ID: 1086303232

View in Genome Browser
Species Human (GRCh38)
Location 11:85452551-85452573
Sequence CATTCTAGTTATGGTGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086303232_1086303242 25 Left 1086303232 11:85452551-85452573 CCTCCAACACCATAACTAGAATG 0: 1
1: 0
2: 1
3: 4
4: 149
Right 1086303242 11:85452599-85452621 TCATATCAGGCCATCTTGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 112
1086303232_1086303240 21 Left 1086303232 11:85452551-85452573 CCTCCAACACCATAACTAGAATG 0: 1
1: 0
2: 1
3: 4
4: 149
Right 1086303240 11:85452595-85452617 ATTGTCATATCAGGCCATCTTGG 0: 1
1: 0
2: 1
3: 4
4: 107
1086303232_1086303238 12 Left 1086303232 11:85452551-85452573 CCTCCAACACCATAACTAGAATG 0: 1
1: 0
2: 1
3: 4
4: 149
Right 1086303238 11:85452586-85452608 TCTACTTCCATTGTCATATCAGG 0: 1
1: 0
2: 0
3: 13
4: 148
1086303232_1086303241 22 Left 1086303232 11:85452551-85452573 CCTCCAACACCATAACTAGAATG 0: 1
1: 0
2: 1
3: 4
4: 149
Right 1086303241 11:85452596-85452618 TTGTCATATCAGGCCATCTTGGG 0: 1
1: 0
2: 2
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086303232 Original CRISPR CATTCTAGTTATGGTGTTGG AGG (reversed) Intronic
900997969 1:6133075-6133097 GATTCTATTTATTGTTTTGGGGG + Intronic
902728617 1:18353490-18353512 CATTCTAGTGAGGGTATCGGAGG + Intronic
903906304 1:26689655-26689677 CATCCTGGTTTTGGTGTTTGGGG + Intergenic
904351767 1:29912642-29912664 TATTTTACTTATGGTGCTGGAGG - Intergenic
910687849 1:89936529-89936551 CAGTGTTGTTCTGGTGTTGGTGG + Exonic
912464906 1:109865469-109865491 CATTCGAGTTCTGGTTTTAGAGG - Intergenic
913601333 1:120424241-120424263 CATTCTAGGGATGGTTTTTGGGG + Intergenic
914085713 1:144452354-144452376 CATTCTAGGGATGGTTTTTGGGG - Intronic
914191608 1:145416335-145416357 CATTCTAGGGATGGTTTTTGGGG - Intergenic
914362519 1:146947799-146947821 CATTCTAGGGATGGTTTTTGGGG + Intronic
914489151 1:148139298-148139320 CATTCTAGGGATGGTTTTCGGGG - Intronic
914589536 1:149094337-149094359 CATTCTAGGGATGGTTTTTGGGG - Intronic
914976044 1:152363376-152363398 CATCCTATTTAAGGTGGTGGAGG + Intergenic
916003771 1:160640886-160640908 CATTATAGTTATTGTGGTGGTGG + Intronic
916026554 1:160838277-160838299 CTTCCTAGTTCTGGTGATGGAGG - Intronic
916570210 1:166018971-166018993 CATTCTAGGTATGATTCTGGAGG + Intergenic
918723069 1:187879171-187879193 CGTTCCAGTTATAGAGTTGGAGG - Intergenic
920141943 1:203822429-203822451 CATTATAGGGATCGTGTTGGGGG - Intronic
924416249 1:243859756-243859778 CTTTCTAGTGGTGGTGGTGGTGG - Intergenic
1063539469 10:6917802-6917824 CATTCTAGTGTGTGTGTTGGGGG + Intergenic
1064082733 10:12321672-12321694 CATTTTAGTTATGGAGTTTGAGG + Intergenic
1065206376 10:23361388-23361410 AATTCTAGAGATGGTCTTGGGGG + Intergenic
1068596842 10:58911120-58911142 CATTCTAAGTATGGAGTTGGGGG + Intergenic
1074334436 10:112555813-112555835 CATTTTAGTTTTGGTGTTTAAGG + Intronic
1074351201 10:112738786-112738808 GAGTCAAGTTATGGTGTTGTGGG + Intronic
1077606603 11:3616698-3616720 CAGTCCAGTTAGGCTGTTGGCGG - Intergenic
1078754692 11:14198079-14198101 CATTCTAGTTATCGTCTAGATGG - Intronic
1079682292 11:23313074-23313096 AAGTCTAGGTATGGTGTTGCTGG + Intergenic
1084875495 11:72129365-72129387 CATTCTAGTTTGGGGGTGGGAGG - Intronic
1086303232 11:85452551-85452573 CATTCTAGTTATGGTGTTGGAGG - Intronic
1087686430 11:101270947-101270969 CATTCTAGGGAGGGTGTTGCAGG - Intergenic
1089761287 11:120725885-120725907 AATTCTAGTGATGGTGGTGGTGG + Intronic
1091668881 12:2438385-2438407 CATGGTAGTCATGGTGGTGGTGG + Intronic
1094472826 12:30819174-30819196 GATTCTAGTTATGATGGTGATGG - Intergenic
1094782654 12:33810201-33810223 CATTCAACATATGTTGTTGGAGG + Intergenic
1097424693 12:59428725-59428747 CCTTCTAGTTTTGCTATTGGAGG + Intergenic
1099285752 12:80712639-80712661 AATTCCAGCTATGGTGTTGTGGG - Intergenic
1103245400 12:119452650-119452672 TATTCTAGTTGTGATGATGGTGG + Intronic
1103640850 12:122350720-122350742 CATTCTAGATGTGGAGTTGTGGG - Intronic
1103658463 12:122494089-122494111 CATTCTAGTTCTGTTTTTTGCGG - Intronic
1104337685 12:127915353-127915375 CATCCCAGTTATTGTGTGGGAGG - Intergenic
1107293307 13:38881937-38881959 CATTCCAGAAATGGTCTTGGAGG + Exonic
1108428369 13:50328354-50328376 CTTTCTAGCTATGGTGGTGATGG + Intronic
1109057028 13:57563780-57563802 CATTCTTATTATTGTTTTGGAGG + Intergenic
1111260255 13:85728813-85728835 CATTCTGGTTATAATGTTAGTGG - Intergenic
1112274939 13:98008348-98008370 CACTCAAGTTTTGGTGTTTGTGG + Intronic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1114546930 14:23509894-23509916 CACTCTTGTTAAGTTGTTGGGGG + Intergenic
1120010788 14:79412044-79412066 CAGTCTCCTTATGGTGATGGTGG + Intronic
1126303366 15:47225344-47225366 CATTCTAGTAAGAGTGTTGTGGG + Intronic
1127500379 15:59549111-59549133 CCTTTCAGTTATGATGTTGGTGG - Intergenic
1128630736 15:69263993-69264015 CTTTCTTTGTATGGTGTTGGTGG + Intronic
1134779574 16:16883614-16883636 CATTCTAGAAATGGTGATGTGGG - Intergenic
1139161302 16:64514006-64514028 CATTATATTGATGGAGTTGGTGG + Intergenic
1140828790 16:78732149-78732171 GATTCAAGTTTTGGGGTTGGGGG - Intronic
1140950984 16:79817132-79817154 TATTCTAGTTAAGTTGGTGGTGG - Intergenic
1141006343 16:80356499-80356521 TAATCTAGTGATGGTGGTGGTGG - Intergenic
1142495509 17:304534-304556 CCCTCTGGTTATGTTGTTGGTGG - Intronic
1151041465 17:70865607-70865629 CATTCTAGGTAGGATGATGGTGG + Intergenic
1151441698 17:74133470-74133492 CATTCTAGGTAGGGTGGAGGGGG + Intergenic
1158203299 18:54963478-54963500 CATTCTAGTCTAGGAGTTGGGGG - Intergenic
1158710037 18:59829425-59829447 GATTCTAGTTCTTGTTTTGGTGG + Intergenic
1159625804 18:70692585-70692607 CCTTCTAGTAATGGTGTGGATGG - Intergenic
1159636406 18:70810082-70810104 CTTTCTGGCTTTGGTGTTGGCGG + Intergenic
1160004687 18:75061092-75061114 CATTTTGCTTATCGTGTTGGTGG - Intronic
1160332695 18:78010053-78010075 CATTCTTGTTACTGTGGTGGTGG + Intergenic
1160413525 18:78690437-78690459 CACAGGAGTTATGGTGTTGGTGG - Intergenic
1162113616 19:8414835-8414857 CATTCTAATGATGGAGCTGGTGG - Intronic
1162211177 19:9093465-9093487 CATCTTAGGGATGGTGTTGGTGG - Exonic
928734590 2:34272647-34272669 CATTTTAGGTATTGTGATGGTGG + Intergenic
929790787 2:45021275-45021297 GTTTCTAGTGATGGTTTTGGGGG + Intergenic
931309996 2:61068632-61068654 CTTTCTAGTCATTTTGTTGGTGG + Intronic
933517204 2:83319627-83319649 GATTCTATTTATGGTAGTGGTGG + Intergenic
938712641 2:133988965-133988987 CATTCTTGTGGAGGTGTTGGGGG + Intergenic
941069126 2:160936764-160936786 AATACTAGGTGTGGTGTTGGTGG - Intergenic
941640414 2:167981937-167981959 GTTTCTAGTTAGGGTGGTGGTGG + Intronic
947790955 2:232869061-232869083 GATTCTAGTTATGGATATGGAGG + Intronic
1169047607 20:2547498-2547520 CATTGTTGTTAGGGTTTTGGGGG - Intronic
1169596437 20:7204696-7204718 CATTCTAGTTGTGGTTTTCCTGG - Intergenic
1169993508 20:11529734-11529756 AATTCTAGTGATGTTGTTTGTGG - Intergenic
1170784688 20:19457212-19457234 CTTTCTAGTTGTGGTGAGGGGGG + Intronic
1170888955 20:20363680-20363702 CGTTCTTGCTATGGGGTTGGCGG - Intergenic
1173110538 20:40183678-40183700 AACTCTAGATATGGAGTTGGGGG + Intergenic
1175601023 20:60273260-60273282 TTTTCTAGTTTTGATGTTGGGGG - Intergenic
1177850926 21:26347778-26347800 CAGTCTAGTGAAGGTGATGGTGG + Intergenic
1180611267 22:17099745-17099767 CATTCTAGTTACCCTGGTGGAGG - Intronic
949923049 3:9019318-9019340 CATTCTTGAGATGGTGTTGCTGG - Intronic
952087101 3:29837192-29837214 CATACTCATTATGGTTTTGGAGG - Intronic
952300559 3:32101005-32101027 CATGTTAGTAATGGTGTAGGAGG + Intergenic
953472436 3:43178632-43178654 CATCCTAGAGATGGTGTTGCGGG + Intergenic
956168898 3:66417346-66417368 CATTGTAGTTATATTGGTGGGGG - Intronic
956894779 3:73648674-73648696 CCCTGCAGTTATGGTGTTGGAGG - Intergenic
959429333 3:106233333-106233355 AAATATAGGTATGGTGTTGGAGG - Intergenic
959855991 3:111159657-111159679 CATTTTAGGAATGATGTTGGAGG - Intronic
960319684 3:116219566-116219588 GATTCTTGGTAAGGTGTTGGTGG - Intronic
964416937 3:156457665-156457687 AATTCTAGTAATGGTGGTAGAGG - Intronic
974830557 4:67183197-67183219 CATTCTAGATATGGTCTTGGAGG - Intergenic
976362408 4:84195493-84195515 CATTCTAATTATGGGGGTAGTGG + Intergenic
982375241 4:154682620-154682642 TATTGTAGTTGTGGTGATGGAGG - Intronic
982475132 4:155841258-155841280 CTTTCTAGATATGCTGTGGGAGG + Intronic
983499616 4:168484019-168484041 CATTCTTGTAATTGTTTTGGAGG - Intronic
983580088 4:169300922-169300944 CATTCTATTTATAGTTTTTGAGG - Intergenic
987839886 5:23210016-23210038 CATTCAAATGATGGTGATGGTGG - Intergenic
989110093 5:37898975-37898997 GATGCTAGTCATGGTGTAGGGGG + Intergenic
992474586 5:77089001-77089023 CATTCCAATAATGGTTTTGGAGG + Intergenic
994613714 5:102077849-102077871 CATTATAGTTTTTGTGCTGGCGG + Intergenic
994770462 5:103974440-103974462 AATTCTAGTCATGGCGGTGGTGG - Intergenic
996448818 5:123593679-123593701 AATTCTGGTTATGGATTTGGAGG + Intronic
999560835 5:152800587-152800609 TATTCTAGAAATGGTGGTGGGGG - Intergenic
1002387068 5:178876111-178876133 CATTTTAGCTATAGTGGTGGAGG + Intronic
1004033802 6:11901588-11901610 TATTCTACTTAAGGTTTTGGGGG + Intergenic
1005350209 6:24926977-24926999 GATTGTAGTTGTGGTGGTGGTGG - Intronic
1005350224 6:24927063-24927085 GATTGTAGTTGTGGTGGTGGTGG - Intronic
1005350239 6:24927149-24927171 GATTGTAGTTGTGGTGGTGGTGG - Intronic
1005350268 6:24927293-24927315 GATTGTAGTTGTGGTGGTGGTGG - Intronic
1007221974 6:40285924-40285946 CGTCCCAGTCATGGTGTTGGTGG - Intergenic
1010705216 6:79100853-79100875 CATTCTCTTTATATTGTTGGTGG - Intergenic
1013072368 6:106740834-106740856 CATTTTAGTTCTGGCATTGGAGG + Intergenic
1013153256 6:107467304-107467326 TATTCTAGTTCTTGTGTTAGTGG - Intergenic
1015558078 6:134483268-134483290 CTTGCTAGTTGTGGTCTTGGGGG - Intergenic
1015965866 6:138694268-138694290 GATACGGGTTATGGTGTTGGTGG + Intergenic
1016848949 6:148597098-148597120 CATCCTTGTTATGGTTTTGCAGG - Intergenic
1017510112 6:155106600-155106622 CATTCCAGCTGTGGTTTTGGAGG + Intronic
1018851254 6:167641601-167641623 GATTATAGTGATGGTGGTGGAGG - Intergenic
1020989204 7:15175398-15175420 CACACTAGTTATGATTTTGGGGG + Intergenic
1022448657 7:30493320-30493342 CACTCTTTTTGTGGTGTTGGTGG - Intergenic
1023481804 7:40642978-40643000 TATTCAAATTATTGTGTTGGAGG + Intronic
1026551363 7:71371814-71371836 CATTCAATAAATGGTGTTGGGGG - Intronic
1026607470 7:71828092-71828114 AATTATAGGTATGGTTTTGGAGG + Intronic
1028427072 7:90701598-90701620 TATTCTACTTCTGGTGTTAGTGG + Intronic
1028549512 7:92043580-92043602 TATTCTAGTTCTGGGGTTTGGGG + Intronic
1029598326 7:101549237-101549259 CATTTTAGGTAGGGTGTGGGAGG + Intronic
1035416512 7:158693751-158693773 AATTCTAGGTATGGAGATGGTGG - Intronic
1035544433 8:468645-468667 CACTCTAGTGATGGTGCTTGAGG - Intronic
1037151856 8:15645813-15645835 TACTTTAGTTATGGTGTTGAGGG - Intronic
1038574283 8:28690861-28690883 GATCCTAGTTAGGGTGTGGGTGG + Intronic
1039269437 8:35864554-35864576 CACTCTAGCTAAGGGGTTGGGGG + Intergenic
1039622339 8:39009884-39009906 CATTCTAGTGATGGGGGGGGGGG + Intronic
1040671277 8:49694122-49694144 CATTCTAGTTCTTCAGTTGGTGG + Intergenic
1047112897 8:121810753-121810775 CATACTAGTTATGATGCTGCAGG - Intergenic
1051928798 9:22361486-22361508 CATTCATGTTTTGTTGTTGGTGG + Intergenic
1056458620 9:86787904-86787926 CATTTTGGTTTTGATGTTGGGGG + Intergenic
1058189991 9:101902036-101902058 CATTCAAGTTTGGGCGTTGGGGG + Intergenic
1059520228 9:114933845-114933867 CATTCCAGAGAGGGTGTTGGTGG - Intergenic
1061725836 9:132581475-132581497 AATTCAAGTTATGTTGTTTGCGG - Intergenic
1188700925 X:33261944-33261966 CATTGTGGTTGTGGTGGTGGTGG - Intronic
1190157851 X:48008149-48008171 GATTGTAGTGATGGTGTTGATGG - Intronic
1190173623 X:48131034-48131056 GATTGTAGTGATGGTGTTGATGG - Intronic
1192440447 X:71169970-71169992 GATCATAGTGATGGTGTTGGGGG - Exonic
1194425319 X:93730518-93730540 CATTTTAGTCATGATTTTGGGGG + Intergenic
1194481008 X:94424473-94424495 CATTGCAGTTATAGTGGTGGTGG - Intergenic
1197531252 X:127629521-127629543 TATTCTAATTGTGGTGGTGGTGG + Intergenic
1197945644 X:131836148-131836170 CATTCTAGTTAAAATGTAGGTGG + Intergenic
1198009565 X:132537369-132537391 CTTTCTAACTATGGAGTTGGTGG + Intergenic
1200947531 Y:8860982-8861004 CATGATAGTTATGTTCTTGGTGG + Intergenic