ID: 1086311664

View in Genome Browser
Species Human (GRCh38)
Location 11:85542256-85542278
Sequence AGGTGGTGCCCCATTTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086311664_1086311669 30 Left 1086311664 11:85542256-85542278 CCAAAAGAAATGGGGCACCACCT 0: 1
1: 0
2: 1
3: 10
4: 108
Right 1086311669 11:85542309-85542331 TATGTTGGAGAACTCCCCCACGG 0: 1
1: 0
2: 1
3: 9
4: 110
1086311664_1086311668 15 Left 1086311664 11:85542256-85542278 CCAAAAGAAATGGGGCACCACCT 0: 1
1: 0
2: 1
3: 10
4: 108
Right 1086311668 11:85542294-85542316 CTCTTGGAAATATATTATGTTGG 0: 1
1: 0
2: 0
3: 15
4: 267
1086311664_1086311667 -1 Left 1086311664 11:85542256-85542278 CCAAAAGAAATGGGGCACCACCT 0: 1
1: 0
2: 1
3: 10
4: 108
Right 1086311667 11:85542278-85542300 TTCATTGTTAAGCAATCTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086311664 Original CRISPR AGGTGGTGCCCCATTTCTTT TGG (reversed) Intronic
901311457 1:8272290-8272312 GGGTCCTGCCCCATTCCTTTGGG - Intergenic
904763809 1:32826156-32826178 AGACGGTGCCCCATTTTCTTGGG + Exonic
909265206 1:73549760-73549782 AGGTGGTTCCCCATGGCCTTGGG + Intergenic
909706647 1:78593176-78593198 AAGTGCTGCCCCATTGATTTTGG + Intergenic
910174354 1:84413018-84413040 AGGGGGTGCATCACTTCTTTGGG - Intronic
914240387 1:145849196-145849218 AGATGGTGGCACATTCCTTTGGG - Exonic
916127595 1:161585064-161585086 AGCTACTGCCCCATTTCTCTCGG - Intronic
916137513 1:161666868-161666890 AGCTACTGCCCCATTTCTCTCGG - Intronic
916214084 1:162381384-162381406 AGCTGCTGCCCCATTTTTTGTGG + Intronic
919357659 1:196545674-196545696 AATGGGTGCACCATTTCTTTTGG - Intronic
919538951 1:198825601-198825623 AGCTTGTGCCACATTTCTTGAGG - Intergenic
920647309 1:207813072-207813094 CGGTTGTGCCGCATTCCTTTAGG - Intergenic
924853676 1:247855731-247855753 AGGTGGGACCCCATTTCTCCAGG - Intergenic
1069587965 10:69621120-69621142 AGGTGGAGCCCCAGTTCTGAGGG + Intergenic
1070634709 10:78115934-78115956 TGGTGGTTCCCTCTTTCTTTTGG + Intergenic
1070738212 10:78880221-78880243 AGATGTTGCTCCATCTCTTTTGG - Intergenic
1075861910 10:125684247-125684269 AGGTGGTGGGCCACCTCTTTTGG + Intergenic
1078950887 11:16133189-16133211 GGGGTGTGCCCCATTTGTTTAGG - Intronic
1079378308 11:19914289-19914311 AGGTGGTGTCACATTACTGTCGG + Intronic
1080388524 11:31824376-31824398 ATGTGGGGCTTCATTTCTTTTGG - Intronic
1081411526 11:42764183-42764205 AGGTGGAGTCCCAGTACTTTGGG - Intergenic
1081848794 11:46260581-46260603 TGGGGGTGCCCCATTTCCTTGGG - Intergenic
1083310133 11:61779730-61779752 AGGGGGTGCCCCATTTCCCCGGG - Intronic
1083674062 11:64315875-64315897 AAGTGCTGGCCCATTTCTATGGG + Exonic
1084839620 11:71834621-71834643 AGGAGGTGCCACCTTTCATTAGG - Intronic
1086144511 11:83536980-83537002 AGGTGGTCCACAATTTCTTTAGG - Intronic
1086311664 11:85542256-85542278 AGGTGGTGCCCCATTTCTTTTGG - Intronic
1087867713 11:103252338-103252360 AGGTGGTGACTTATTTCCTTTGG + Intronic
1091830301 12:3544538-3544560 AGGCGGTCCCCCACTTCTGTAGG - Intronic
1094362661 12:29646825-29646847 AGGTGGCTCCCCAATTCATTAGG + Intronic
1101505131 12:105339117-105339139 AGCTGTTGTTCCATTTCTTTTGG + Intronic
1102697346 12:114810227-114810249 AGGTGGAGCTCCATTTCCTAAGG + Intergenic
1105344364 13:19560082-19560104 AAGTGCTGGCCCATTTCTATGGG - Intergenic
1105535670 13:21261492-21261514 AAGTGCTGGCCCATTTCTATGGG + Intergenic
1105978265 13:25492833-25492855 AGGTGGGGCCCAGTTTCCTTTGG + Intronic
1106288031 13:28335160-28335182 TGGAGGTGCACCATTTCTCTGGG - Intronic
1109721137 13:66277646-66277668 AGGTGGTGTCCCATGGTTTTGGG - Intergenic
1111343506 13:86918850-86918872 AGGTGGTGCCTGATTTACTTAGG + Intergenic
1111788955 13:92828103-92828125 TGGTGGTGCTGCACTTCTTTTGG - Intronic
1116255348 14:42547950-42547972 GGCTGTTGCCCCCTTTCTTTTGG - Intergenic
1117864856 14:60136611-60136633 AGCTGGTCCCCCACTTCTGTAGG - Exonic
1118075985 14:62299737-62299759 AAATGGTGCCACATGTCTTTAGG + Intergenic
1125394450 15:39231753-39231775 AGGTGATGTCCCATTTATGTCGG + Intergenic
1130358270 15:83155301-83155323 AGGTGGAGCCCCATTACTTTTGG + Intronic
1130838209 15:87672556-87672578 GGGTGGGGCCCCATTTTTTCAGG - Intergenic
1131355024 15:91737609-91737631 AGGTGGTTTCCCCTTTCATTGGG + Intergenic
1140449951 16:75062938-75062960 AGATAGTGCCCCCTTTCTTCAGG + Intronic
1140526295 16:75625694-75625716 ACCTGGTGCCATATTTCTTTGGG + Intergenic
1140734150 16:77883331-77883353 AGTTGGATCCCCATTTCTCTAGG + Intronic
1143178215 17:4968553-4968575 TGGTCGTGCCCCGTCTCTTTTGG - Exonic
1144399610 17:14883638-14883660 AGGTGGGGCCCCATGGCTTTGGG + Intergenic
1144789230 17:17848200-17848222 GGGGAGTGCCCCATTTCTATGGG + Intronic
1148390465 17:47268618-47268640 AGGTGGTCTCCCATGGCTTTGGG + Intronic
1155610456 18:27661364-27661386 AGGGGGTTTCCCTTTTCTTTGGG - Intergenic
1155988576 18:32256133-32256155 AGTTGGTCCCCCATGTCTGTGGG + Intronic
1157868745 18:51209859-51209881 AGGTGGTGACTTATTTATTTTGG + Intronic
1158940093 18:62399808-62399830 AGGTGGAGCCCCCTTCCTGTGGG + Intergenic
1161543330 19:4865598-4865620 AGGTGGGGCCTCATTCCTCTGGG - Intronic
1162295693 19:9811689-9811711 AGGAGGTGCCACATGACTTTAGG + Exonic
1162798575 19:13099007-13099029 AAGTGGTGCCTCATTTTTTCCGG - Intergenic
925859264 2:8159384-8159406 AGGTGCTGCCCAATTTCTGAGGG + Intergenic
927368792 2:22330576-22330598 AGGGGCTGCCCTTTTTCTTTTGG + Intergenic
927959557 2:27232556-27232578 GGGTGGTGCCCCAATACGTTAGG - Exonic
929201693 2:39243735-39243757 AGGCGGTCCCGCTTTTCTTTCGG + Intergenic
929821724 2:45279636-45279658 AGGTGGAGCTCCTTTTCTTTGGG - Intergenic
935723681 2:106002344-106002366 ATGTGGTGTCCTATTTATTTAGG + Intergenic
936724029 2:115290695-115290717 AGGTGATGCACCATATATTTTGG + Intronic
942219138 2:173752401-173752423 AGGCGTTGCCCCATTTCACTGGG + Intergenic
943053312 2:182943930-182943952 AGATGGGGAACCATTTCTTTAGG - Intronic
945494361 2:210491709-210491731 AGGTGATCCCACATTTCTTAGGG - Intronic
945931060 2:215855040-215855062 AGGTGGTCTCCCATTGCCTTGGG - Intergenic
947484381 2:230534662-230534684 AGGTGGTGGTCAACTTCTTTTGG + Intronic
1170887068 20:20349750-20349772 AGATGTTGTCCCATTTATTTAGG - Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1173327444 20:42046897-42046919 ATGTGGTTCCTCATGTCTTTGGG + Intergenic
1178705346 21:34868386-34868408 AAGTGGTTCTCCATTTCATTAGG + Intronic
1183268190 22:36843963-36843985 GGTTTGTGGCCCATTTCTTTGGG + Intergenic
1184027059 22:41865680-41865702 TGGTTGTGCCCCTTTTCTCTGGG - Intronic
954546576 3:51441152-51441174 AAGAGGTGCATCATTTCTTTAGG - Intronic
957322696 3:78653028-78653050 AGGTGTTGGCCCATTTCATTAGG + Intronic
965475329 3:169148832-169148854 AGGTGGTGACTAATTTGTTTCGG + Intronic
968275791 3:197439421-197439443 AGGTGGGGCCCCCAGTCTTTTGG - Intergenic
980603606 4:135059407-135059429 AGGTGGTGGCTCATTTCCTCAGG - Intergenic
980643102 4:135604525-135604547 AGGTGGTGTCTGATTTCCTTAGG - Intergenic
981899544 4:149846433-149846455 AGGTGATTCAACATTTCTTTAGG - Intergenic
985405727 4:189636396-189636418 AGGTGGTGTCCGATTTATGTAGG - Intergenic
986853878 5:11845487-11845509 ATGTGGTGCTCCTTTTCTTAAGG - Intronic
987867391 5:23563353-23563375 AGTTGGTCCACCTTTTCTTTTGG - Intergenic
996470960 5:123860030-123860052 AGGTGGGGCCCCACTTGTCTGGG - Intergenic
1012001372 6:93659252-93659274 AGGTGGTGGCCCATAACCTTTGG + Intergenic
1014678964 6:124404427-124404449 AGGTGGTGCCACTGTTCTTCTGG - Intronic
1015304417 6:131691093-131691115 AAATGGTAGCCCATTTCTTTGGG - Intronic
1016898288 6:149075376-149075398 AGGTAGAGTCCCATTTCTTATGG + Exonic
1018792837 6:167162621-167162643 GGCTGGTCCCCCACTTCTTTTGG - Intronic
1022536478 7:31101754-31101776 GGGTGGTGCCTCATTTATCTGGG - Intronic
1023795333 7:43787676-43787698 AGGTGCTCCACCATGTCTTTAGG - Intronic
1024094913 7:45975842-45975864 AGAGGGTGCCCCATTCATTTGGG - Intergenic
1028045122 7:86108100-86108122 AGGTGGTGTCCCATGGCTTTGGG - Intergenic
1030843465 7:114382440-114382462 AGGTGGTGGCTTATTTCTATTGG + Intronic
1033984956 7:147213920-147213942 AGGTGATGCCCTCTTTCTCTTGG - Intronic
1034498340 7:151435048-151435070 AGGTGGTACCCCATGTCCATGGG - Intronic
1034743192 7:153497307-153497329 AGGTGTTGCCTCAGTTCATTGGG + Intergenic
1036403547 8:8432525-8432547 AGAAGGTGCCCCACTTCCTTCGG + Intergenic
1037766658 8:21776297-21776319 TGGGGCTGCCCCATTTCTTGGGG - Intronic
1038274568 8:26109723-26109745 AGAAGGTGCCCCATTTCCTCAGG - Intergenic
1049983088 9:922678-922700 AAATGGTGCCTTATTTCTTTTGG + Intronic
1050740487 9:8813938-8813960 AGGTGCTTTCACATTTCTTTCGG + Intronic
1052138381 9:24944659-24944681 AGGAGATTTCCCATTTCTTTCGG + Intergenic
1057212150 9:93206218-93206240 ATGTAGGGCCCCATTTCTTTGGG + Intronic
1059015621 9:110512419-110512441 TGGTGGTGCCCACTTTCTATTGG + Intronic
1186259439 X:7761116-7761138 AGGAGGTGCCCAATCTCTTCAGG + Intergenic
1186271374 X:7891969-7891991 AGCTGGTCCCCCACTTCTTTAGG - Intergenic
1187438827 X:19298475-19298497 AGCTACTGCCCCATTCCTTTTGG + Intergenic
1188262610 X:28037662-28037684 ATGTGGTTCCCCAATTCTTCAGG + Intergenic
1194039167 X:88918418-88918440 AGGTGTTGCCTAGTTTCTTTTGG + Intergenic
1196808641 X:119610821-119610843 AGGTGTTGCCCAATTTCTCCAGG - Intergenic
1197383034 X:125768893-125768915 AGGTGGTCCACCATATCTTAAGG - Intergenic
1201864000 Y:18630030-18630052 AGGTGGTGCCTGATTTCTATAGG - Intergenic
1201869322 Y:18690348-18690370 AGGTGGTGCCTGATTTCTATAGG + Intergenic
1202565945 Y:26212195-26212217 AGCTGGTTGCCCATTTTTTTTGG - Intergenic