ID: 1086301837

View in Genome Browser
Species Human (GRCh38)
Location 11:85434767-85434789
Sequence AACTGTTTGGAATAGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086301837_1086301841 13 Left 1086301837 11:85434767-85434789 CCCTCAGACTATTCCAAACAGTT 0: 1
1: 0
2: 2
3: 12
4: 147
Right 1086301841 11:85434803-85434825 TTCTCCCAGCTCATTTTATGAGG 0: 1
1: 1
2: 13
3: 109
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086301837 Original CRISPR AACTGTTTGGAATAGTCTGA GGG (reversed) Intronic
901333621 1:8429713-8429735 AACTGTTTGGAAAACACTGTAGG + Intronic
901549533 1:9985495-9985517 AACAGTTTGTGGTAGTCTGATGG + Exonic
903437342 1:23360625-23360647 AACTCTTTGGCTTAGTCAGAAGG - Exonic
907057378 1:51382834-51382856 AATTTTTTGGAAGAGTTTGAGGG - Intronic
910409586 1:86926137-86926159 CACTGGGTGGAATACTCTGAAGG - Intronic
912148689 1:106828370-106828392 AACTTTTTGGAAAGGTTTGAAGG - Intergenic
916584524 1:166138953-166138975 AACTGTCTGGAATTATTTGAGGG - Intronic
916698424 1:167264773-167264795 AACTGTCTAGAATAGGCTGTTGG - Intronic
916924621 1:169504919-169504941 TATTGTTTGGAATAGTTTCAGGG - Intergenic
918642619 1:186861615-186861637 AACTTTTTGGGATTGTCTGGAGG - Intronic
922280190 1:224115707-224115729 CACTGTTTGTAAAAATCTGAAGG - Intronic
1062808679 10:445229-445251 AACTGTTGTGAAGAGTCTCATGG + Intronic
1062808758 10:446339-446361 AACTGTTGTGAAGAGTCTCATGG + Intronic
1066168203 10:32811666-32811688 AATTTTTTGGAATAGTTTGAGGG - Intronic
1068412795 10:56679225-56679247 AACTGATTGGAACAGTTTGGAGG - Intergenic
1071858414 10:89648446-89648468 AAATGTTTGGAAGAGAGTGAGGG + Intergenic
1072504054 10:96046378-96046400 CACTGTTTGTAATACACTGAAGG + Intronic
1073930594 10:108569843-108569865 AATTGTTTTGAATAATTTGAAGG + Intergenic
1074881618 10:117663917-117663939 AAGTGTTTGCAATAGTTAGAAGG + Intergenic
1076609760 10:131716215-131716237 AGGTGTTTGTAATAGTCTCAGGG + Intergenic
1076701097 10:132273183-132273205 CACTGCTTTGAATAGGCTGACGG + Intronic
1077127607 11:949305-949327 AACTCTTTGGAAAAGTAGGAGGG + Intronic
1082588466 11:54973777-54973799 AGATGTTTGGAAGAGTATGAAGG + Intergenic
1082796101 11:57379028-57379050 AAGTGTTTGGAATAGTCACTGGG - Intronic
1085577461 11:77619813-77619835 CTCTTTTTGGAAAAGTCTGAAGG + Intronic
1086301837 11:85434767-85434789 AACTGTTTGGAATAGTCTGAGGG - Intronic
1086821132 11:91437534-91437556 ATCTGGTTGGCATAGCCTGAGGG - Intergenic
1090608390 11:128448738-128448760 ACCTGTTTGGAATGGGCTGTGGG + Intergenic
1091107811 11:132939147-132939169 ATTTGTTTTGAATAGTCTAATGG + Intronic
1092206454 12:6617156-6617178 AACTGTGTGGAATAAACTGTAGG - Intergenic
1092690512 12:11104272-11104294 AACAATTTGGGATAGTCAGAAGG - Intronic
1094862138 12:34479645-34479667 AAGTGTTTGTAGTACTCTGATGG - Intergenic
1098776938 12:74632241-74632263 AAGTGTTTGTAATGGTCTGGGGG + Intergenic
1098937299 12:76495067-76495089 AACAGTTTGGAATAGAGAGAAGG - Intronic
1101140201 12:101787974-101787996 AAGTGTTTTTAAAAGTCTGATGG + Intronic
1104197602 12:126555955-126555977 TACTGTTTGGAATAACCTAAGGG - Intergenic
1105428787 13:20318302-20318324 TGCTGTGTGGAATAGTATGACGG - Intergenic
1111884035 13:93996194-93996216 AAATTTTTGGAATAGTATAATGG + Intronic
1114818956 14:25992966-25992988 AATTATTTGGAATAGTCAAAAGG - Intergenic
1115890814 14:38026521-38026543 AAGTGTTTGTAATAGTCTCAGGG - Intronic
1118035908 14:61865476-61865498 AACAGTTTGGAATATTGTGGGGG + Intergenic
1121784467 14:96645852-96645874 AACTTTTTGGAATAGTTTGAGGG + Intergenic
1124571292 15:30866541-30866563 TACTGTGTGGAATACTATGATGG + Intergenic
1126238436 15:46412915-46412937 CACTTCTTAGAATAGTCTGAGGG - Intergenic
1127279044 15:57473160-57473182 AACTGTTTGCAATATTATGGTGG - Intronic
1131767666 15:95697570-95697592 AAATATGTGGAATATTCTGAGGG - Intergenic
1135396170 16:22133117-22133139 AACTGTTTGGAATGAGCTGAAGG - Intronic
1135461595 16:22648617-22648639 TCCTATTTGGAATATTCTGATGG + Intergenic
1138173493 16:54874995-54875017 AACTGTCTGGTAAACTCTGAAGG + Intergenic
1140072118 16:71659742-71659764 AACTATTTGTAATAACCTGAAGG - Intronic
1142910456 17:3085434-3085456 AACTTTTTGGATGAGTCTGCAGG + Intergenic
1149484907 17:57035017-57035039 GATTGTTTGGAGGAGTCTGAAGG - Intergenic
1149691620 17:58581921-58581943 AACTGACTGGAATAGCATGAAGG + Intronic
1149831987 17:59880387-59880409 ATCTGTTTGGAAAAGTTTAAGGG + Intronic
1153655458 18:7278159-7278181 ATCTGTTTGGATTAGGGTGAGGG - Intergenic
1155460188 18:26071074-26071096 AAATGGTTGGAAAAGTCTGAAGG + Intronic
1156113345 18:33755297-33755319 ACAGTTTTGGAATAGTCTGATGG - Intergenic
1157469629 18:47979341-47979363 CACTGTTGGGATTACTCTGAGGG - Intergenic
1158296674 18:56004045-56004067 AGCTGTTTGGAAAAGCTTGATGG - Intergenic
1158360543 18:56667401-56667423 AACTTTTTGAGATAGTATGAGGG - Intronic
1159339527 18:67117938-67117960 AGCTGTTTTGAATTCTCTGAGGG + Intergenic
1159453707 18:68634826-68634848 AACTTTTTGGAAGAGTCTGTAGG + Intergenic
1159752810 18:72324058-72324080 GACTTTTTAAAATAGTCTGATGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
926081708 2:9992265-9992287 AGCTCTTTGGAATATTCTGCTGG + Intronic
931250763 2:60528948-60528970 AGCTGGTTGGGAGAGTCTGAGGG - Intronic
937319971 2:120955304-120955326 ATCTGGTGGTAATAGTCTGAGGG - Exonic
937797243 2:126038361-126038383 AACAGCTTGGAATAGTCAGTGGG - Intergenic
939977300 2:148733124-148733146 TACTGTTTGAAATACTCTTAGGG - Intronic
941593613 2:167449485-167449507 AACTTTTTGGAAAAGTCTTTAGG + Intergenic
941867709 2:170351788-170351810 AAATTCATGGAATAGTCTGAAGG + Intronic
943143861 2:184017580-184017602 AAGAGTTTGGAACAGTTTGAAGG + Intergenic
943272242 2:185821387-185821409 AGTTTTTTGGAAAAGTCTGAGGG - Intronic
943317771 2:186411166-186411188 TGCTGTGTGGAATAGTATGATGG + Intergenic
944142042 2:196467347-196467369 AACTGCTTGGTATAGGATGAGGG + Intronic
945485144 2:210386601-210386623 AAATGTTTGTAAAATTCTGAAGG + Intergenic
1172328038 20:34052634-34052656 AACTGTTTGGAAACATCTGATGG - Intronic
1173837846 20:46137419-46137441 GACTGTGTGGAATAGGATGAGGG + Intergenic
1180590985 22:16937208-16937230 TACTGTATGGAATACTGTGATGG + Intergenic
1182659077 22:31912381-31912403 AAGTGTGTGGCACAGTCTGAAGG - Intergenic
949094051 3:64828-64850 AACTGTTTCTTATACTCTGATGG + Intergenic
955096278 3:55801316-55801338 AACTGTTTGGAAGCACCTGAAGG + Intronic
955176361 3:56618076-56618098 TACTTGTTGAAATAGTCTGAGGG - Intronic
957744181 3:84317429-84317451 TGCTGTTTGGAATAGTATAATGG + Intergenic
958039978 3:88215681-88215703 AACTGTGTCGAAAACTCTGAAGG + Intergenic
958881559 3:99677744-99677766 AACTGTATGGAAACGTCTGGAGG - Intronic
959284308 3:104388384-104388406 AACTGTGTGGAAAGTTCTGAGGG - Intergenic
961944890 3:130675634-130675656 AAGTGTTTTGAAAAGTCTAATGG + Exonic
962464607 3:135645937-135645959 AAGTGTTTATAATATTCTGATGG + Intergenic
962843841 3:139258507-139258529 ATATGTTGGGAATAGTCTTACGG + Intronic
963635660 3:147792240-147792262 AAATGTATGCTATAGTCTGATGG - Intergenic
965878155 3:173353592-173353614 AACTGATTGGAATTTTCTCATGG - Intergenic
967603779 3:191419891-191419913 AAAAGTTTGCAATGGTCTGAAGG + Intergenic
971637472 4:29080264-29080286 GATTGTGTGGAAAAGTCTGAGGG + Intergenic
972157075 4:36177171-36177193 AAATGTTTTGATGAGTCTGATGG - Intronic
974575542 4:63715437-63715459 AACAGATTGGAAGAGTGTGAAGG - Intergenic
975275524 4:72495250-72495272 AAATGTGTGGAATAGTCCCAGGG + Intronic
976015310 4:80545451-80545473 AGATGTTTGTAATAGTCTGAGGG - Intronic
976292768 4:83438076-83438098 AAATGTTTGGAATAAGATGAAGG - Intronic
977572767 4:98646857-98646879 AACTGCTTGGAATAGTCAATAGG - Intronic
978053163 4:104228790-104228812 AAATGTTGGGAATATTGTGATGG - Intergenic
978237399 4:106475416-106475438 TACTGCTTGGGATACTCTGAAGG + Intergenic
980897442 4:138873721-138873743 AAATCTTTGGAATAGTAGGAGGG - Intergenic
982321302 4:154080013-154080035 AACTGTTTGGCTGATTCTGAAGG - Intergenic
983820550 4:172188586-172188608 AAATGCTTGAAATGGTCTGAAGG + Intronic
984238475 4:177190341-177190363 ACCTATTTAGAATAGTCTGCAGG - Intergenic
984876013 4:184368237-184368259 AGCTTTTTTGAATTGTCTGACGG - Intergenic
986488823 5:8268860-8268882 AGCTTTTTGGAATATTATGAAGG - Intergenic
986706993 5:10460558-10460580 AGCAGTTTGGAAGAGTGTGAGGG + Intronic
991387375 5:66105404-66105426 AATTCTTTGGAAGAGTTTGAAGG - Intergenic
991430077 5:66535263-66535285 AGCTGATAGGAATATTCTGATGG + Intergenic
993083813 5:83338029-83338051 AGCTGTGTGGAATAGCCTGGAGG + Intronic
997420466 5:133762992-133763014 AACTGTTAGGAAGAGGATGAAGG - Intergenic
998462279 5:142318693-142318715 AGCAGTTTGGAAGAGACTGATGG + Intronic
999845408 5:155474155-155474177 AACTGTCTGTAAGAGCCTGAAGG - Intergenic
1000154208 5:158534681-158534703 ACTTGTTTGAAATAGTCTGTAGG + Intergenic
1002020261 5:176359952-176359974 AAGTGTTTGGCAGACTCTGACGG - Intronic
1003985820 6:11434183-11434205 AACAGATTGTAATATTCTGAAGG + Intergenic
1004315249 6:14581225-14581247 AACTGTCTGGAGTAACCTGAAGG + Intergenic
1004801323 6:19151945-19151967 AACTGTTTGAAGTATTATGAGGG + Intergenic
1005749677 6:28871172-28871194 AACTGTTTTGGACAGCCTGAAGG - Intergenic
1005970708 6:30758951-30758973 AAATGCTTGGTATAGGCTGATGG + Intergenic
1009699655 6:67160156-67160178 AAGTGGTTGGAATAGTTTGGAGG + Intergenic
1010778146 6:79910063-79910085 AACTCTTTGGAATAATGTGGAGG - Intergenic
1010991176 6:82481918-82481940 AACTGTTAGGAATAGTGTCAGGG + Intergenic
1012822482 6:104103809-104103831 AACTGTGTGCAAGAGTGTGAAGG + Intergenic
1013927967 6:115495296-115495318 AACAGTTTGGAAGACTCAGAAGG - Intergenic
1015484259 6:133750265-133750287 AAGTGTTTGGAAAATTATGAAGG + Intergenic
1017853171 6:158323795-158323817 TACTGTATAGAAAAGTCTGAGGG - Intronic
1021922781 7:25503481-25503503 AGCTGTTTGGAAAATTCTGAGGG + Intergenic
1024369645 7:48566184-48566206 AAATGTTTGGAGCACTCTGAGGG - Intronic
1025768226 7:64478872-64478894 AACTTTTTGGAAGAGTCTTTAGG + Intergenic
1026270033 7:68828612-68828634 AACTGTTTTGACTAAACTGATGG + Intergenic
1028102697 7:86840611-86840633 AACAGTTTGGAATATTATAATGG - Intronic
1028346997 7:89795396-89795418 AGCTGCTTGCAGTAGTCTGAGGG + Intergenic
1029225133 7:99020828-99020850 AACTGTTTGAAAGATGCTGAAGG + Intergenic
1030806717 7:113928957-113928979 AACTGGTTGGAACAGTTTGGGGG + Intronic
1030986671 7:116249829-116249851 ACATGTTTGGAATGGTCTGTAGG - Intronic
1034447320 7:151120308-151120330 AACAGTCTGGAAGACTCTGAGGG - Intronic
1036585171 8:10117025-10117047 AACTGTATGGAATAATGTGAAGG + Intronic
1038859889 8:31375637-31375659 AACAGTTAGGAGTAGTCTGCTGG + Intergenic
1039877246 8:41597292-41597314 AAGTGTTTGGAATAGCCTGAAGG + Intronic
1041168205 8:55112855-55112877 AACTGTTTGGGACAGTCTTCTGG - Intronic
1041836951 8:62227039-62227061 TATTGTTTGGAATAGTAAGACGG - Intergenic
1042108327 8:65352636-65352658 AACTTTTTGGAATAGCTTCAGGG + Intergenic
1043252943 8:78098676-78098698 AACACTTTGGAATAATGTGAAGG - Intergenic
1050924320 9:11244147-11244169 AACTCTTTTGAATATTCTTAAGG - Intergenic
1051556242 9:18385463-18385485 TACTGTTTGAAATAATCTCAAGG - Intergenic
1052176081 9:25464364-25464386 GAGAGGTTGGAATAGTCTGAAGG - Intergenic
1055421970 9:76152973-76152995 CCCTGCTTGGAATAGTCAGATGG - Intronic
1056932151 9:90888020-90888042 CTCAGTTTGGAATAGACTGAGGG - Intronic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1059815888 9:117914303-117914325 AATTGTTTGGAAAAGTTTGAGGG - Intergenic
1059969700 9:119652820-119652842 AACTGCATGGACCAGTCTGAGGG + Intergenic
1187871709 X:23770158-23770180 GAATGTTTGGCATAGTCTGCTGG - Intergenic
1189087266 X:38038723-38038745 AACTGATTAGTACAGTCTGAAGG - Intronic
1192829699 X:74738705-74738727 AAAATTTTGGAAAAGTCTGAAGG - Exonic
1193698361 X:84736660-84736682 AACTGTTTGGAACAGTCTTTAGG - Intergenic
1194460888 X:94166138-94166160 AATGGTTTGAAATAGTATGACGG - Intergenic
1195434251 X:104824435-104824457 AATTGTTTGGAATACTTTCAAGG + Intronic
1201862592 Y:18615651-18615673 AACTGTATGTACTAGGCTGATGG - Intergenic
1201870731 Y:18704729-18704751 AACTGTATGTACTAGGCTGATGG + Intergenic