTGTTAATGGGATTGG - Intronic
1046075680 8:109309048-109309070 TGGAATAGTGTCAATAGGATTGG - Intronic
1046140615 8:110085243-110085265 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1046144235 8:110136509-110136531 TGGAATAGAACCACAGAGATGGG - Intergenic
1046345359 8:112917725-112917747 TAGAATAGTGACAATGGGAATGG + Intronic
1046455203 8:114450150-114450172 TGGAAACATACTAATGGGATGGG + Intergenic
1046467507 8:114625420-114625442 TGAAATAGTGTCAATAGGATTGG + Intergenic
1047032653 8:120899525-120899547 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1047148106 8:122228905-122228927 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1047530825 8:125673408-125673430 TGGAATAGTATCAAAAGGATTGG + Intergenic
1047606963 8:126484516-126484538 TGGAATAGTGTCAATAAGATTGG + Intergenic
1047901547 8:129427900-129427922 TGGAATAGTGTCAATCAGATTGG + Intergenic
1047939226 8:129812278-129812300 TGGAATAGTTCCAATAGAATTGG + Intergenic
1048101603 8:131358153-131358175 TGAAATAGTTTCAGTGGGATTGG + Intergenic
1050133349 9:2436224-2436246 TGGAATAGCATCAATAGGATTGG + Intergenic
1050428833 9:5540801-5540823 TGGAATAGTGTCAATAGAATTGG - Intronic
1050503099 9:6319058-6319080 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1050972423 9:11894396-11894418 GGGAAAAGTTTCAATGGGATTGG + Intergenic
1050988064 9:12108035-12108057 TGGAATAGTGTCAATAGTATTGG - Intergenic
1051313631 9:15804807-15804829 TGGAATAGTTTCAGTGGGAATGG + Intronic
1051601084 9:18874819-18874841 TGGAATAGTTTCAGTAGGATTGG + Intronic
1051687382 9:19672107-19672129 TGGAATAGTGTCAATAGGATTGG + Intronic
1051733483 9:20172786-20172808 TGAAATAGTGTCAATAGGATTGG - Intergenic
1051735488 9:20193978-20194000 AGGAATAGAATCAATGGAATAGG + Intergenic
1051816666 9:21116303-21116325 TGGAATAGTGTCAATAGGATTGG + Intergenic
1051819376 9:21146686-21146708 TGGAATAGTTTCAATAGGATTGG + Intergenic
1052006382 9:23354531-23354553 TGGAATAGTGTCAATAAGATTGG + Intergenic
1052253841 9:26430288-26430310 TGGAATAGTATCAGTAGGATTGG - Intergenic
1052537448 9:29765208-29765230 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1052549993 9:29935813-29935835 TGGAATAGTGTCAATAGGATTGG + Intergenic
1052624623 9:30959244-30959266 TGGAATAGTGTCAATAGGATTGG + Intergenic
1052694393 9:31857439-31857461 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1052711589 9:32063281-32063303 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1054933418 9:70660872-70660894 TGGAATAGTTTCAGTAGGATTGG - Intronic
1054940779 9:70739070-70739092 TGAAATAATATCAATAGGATTGG - Intronic
1055138188 9:72847505-72847527 TGAAATAGTGTCAATAGGATTGG - Intergenic
1055181881 9:73398300-73398322 TGGAATAGTTTCAGTCGGATTGG + Intergenic
1055186868 9:73467541-73467563 TTGAATAGTGTCAATAGGATTGG + Intergenic
1055244883 9:74227890-74227912 TGGAATAGTGTCAACAGGATTGG - Intergenic
1055531653 9:77190632-77190654 TGGAATAGTTTCAATAGGATTGG + Intronic
1055656682 9:78457188-78457210 TGGAATAGTGTCAATAGGATTGG - Intergenic
1055811350 9:80151907-80151929 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1055846809 9:80575206-80575228 TGGAATAGTTTCAATAGGATTGG - Intergenic
1056309712 9:85327599-85327621 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1056322437 9:85448939-85448961 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1056396996 9:86190967-86190989 TGGAATAGTGTCAATAGGAGTGG - Intergenic
1056447265 9:86678037-86678059 TGGAATAGGACAAGTGGGAGAGG - Intergenic
1056582452 9:87902030-87902052 TGGAATAGTGTCAATAGAATTGG - Intergenic
1056696476 9:88859450-88859472 TGGAATAGTCTCAATAGGACTGG - Intergenic
1057004126 9:91541374-91541396 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1057340158 9:94193525-94193547 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1058156434 9:101521267-101521289 TGGAATAGTGTCAAAAGGATTGG + Intronic
1058228135 9:102392276-102392298 TGGAATAGTGTCAATAGGATTGG + Intergenic
1058233882 9:102464944-102464966 TGGAATAGTGTCAATAGGATTGG - Intergenic
1058246238 9:102629011-102629033 TGGAATAGTTTCAATAGGATTGG + Intergenic
1058343114 9:103921845-103921867 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1058410756 9:104728539-104728561 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1058540406 9:106006184-106006206 TGGAATAGTGTCAATAGGACTGG + Intergenic
1058916490 9:109571569-109571591 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1059032963 9:110720680-110720702 TGGAATAGTGTCAATAGGATTGG - Intronic
1059075148 9:111185206-111185228 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1059674051 9:116520094-116520116 TGGAATAGTGTCAATAGCATTGG - Intronic
1060383534 9:123200467-123200489 TGGAATAGTTTCAGTAGGATTGG + Intronic
1061790412 9:133056088-133056110 TGGAAGAGTACGTATGGGAGGGG + Exonic
1062489302 9:136797064-136797086 TAGAATAGAACGAATGGGAATGG - Intronic
1062705749 9:137940506-137940528 TGGAATAGTGTCGATAGGATTGG - Intronic
1062713905 9:137993786-137993808 TGGAATAGTGTCGATAGGATTGG - Intronic
1203725478 Un_GL000216v2:46163-46185 TGGAATGGCACCGAAGGGATTGG - Intergenic
1203636071 Un_KI270750v1:113247-113269 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1186308716 X:8293482-8293504 TGGAATAGTGTTAATAGGATTGG - Intergenic
1186495537 X:10010124-10010146 TGGAACAGAACCCATGGGAAGGG + Intergenic
1187325490 X:18282883-18282905 TGGAATAGTTTCAGTAGGATTGG - Intronic
1187589131 X:20696743-20696765 TGGAATAGTGTCAATAGGATTGG - Intergenic
1187601518 X:20837530-20837552 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1187749055 X:22441588-22441610 TGGAATAGTGTCAAGAGGATTGG - Intergenic
1187776977 X:22771250-22771272 TGGAATAGTGTCAAGAGGATTGG - Intergenic
1187803969 X:23097638-23097660 TGGAATAATTTCAATCGGATTGG - Intergenic
1187848973 X:23572079-23572101 TGGAATAATGTCAATAGGATTGG - Intergenic
1188040234 X:25363149-25363171 TGGAATAGTGTCAATAGGATTGG + Intergenic
1188045594 X:25422906-25422928 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1188389085 X:29597597-29597619 TGGAATAGTGTCGATAGGATTGG + Intronic
1188848690 X:35105428-35105450 TGGAATAGTTTCAGTGTGATTGG - Intergenic
1188941616 X:36244800-36244822 TGGAATAGTTTCAGTAGGATTGG - Intronic
1188961576 X:36499606-36499628 GGGAATAGTTTCAATGTGATTGG + Intergenic
1189218905 X:39353476-39353498 TGGAATAGTGTCAATAGGATTGG + Intergenic
1189653426 X:43214671-43214693 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1189659548 X:43282388-43282410 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1189774814 X:44461252-44461274 GGGAACAGAACCAATGGGAGAGG + Intergenic
1189889917 X:45590208-45590230 TGGAATAGTTCGAGTAGGATTGG + Intergenic
1189929562 X:45994457-45994479 TGGAATAGTTTGAATAGGATTGG + Intergenic
1189958024 X:46296112-46296134 TGGACTAGTTCCAAAGTGATAGG + Intergenic
1190429518 X:50365717-50365739 TGGAATGGTGCTAATGGGTTTGG + Exonic
1190895169 X:54610901-54610923 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1190899419 X:54655252-54655274 TGGAATAGTTTGAATAGGATTGG - Intergenic
1191030523 X:55964995-55965017 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1191046017 X:56137813-56137835 TGGTATGGTAGCATTGGGATTGG - Intergenic
1191067419 X:56364989-56365011 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1191100542 X:56722475-56722497 TGGAACAGTGTCAATAGGATTGG - Intergenic
1191139572 X:57102860-57102882 TGGAATAGTGTCAATAGGATTGG - Intergenic
1191164645 X:57375275-57375297 TGGAATAGCATCAATAGGATTGG + Intronic
1191629417 X:63305481-63305503 TGGAATAGTGTCAATAGAATTGG + Intergenic
1191679124 X:63823996-63824018 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1191888626 X:65917105-65917127 TGGAATAGTGTCAATAGGATTGG + Intergenic
1191906003 X:66090827-66090849 TGGAATAGTGTCAATAGCATTGG + Intergenic
1191944967 X:66523499-66523521 TGGAATAGTGTCAATAGGATTGG + Intergenic
1191954455 X:66628779-66628801 TGGAATAGTGCCAAAAGGATTGG - Intronic
1192010426 X:67264773-67264795 TGGAATAGTTTCATTAGGATTGG + Intergenic
1192014185 X:67311232-67311254 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1192164245 X:68816154-68816176 TGGAATAGTGTCAATAGGCTTGG - Intergenic
1192432966 X:71125135-71125157 GGGAATAGTACCTGGGGGATGGG - Exonic
1192609987 X:72558178-72558200 TGGAATAGTGTCAATAAGATTGG - Intronic
1192673744 X:73172612-73172634 TGGAATAGTGTCAATAGGATTGG + Intergenic
1192688040 X:73327835-73327857 TGGAATAGTGTCAATAGGATTGG + Intergenic
1192690970 X:73363731-73363753 TAGAATAGTGTCAATAGGATTGG + Intergenic
1192876886 X:75239538-75239560 TGGAATAGTTATAATAGGATTGG - Intergenic
1192878412 X:75256957-75256979 TGGAATAGTGTCAGTAGGATTGG - Intergenic
1192913315 X:75628601-75628623 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1192951141 X:76017910-76017932 TGAAATAGTATCAATAAGATTGG - Intergenic
1192978509 X:76313537-76313559 TGGAATAGTATCAAAAGGATTGG + Intergenic
1192987197 X:76412523-76412545 TGGAATAGTGTCAATAGGATTGG - Intergenic
1192994808 X:76501904-76501926 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1193015662 X:76730702-76730724 TGGAATAGTATCAAATAGATTGG - Intergenic
1193155002 X:78162773-78162795 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1193182479 X:78474408-78474430 TGGAATAGTGTCAATAGGATTGG + Intergenic
1193185812 X:78511066-78511088 TGAAATAGTGTCAATAGGATTGG - Intergenic
1193197203 X:78646734-78646756 TGGAATAGTATCAATAGGATTGG - Intergenic
1193208403 X:78776452-78776474 TGGAATAATGTCAATAGGATTGG + Intergenic
1193225129 X:78973473-78973495 TGGAATAGTTCCAGTAAGATTGG + Intergenic
1193237040 X:79120041-79120063 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1193359792 X:80567924-80567946 TGGAATAGTTTCAATGGGAGTGG + Intergenic
1193369390 X:80676486-80676508 TGGAAAAGCACCAATGTGAAAGG + Exonic
1193423490 X:81312981-81313003 TGGAATAGTGTCAATAGGATTGG + Intergenic
1193429576 X:81384769-81384791 TGGAATAGTACCAATAAGAATGG + Intergenic
1193517590 X:82488454-82488476 TGGAATAGTGTCAATAGGATTGG - Intergenic
1193638967 X:83988185-83988207 TGGAATAGTTGCAGTGGGAATGG - Intergenic
1193689754 X:84626483-84626505 TGGAATAGTTTCAATAGGATTGG + Intergenic
1193690716 X:84638449-84638471 TGGAATAGTGTCAATAGGACTGG - Intergenic
1193697560 X:84727305-84727327 TGGAATAGTTTCAATAGAATGGG + Intergenic
1193736887 X:85167729-85167751 TGGAATAGTTTCAATAGGAGTGG - Intergenic
1193775119 X:85631805-85631827 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1193775703 X:85638786-85638808 TGGAATAGAGTAAATGGGATTGG + Intergenic
1193776221 X:85645576-85645598 TGGAATAATTTCAGTGGGATTGG - Intergenic
1193788262 X:85787151-85787173 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1193791920 X:85824995-85825017 TGGAATAGTGTCAGTAGGATTGG - Intergenic
1193950686 X:87794311-87794333 TGAAATAGTGTCAATAGGATTGG + Intergenic
1193966597 X:87994902-87994924 TGGAATAGTGTCAGTAGGATTGG + Intergenic
1193979652 X:88166198-88166220 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1194012279 X:88577090-88577112 TGGAATAGTGTCAATAGGATTGG + Intergenic
1194028165 X:88779954-88779976 TGGAATAGTGTCAATAGGATTGG + Intergenic
1194058657 X:89168919-89168941 TGGAATAATTTCAATAGGATTGG - Intergenic
1194095027 X:89628875-89628897 TGGAACAGTGTCAATAGGATTGG + Intergenic
1194104293 X:89749729-89749751 TGGAATAGCGTCAATAGGATTGG + Intergenic
1194175103 X:90636333-90636355 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1194224653 X:91241396-91241418 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1194337822 X:92669820-92669842 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1194348679 X:92797971-92797993 CGGAATAGTTTGAATGGGATTGG - Intergenic
1194373649 X:93106287-93106309 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1194381369 X:93195737-93195759 TGTAATAGTGTCAATAGGATTGG - Intergenic
1194468442 X:94261325-94261347 TGGAATAGTGCTAATAGGATTGG - Intergenic
1194547402 X:95254557-95254579 TGGAATAGTGTCAATAGAATTGG + Intergenic
1194602383 X:95938284-95938306 TGGAATAGTGTCAATAAGATTGG + Intergenic
1194617169 X:96119714-96119736 TGGAATAGTGTCAATAGGATTGG - Intergenic
1194630551 X:96277724-96277746 TGGAATAGTGTCAATAGTATTGG - Intergenic
1194770175 X:97893666-97893688 TGGAATAGTGTCAGTAGGATTGG + Intergenic
1194906652 X:99585313-99585335 TGGAATAGTGTCAATAGGATTGG - Intergenic
1194907034 X:99590590-99590612 TGGAATAGTGTCAATAGGATTGG + Intergenic
1194926382 X:99829964-99829986 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1194955850 X:100179690-100179712 TGGAATAGTGTCAAAGGGATTGG - Intergenic
1194967627 X:100306987-100307009 TGGAATAGTGTTAATAGGATTGG - Intronic
1195015791 X:100779166-100779188 TGGAATAGCATCAAAAGGATAGG + Intergenic
1195231688 X:102856127-102856149 TAGAATAGTGTCAATAGGATTGG + Intergenic
1195237383 X:102914742-102914764 TGGAATAGTGTCAATAGGATTGG - Intergenic
1195556656 X:106234671-106234693 TGGAATAGTGTCAGTAGGATTGG - Intergenic
1195643371 X:107202080-107202102 TGGAAAAGTATCTCTGGGATGGG + Intronic
1195663981 X:107411560-107411582 TGGAATAGTTTCAAGAGGATTGG + Intergenic
1195838565 X:109147204-109147226 TGGAATAGTGTCAATAGAATTGG - Intergenic
1195855260 X:109324800-109324822 TGGAATAGTGTCAATAGGATTGG + Intergenic
1195975954 X:110527026-110527048 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1195984877 X:110618589-110618611 TGGAATAGTGCCAATAGGATTGG + Intergenic
1196024433 X:111025731-111025753 TGGAATAGTATGAATAGGATTGG - Intronic
1196231741 X:113232168-113232190 TGGAATAGTACTAGGGGGCTGGG - Intergenic
1196361873 X:114870475-114870497 TGGAATAGTTTGAATAGGATTGG + Intronic
1196477788 X:116108882-116108904 TGGAATAGTTTCAATAAGATTGG + Intergenic
1196519079 X:116651498-116651520 TTGAATAGTGCCAATAAGATTGG + Intergenic
1196599079 X:117580747-117580769 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1196860547 X:120023448-120023470 TGGAATACTGCCAACGAGATCGG - Intergenic
1196935175 X:120723163-120723185 TGGAATAGTGTCAATAGGATTGG + Intergenic
1196947938 X:120846830-120846852 TGGAATAGTGTCAGTAGGATTGG + Intergenic
1197081483 X:122423295-122423317 TGGAATAGTGTCAATAGAATTGG + Intergenic
1197132750 X:123023571-123023593 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1197145176 X:123164243-123164265 TGGAATAGTATCAGTAGGATTGG - Intergenic
1197393036 X:125892184-125892206 TGGAATATTGTCAATAGGATTGG + Intergenic
1197398854 X:125963852-125963874 TGGAATAGTTCCAGTAGAATTGG - Intergenic
1197476030 X:126926516-126926538 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1197511664 X:127376796-127376818 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1197518059 X:127461253-127461275 TGGAATAGTTTCAATAGGAATGG + Intergenic
1197545544 X:127819474-127819496 TGGAATAGTATAAATAGGATTGG - Intergenic
1197571907 X:128160045-128160067 TGTAATAGTGTCAATAGGATTGG + Intergenic
1197575959 X:128211819-128211841 TGGAATAGTGTTAATAGGATTGG - Intergenic
1197591365 X:128414943-128414965 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1197611779 X:128647396-128647418 TGGAATAGTGTCAACTGGATTGG - Intergenic
1197668788 X:129252782-129252804 TGGAATAGTGTCAAAAGGATTGG + Intergenic
1197677972 X:129351278-129351300 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1197911271 X:131485255-131485277 TGGAATAGTGCCAATAGGATTGG - Intergenic
1198559599 X:137834783-137834805 TGGAATAATGTCAATAGGATTGG + Intergenic
1198604220 X:138318980-138319002 TGAAATAGTGTCAATAGGATTGG + Intergenic
1198665029 X:139011242-139011264 TGTAATAGTGTCAATAGGATTGG - Intronic
1198796849 X:140406363-140406385 TTGAATAGTGTCAATAGGATTGG + Intergenic
1198995813 X:142572474-142572496 TGGAATAGTTTCAATAGTATTGG - Intergenic
1199011077 X:142759656-142759678 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1199048995 X:143212949-143212971 TGGAATAGTGTCAATATGATTGG + Intergenic
1199407735 X:147482439-147482461 TGGAATAGTTTCAATAGAATTGG + Intergenic
1199556275 X:149112772-149112794 TGGAATAGTTGCAGTAGGATAGG - Intergenic
1199668842 X:150124401-150124423 TGGAATAGTGTCAAAAGGATTGG - Intergenic
1199786278 X:151108491-151108513 TGGAATAGTTTCAATAGGAATGG + Intergenic
1200317812 X:155152374-155152396 TGGAATAGTGTCAATAGGATTGG + Intergenic
1200332985 X:155317650-155317672 TGGAATAGTGTCAATAGGATTGG - Intronic
1200361062 X:155607058-155607080 TGGAATAGTTTCAATAGGAATGG - Intronic
1200447661 Y:3285054-3285076 TGGAACAGTGTCAATAGGATTGG + Intergenic
1200456252 Y:3397508-3397530 TGGAATAGCATCAATAGGATTGG + Intergenic
1200474284 Y:3625460-3625482 TGGAATAGTTTCAATAGGATTGG + Intergenic
1200521750 Y:4217306-4217328 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1200561115 Y:4704706-4704728 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1200646233 Y:5786560-5786582 TGGAATAGTTTCAGTAGGATTGG - Intergenic
1200657006 Y:5914594-5914616 CGGAATAGTTTGAATGGGATTGG - Intergenic
1200681674 Y:6220322-6220344 TGGAATAGTTTCAGTAGGATTGG + Intergenic
1201112189 Y:10807649-10807671 TGGAATAGAATCAAGGGGAGTGG - Intergenic
1201130616 Y:10949222-10949244 TGGAATAGAATGAAAGGGATAGG - Intergenic
1201195601 Y:11491779-11491801 TGGAATAGAATCAAAAGGATTGG + Intergenic
1201214183 Y:11707669-11707691 TGGAATAGAATCAAAGGGAATGG + Intergenic