ID: 1086307187

View in Genome Browser
Species Human (GRCh38)
Location 11:85493979-85494001
Sequence CTCCAGAGGATGCAGCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 899
Summary {0: 20, 1: 59, 2: 144, 3: 207, 4: 469}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086307187_1086307192 20 Left 1086307187 11:85493979-85494001 CCTTGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1086307192 11:85494022-85494044 ATATGACAGGAGAGAAAGAAGGG 0: 1
1: 0
2: 3
3: 97
4: 940
1086307187_1086307190 7 Left 1086307187 11:85493979-85494001 CCTTGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1086307190 11:85494009-85494031 AAATCATGTCTTCATATGACAGG 0: 1
1: 0
2: 1
3: 22
4: 212
1086307187_1086307191 19 Left 1086307187 11:85493979-85494001 CCTTGTTGCTGCATCCTCTGGAG 0: 20
1: 59
2: 144
3: 207
4: 469
Right 1086307191 11:85494021-85494043 CATATGACAGGAGAGAAAGAAGG 0: 1
1: 0
2: 0
3: 57
4: 618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086307187 Original CRISPR CTCCAGAGGATGCAGCAACA AGG (reversed) Intronic