ID: 1086316665

View in Genome Browser
Species Human (GRCh38)
Location 11:85602103-85602125
Sequence GAGGAGAAGCAGACTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 1, 1: 0, 2: 4, 3: 80, 4: 734}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086316665 Original CRISPR GAGGAGAAGCAGACTGAGGG TGG (reversed) Intronic
900120190 1:1045576-1045598 GAGGAGAAGCACAGTGATGGGGG - Intronic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900762982 1:4485407-4485429 GAGAAGAACCAGACTGAAGAAGG + Intergenic
900834822 1:4993558-4993580 GAGGAAAAGCAGACTGTTGGTGG - Intergenic
901018359 1:6244077-6244099 GAGGAGGAGGGGACCGAGGGAGG - Intergenic
901050516 1:6423905-6423927 GAGGAAAAGCTGACAGAAGGTGG - Intronic
901240410 1:7689782-7689804 AAGGGGAGGCAGACAGAGGGAGG - Intronic
901658701 1:10785568-10785590 GAGGAGAAGCAGAGGTGGGGTGG - Intronic
901755986 1:11441879-11441901 GAGGAGGAGGAAAATGAGGGAGG + Intergenic
902210924 1:14903922-14903944 GATGAGAAGCAGACTGCGGAAGG + Intronic
902711524 1:18243270-18243292 GAGGTGGAGAAGACTAAGGGAGG - Intronic
903189449 1:21648683-21648705 GAGCAGGGGTAGACTGAGGGGGG - Intronic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904636357 1:31884585-31884607 GAGGAGAAGCCTACTGTGGTCGG + Intergenic
904868751 1:33603087-33603109 GAGGAAATGGAGACTCAGGGAGG - Intronic
905352795 1:37359153-37359175 GAGGAGAAACAGAGAGAGGTTGG + Intergenic
905503832 1:38460609-38460631 GAGGAGAGACATACTGAGGTTGG - Intergenic
905710177 1:40095533-40095555 TAGGACAAGCTGACTTAGGGTGG - Intronic
906271294 1:44481130-44481152 GAAGAGCAGAAGACTGAGCGTGG + Intronic
906480326 1:46195237-46195259 GAGGTGGAGCAGAATAAGGGAGG - Intronic
906720562 1:48001253-48001275 GAGGAGATAGAGCCTGAGGGTGG - Intergenic
906726662 1:48049168-48049190 GAGGAAAAGCTGTCTGAGGAGGG + Intergenic
906963499 1:50434111-50434133 GAAGAGCAGCAAACTGAGGAAGG + Intergenic
907110157 1:51919867-51919889 AGGGAGAAGCAGACTGGGTGTGG + Exonic
907281034 1:53347129-53347151 AGGGAGAAGCAAACTGGGGGAGG + Intergenic
907705530 1:56829158-56829180 GAGGAGAAGGAGACACAGGAAGG - Intergenic
907786507 1:57618122-57618144 AAGGAGAAGAAGACTGGGCGCGG + Intronic
908206234 1:61852729-61852751 GATGAGAAGCAGCCTGAGTCAGG + Intronic
908236529 1:62152362-62152384 AAGGAGCAGCAGTCTGAGTGCGG + Intronic
908273967 1:62449813-62449835 GAGGAGGAGGAGCCTGAGGTGGG + Intronic
908427159 1:64018279-64018301 GAGAAGCAGGAAACTGAGGGAGG - Intronic
910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG + Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910547982 1:88440797-88440819 GAGGAGAAGGAGAAAGAAGGAGG + Intergenic
910771384 1:90835764-90835786 TAGGAGAAGGTGCCTGAGGGAGG + Intergenic
910845174 1:91598374-91598396 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
910876722 1:91885576-91885598 GCGGAGAGGAAGAGTGAGGGCGG + Intronic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912158635 1:106953347-106953369 GAGAAGAAGCAAAGTGAGAGAGG - Intergenic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
912666765 1:111588097-111588119 GAAGAGAAGCAGGCTTATGGGGG - Intronic
913458209 1:119055724-119055746 GAGGAGGAGAAGAGGGAGGGAGG + Intronic
913458613 1:119059905-119059927 GAGGAGAAGCACACACAGTGGGG + Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915137050 1:153739904-153739926 CAGGAGGAGGAGACTGAGGCAGG - Intronic
915254550 1:154616391-154616413 GAGGAAAAGAAGGCTCAGGGAGG - Intronic
915361670 1:155289677-155289699 GGGGACAGGCAGAGTGAGGGTGG - Exonic
915444631 1:155967675-155967697 GCGGAGAAGCAGATGGAGTGTGG - Intronic
915476589 1:156156191-156156213 GAGGAGAGGCAGCCAGAGGCAGG - Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916052973 1:161049024-161049046 GAGGACAAGCAGGCTGAGCCTGG - Exonic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
916797512 1:168180328-168180350 GAGGAGAAGCAGATGGGGGCAGG + Intronic
917329561 1:173868084-173868106 GATGAGAGGAAGATTGAGGGAGG - Intronic
917789682 1:178491574-178491596 GAGGAAAAGGAGGCTCAGGGAGG + Intergenic
918134922 1:181663304-181663326 GAGGAAATGGAGACTGAGAGTGG + Intronic
919054000 1:192546127-192546149 GAGCAGATGCAGGCTGAGGAAGG + Intergenic
919209497 1:194461562-194461584 GAGGAGGAGGAGATTGAGGCGGG + Intergenic
919767912 1:201139212-201139234 GAGGAGGAGCAGCCAGAGAGAGG - Intronic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920785090 1:209033601-209033623 GAGAAGCACCAGACTGAGGCTGG + Intergenic
921276789 1:213528621-213528643 GAGGAGAAGGACACAGAGAGTGG - Intergenic
921383120 1:214544925-214544947 GGGGAGGAGCAGAGTGAAGGTGG + Intronic
921402627 1:214743045-214743067 GAGGAGAAGGAGAGAGATGGGGG + Intergenic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
921938413 1:220815815-220815837 GAGGAGATGCCCACCGAGGGTGG - Exonic
922159592 1:223068858-223068880 GAGGAAAAGCAGTGGGAGGGTGG + Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923227303 1:231949956-231949978 GAGGATAAGGAGACTGGGGCTGG - Intronic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
923474185 1:234317380-234317402 GAGGAGAAGGGAAGTGAGGGGGG - Intronic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
923843173 1:237696666-237696688 GAGAAGAAGCAGACTGTGGGAGG - Intronic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
924856142 1:247876897-247876919 GAGGAGAAACAGAATTAAGGAGG - Exonic
1062922844 10:1293036-1293058 GAAGAGATGCAGAGGGAGGGAGG + Intronic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1063103584 10:2973319-2973341 GAAGATAAGCAGCCTGAGGCAGG + Intergenic
1063330682 10:5155929-5155951 GAGAAGAGGCAGAATGAAGGTGG - Intergenic
1063601155 10:7482670-7482692 GAGAAGAAGCAGCCTGAGTCTGG - Intergenic
1064416728 10:15156294-15156316 GAGAAGAATGAGAGTGAGGGGGG - Intronic
1064627967 10:17280940-17280962 GAAGAGAGAGAGACTGAGGGGGG + Intergenic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1066408265 10:35141075-35141097 AAGGAAAAGGAGACTCAGGGAGG - Intronic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1068724825 10:60289362-60289384 GGGGAGAAGAAGAAAGAGGGTGG - Intronic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069622323 10:69845586-69845608 GAGGGGCTGCAGGCTGAGGGAGG - Intronic
1069994997 10:72336514-72336536 GAGAAGCAGCAGAGTGAGTGTGG - Exonic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1071324688 10:84501422-84501444 GAGGAGAAGGAGAAAGGGGGAGG - Intronic
1071341445 10:84652376-84652398 CAGAAGAAGCAGAGTGTGGGAGG - Intergenic
1071498471 10:86187202-86187224 GAGGAAATGGAGACTCAGGGAGG - Intronic
1072107881 10:92291271-92291293 GAGGAGGAGGAGCCTGAGGCGGG - Exonic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072747091 10:97948366-97948388 GAGGAGAGCTAGACTGAGGAGGG + Intronic
1072893358 10:99344660-99344682 GAGGAAGAGCAGAGTGATGGGGG - Intronic
1073495679 10:103888911-103888933 GAGGAGATGGAGGCTCAGGGAGG + Intronic
1074164253 10:110860855-110860877 CCAGAGAAGCAGACTCAGGGAGG + Intergenic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074413249 10:113245623-113245645 GAGGAGAGGCTGACTGAGGAGGG + Intergenic
1074532335 10:114305942-114305964 GAGGAGATGCAGATGCAGGGGGG + Intronic
1074548482 10:114421024-114421046 GAGGAGGAGCAGATTTGGGGTGG - Intergenic
1074691126 10:116005054-116005076 GAGGAGAAGGAGATGGAGGGGGG - Intergenic
1074914482 10:117942175-117942197 GAGGAGGAGAAAACTGAAGGAGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1076623914 10:131810167-131810189 GAGGAAAAGCAGGATGATGGAGG + Intergenic
1077331256 11:1984701-1984723 GAGGAAAACCAGCCTGTGGGGGG + Intergenic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078441947 11:11375642-11375664 GAGGAGAGCAAGACTGAGAGAGG - Intronic
1078575963 11:12503009-12503031 GAGGAGAAAAAGACTCAGTGAGG - Intronic
1079296443 11:19239215-19239237 GAGAAGATGCAGGCTGAGAGAGG + Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1079994135 11:27277473-27277495 GAGGAGAAGCAGTTTGGTGGTGG - Intergenic
1080091346 11:28352755-28352777 GAGGTGAAGCTCATTGAGGGAGG + Intergenic
1080549724 11:33362215-33362237 TAGATGAAGCAGACTGAGTGGGG + Intergenic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1081498251 11:43638062-43638084 GAGGGAAAGCAGACTGAGAGAGG + Intronic
1081696796 11:45117455-45117477 GAGGAGAAGCAGGTTGAGTGTGG + Intronic
1082809434 11:57470193-57470215 GAGGAAATGGAGACTGAGAGAGG - Intronic
1083254944 11:61490135-61490157 GAGGAGGAGCCATCTGAGGGAGG - Intronic
1083734655 11:64672470-64672492 GGGGAGAACAAGACGGAGGGCGG + Intronic
1083897573 11:65627750-65627772 GAGAGGAAGCAGGCTGAAGGAGG + Intronic
1084095660 11:66909452-66909474 GAAGAGAAGCTGCCTGAGAGTGG + Intronic
1084120401 11:67065871-67065893 GAGGAGAAGCAGGGCGGGGGAGG - Intronic
1084753932 11:71222748-71222770 GAGCAGGAGCAGACTGAGAGAGG - Intronic
1084892863 11:72244922-72244944 GACGAGAAAGAGAGTGAGGGAGG + Intronic
1085338866 11:75718426-75718448 GAGAAGGTGCAGACTGAGAGTGG + Intronic
1085469136 11:76745711-76745733 GCGGAGAAGCAGAGAGAGGGTGG - Intergenic
1085658867 11:78343414-78343436 GAGGAGAGGGAGACAGAAGGAGG + Intronic
1085730647 11:78995746-78995768 GATGAGATGCAGAGTGAGGGTGG + Intronic
1085754049 11:79189341-79189363 GAGGAGCAGGAGACTGTGGTGGG - Intronic
1085902380 11:80716722-80716744 GAGGTGAAACAAACTGAGGTAGG + Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086331837 11:85761992-85762014 GAGGAGAGTGAGGCTGAGGGGGG + Intronic
1087327282 11:96739045-96739067 GAGGTGATGCAGACTGAAGAGGG - Intergenic
1088109477 11:106245788-106245810 GAGCAGAAGCAAAATGGGGGAGG - Intergenic
1088190823 11:107226400-107226422 GGGGAGAAGAATACTGAGGGGGG - Intergenic
1088207283 11:107407605-107407627 GAATAGAAGCAAACTGAGGAAGG + Intronic
1088524219 11:110735221-110735243 GAGGAGAAGCAGAGGAGGGGAGG + Intergenic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089564074 11:119361630-119361652 GGGGAGGAGCAGGCTGAAGGAGG + Intronic
1089683573 11:120132999-120133021 GTGAAGGAGGAGACTGAGGGGGG - Intronic
1090297194 11:125599125-125599147 TAGGAGAGGCAGAGTGAGAGAGG - Intronic
1090591382 11:128273841-128273863 AAAGATAAGCAGAGTGAGGGTGG - Intergenic
1091169196 11:133505483-133505505 AAGAGGAAGCAGATTGAGGGAGG - Intronic
1091217339 11:133910563-133910585 GAGGAGAAGCAGACCTGGAGAGG + Intronic
1202814237 11_KI270721v1_random:39877-39899 GAGGAAAACCAGCCTGTGGGGGG + Intergenic
1091456887 12:614545-614567 AAGGGGAAGAAGACAGAGGGAGG - Intronic
1091692090 12:2604254-2604276 GAGGAGAAGGGGACTGAGACAGG + Intronic
1091702765 12:2674689-2674711 GAGGAGAGGCAGGCAGAGGGGGG - Intronic
1091722238 12:2821663-2821685 GGGGAGAGGCAGGCTGAGTGTGG - Intronic
1091743308 12:2975267-2975289 TAGGAGAAACTGACTGGGGGCGG - Intronic
1091800153 12:3319993-3320015 CAGGAGAAGCAGACTCTTGGAGG + Intergenic
1092252178 12:6905697-6905719 GACGAGAAGGAGACAGAGGAGGG + Exonic
1092409993 12:8245329-8245351 GATTGGAAGCAGACTGAGGAAGG + Intergenic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1093884958 12:24448926-24448948 GAGATGAGGAAGACTGAGGGAGG - Intergenic
1094157143 12:27349078-27349100 GAGGAGAATCAGAGTCATGGGGG + Intronic
1094234382 12:28146846-28146868 GAGGAGAAGAAGAAAGAAGGAGG - Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095154377 12:38834369-38834391 GGGGAGAAGGAGATTGAGGCAGG - Intronic
1095446319 12:42286773-42286795 GAGGGGAGCCAGGCTGAGGGTGG + Intronic
1095746510 12:45665171-45665193 GAGGAGAAGGAGGCTGAATGTGG + Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096557916 12:52415115-52415137 GAGGAGAAGCAGACCTCGGATGG + Intergenic
1096719497 12:53510453-53510475 GAGGAGCAGCGGTGTGAGGGTGG + Intronic
1096752355 12:53769139-53769161 AATCAGAAGCAGACTGTGGGGGG - Intergenic
1097813652 12:64046651-64046673 GGGGAGAAGCAGGCTGAAGCGGG + Intronic
1098443917 12:70546790-70546812 GAGGAGAAGCAGTCCCAGGGAGG + Intronic
1098445633 12:70563119-70563141 GAGGAGCAAGAGAATGAGGGAGG + Intronic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1100098749 12:91076588-91076610 GAGGAGAAGGAGACGGAGAAGGG + Intergenic
1100393208 12:94162354-94162376 GAGCAGAAGCAGAGTGCAGGAGG + Intronic
1101853795 12:108425532-108425554 CAGGACAAACAGACTCAGGGAGG + Intergenic
1102007125 12:109596116-109596138 GAGGAGACTGAGACTGAGAGAGG + Intronic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102531893 12:113552868-113552890 GTGGAGGAGGAGACTGGGGGCGG + Intergenic
1102865938 12:116374009-116374031 CAGGAGAAGCGGACTGAGCCAGG + Intergenic
1103410858 12:120710547-120710569 GAGGAGAAGAAGAAGGCGGGCGG + Exonic
1103513349 12:121490296-121490318 GAGGACAAGCACCCTGATGGGGG - Intronic
1104486027 12:129151751-129151773 GAAGAGAAGCAGACAGAAGACGG - Intronic
1104765322 12:131326389-131326411 GAAGAAAGGCAGACTCAGGGTGG + Intergenic
1104814067 12:131636080-131636102 GAAGAAAGGCAGACTCAGGGTGG - Intergenic
1105223850 13:18409102-18409124 GAGGAGGAGGAGGCTGTGGGAGG + Intergenic
1105285273 13:18998347-18998369 GAGGAGAAGCGGAGGGAAGGAGG - Intergenic
1105426193 13:20297041-20297063 GAGGACAGGGAGACAGAGGGCGG - Intergenic
1106626486 13:31425735-31425757 GAAGACAAGAAGACTGTGGGAGG + Intergenic
1106785090 13:33099517-33099539 GAGGAGAAGCAGATTCGTGGGGG - Intergenic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1109306319 13:60645861-60645883 AAGGAGACTCAGAGTGAGGGAGG - Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1110574199 13:77037369-77037391 CAGGAGAAACAGACTGAGTGGGG - Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111640515 13:90963851-90963873 GAGGAGAAGGAGAGAGATGGGGG - Intergenic
1112635445 13:101212650-101212672 GTGGTGTGGCAGACTGAGGGAGG + Intronic
1112732161 13:102376454-102376476 GAGGAGAGGCAGACAGTGGAAGG - Intronic
1113340258 13:109416141-109416163 GAGGATCAGGAGACCGAGGGCGG + Intergenic
1113955259 13:114096974-114096996 GTGGAGGAGCAGACTCAGAGTGG - Intronic
1114483579 14:23049575-23049597 GAGGAGAAGGGGACAGAGGCAGG + Intronic
1114559321 14:23579002-23579024 GGGGAGATGCAGCCTGAGAGAGG + Intergenic
1115211025 14:30967248-30967270 GAAGAGAGGCAGAGAGAGGGGGG + Intronic
1115308232 14:31953819-31953841 GAGGAGAAGCAGAGAGTTGGGGG - Intergenic
1115440575 14:33430245-33430267 GAGGAAAAGAAGAATGGGGGAGG - Intronic
1115642361 14:35342684-35342706 GAGGAGAAACAGGATGATGGTGG - Intergenic
1115650746 14:35401417-35401439 GAGGTGGAGCAGTGTGAGGGAGG - Intergenic
1116110777 14:40577889-40577911 GAGGAGGAGGAGAGAGAGGGTGG + Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116499469 14:45602678-45602700 GAGGAGAGGGAGACAGATGGGGG + Intergenic
1116524775 14:45891121-45891143 GAGGAGCAGGAGAGAGAGGGAGG - Intergenic
1117334132 14:54742327-54742349 GAGGAGAAATAGAATGGGGGGGG + Intronic
1118000231 14:61516166-61516188 GGAGGGAAGCAGATTGAGGGAGG + Intronic
1118072077 14:62256510-62256532 GAGTAAAAGCAGACGGAAGGTGG - Intergenic
1118331425 14:64818619-64818641 GAGGAGAGGGAGACAGAGGATGG + Intronic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1118900402 14:69981069-69981091 GAGCAGAAGGAGGCTGGGGGAGG + Intronic
1118908408 14:70040803-70040825 GAGGAGAAGGGAACTGTGGGAGG + Intergenic
1118922973 14:70166933-70166955 GAGGAGGAGCAGCCAGAGGAGGG - Exonic
1119009727 14:70972234-70972256 GAGGAGGAGCAGATTCAGGGTGG + Intronic
1119422940 14:74518360-74518382 GATGAGAAGCAGGCTGGGGCCGG - Intronic
1121310184 14:92931591-92931613 GAGGAGGAGGAGGCTGAGGCTGG + Exonic
1121685512 14:95832325-95832347 GAGGAGGAGCACCCTGGGGGAGG - Intergenic
1121895009 14:97638667-97638689 TAGGGGAAGCAAACTGAGTGTGG + Intergenic
1122253855 14:100462788-100462810 GAGGAGGAGAGGACGGAGGGAGG - Intronic
1122400013 14:101461453-101461475 GAGGAGAAGCAGATTGCCTGGGG + Intergenic
1122698306 14:103569237-103569259 GAGGACAAGCAGCTTGGGGGAGG - Intronic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1124051021 15:26197686-26197708 GAGGAGAGGCAGACAGAGCCAGG + Intergenic
1124051032 15:26197737-26197759 GAGGAGAGGCAGACAGAGCCAGG + Intergenic
1124652795 15:31485525-31485547 GAGGTCAACCAGTCTGAGGGGGG + Intronic
1124816731 15:33001538-33001560 GAGGAGGAGGAGGATGAGGGGGG - Intronic
1124956547 15:34364096-34364118 GAGGTGAAGAAGACTGAAGAAGG + Intronic
1125437828 15:39666991-39667013 GCTGAGAAGCAGATTTAGGGTGG - Intronic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125720269 15:41841991-41842013 GAGGAGGTGCAGAGGGAGGGAGG - Intronic
1125727893 15:41877398-41877420 GAGGAGAAGGAGGCTGACGAGGG - Intronic
1125882153 15:43204292-43204314 GAGGAAAAGCAGAGTAAGGGAGG - Intronic
1126343566 15:47669667-47669689 GAGGAGAAGGAGATTGACAGAGG - Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1127320600 15:57841408-57841430 GAGAAGGAGAAGACTGAGGCTGG + Intergenic
1128749541 15:70139225-70139247 GAGGAGCAGCAGGCGGAGGTGGG - Intergenic
1128766380 15:70253547-70253569 GCGGAGAAGCAGCTAGAGGGAGG + Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1129275609 15:74443288-74443310 TGGGAGTAGAAGACTGAGGGAGG - Intergenic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129651481 15:77493823-77493845 GAAGAGGAGCAGACTGGGGCAGG + Intergenic
1129685355 15:77683146-77683168 GGGGAGAAGCAGAGTGAGTGTGG + Intronic
1130054121 15:80507642-80507664 GAAGAGAAGAAGGCTGAGGTTGG + Intronic
1131149971 15:90041603-90041625 GAGGAGGGGCAGACTTAGAGAGG - Intronic
1131562303 15:93455154-93455176 GAGGAGAGGGAGGCGGAGGGAGG + Intergenic
1132929319 16:2450923-2450945 GAGAAGATGGAGACTGCGGGTGG + Intronic
1133026860 16:2992376-2992398 GAGGAGAAGCAGTGTGTGAGGGG - Intergenic
1133320307 16:4909392-4909414 GAGGAGTGGGAGGCTGAGGGTGG - Intronic
1133392602 16:5422237-5422259 GAGGAGGAGCAGGGAGAGGGAGG + Intergenic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1135996828 16:27256396-27256418 GAGGAGAAGCAGAGTGGGAGTGG - Intronic
1136083310 16:27867328-27867350 GAGGAGAAGGAGGCTTAGAGAGG - Intronic
1136172433 16:28496983-28497005 GAGGAGGAGGAGACTGCGGGAGG + Exonic
1136227092 16:28866494-28866516 GAGGAGGAAGAGACTGAGGAAGG - Exonic
1136550541 16:30980266-30980288 GAGGGGAGGCAGACAGAGTGGGG - Intronic
1138124850 16:54430306-54430328 GAGGAGAGAAAGACAGAGGGAGG + Intergenic
1138229681 16:55327830-55327852 GAGGAGAGGAAGGCAGAGGGAGG + Exonic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138319785 16:56102250-56102272 GAGGAGAAACAGCCTGACAGGGG - Intergenic
1139194650 16:64905098-64905120 CAAGAGAAACACACTGAGGGTGG + Intergenic
1140153783 16:72401174-72401196 GAGGAGAGGGAGAGGGAGGGGGG + Intergenic
1140221852 16:73049213-73049235 GAGTAAATTCAGACTGAGGGTGG - Intronic
1140251803 16:73300912-73300934 GTGGAGAAGGAGACTGATGTTGG + Intergenic
1140473872 16:75229015-75229037 GAAGAGCAGCTGCCTGAGGGTGG - Intronic
1140851039 16:78934807-78934829 GAGAAGAAGCAGACTGGGCATGG + Intronic
1141520520 16:84575792-84575814 GAGGAGACTCAGGCTCAGGGAGG - Intronic
1141859293 16:86705533-86705555 GAGGTGGACCAGACTGAGAGAGG + Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142673304 17:1497517-1497539 GAGGGGCAGCAGCCTGAAGGAGG + Intronic
1142714260 17:1739332-1739354 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714281 17:1739422-1739444 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714331 17:1739645-1739667 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714395 17:1739915-1739937 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714438 17:1740095-1740117 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714522 17:1740455-1740477 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714686 17:1741130-1741152 GAGGAGCCGGACACTGAGGGTGG + Intergenic
1142714791 17:1741580-1741602 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714811 17:1741670-1741692 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714834 17:1741760-1741782 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714887 17:1741983-1742005 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142714899 17:1742028-1742050 GAGGAGCAGGACAGTGAGGGTGG + Intergenic
1142818412 17:2446719-2446741 GAGGCGTAGCAGGCTGAGGCAGG - Intronic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143435736 17:6923352-6923374 CAGGAGAAGCAAACTGGGGGAGG + Intronic
1143541838 17:7573667-7573689 GAAGCGAAGCAGACTGGGGGAGG - Intronic
1143952299 17:10643131-10643153 GAGGAGATGCGGTCTGAGGCAGG - Intronic
1144021961 17:11245580-11245602 GATGAGAATCATTCTGAGGGAGG + Intronic
1144085715 17:11806932-11806954 GAGGAGAGGCTGATGGAGGGTGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144721428 17:17473144-17473166 GAGGAGACCCAGGCTCAGGGAGG + Intergenic
1145246510 17:21273232-21273254 CAGTAGAAGGAGGCTGAGGGAGG - Intergenic
1145775377 17:27524256-27524278 GAGGTCAAGCAGGATGAGGGTGG + Intronic
1145940702 17:28742010-28742032 GAGGAGAAGCAATATCAGGGTGG - Exonic
1146428264 17:32764658-32764680 GAGTGGAAGCTGACTGGGGGTGG - Intronic
1146528217 17:33584949-33584971 GAGAAGGAGCAGACAGAGAGAGG + Intronic
1146915170 17:36673724-36673746 GAAGAGAAGAAGACAGAGGAGGG + Intergenic
1146948841 17:36891997-36892019 GTGGAGAAGCAGAGTGAAAGAGG + Intergenic
1147317275 17:39626976-39626998 GAGGAGAGGCTGAGGGAGGGAGG + Exonic
1147697383 17:42366194-42366216 GAGGAGAAGCCGGCTGGGAGAGG - Intronic
1148177503 17:45580018-45580040 AAGGACAGGCAGATTGAGGGAGG - Intergenic
1148192633 17:45690359-45690381 GAAGAGAAGCAGACACAGAGAGG + Intergenic
1148357563 17:46985848-46985870 GAGCAGAAGAAGACAGAGGAGGG - Intronic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1150220706 17:63494314-63494336 GGGGAGAACCAGGCTGGGGGTGG - Intronic
1150747827 17:67830606-67830628 AAGGAAAGGCAGATTGAGGGAGG + Intronic
1151393292 17:73802223-73802245 GAGGAGAAGCAGGTTTAGTGGGG - Intergenic
1151945990 17:77320222-77320244 GAGGAGGAGGAGGCTGAGAGAGG + Intronic
1152325165 17:79631802-79631824 CAGGGGGAGCAGCCTGAGGGTGG - Intergenic
1152793820 17:82296928-82296950 GAGGAAGAGGAGGCTGAGGGGGG - Intergenic
1154492848 18:14934437-14934459 GAGGAGCAGTGGACTGAGGTGGG - Intergenic
1154529455 18:15330012-15330034 GAGGAGGAGGAGGCTGTGGGAGG - Intergenic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155925670 18:31652517-31652539 GAGGGGAAGAAGGCTGAGAGTGG - Intronic
1156310810 18:35919884-35919906 GAGGAGGAGCAGGCTGGGTGGGG + Intergenic
1156390420 18:36645084-36645106 GAGGAAAAGAAGACTGAGGCTGG + Intronic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157446373 18:47749435-47749457 GGGGAGAAGCAGAGGGCGGGGGG - Intergenic
1157616986 18:48992785-48992807 GAGCAGGAGCAGACTGAGTGTGG - Intergenic
1157780070 18:50430614-50430636 GAGAAGATGCAGAATGATGGTGG + Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158489199 18:57894827-57894849 GAGGAGAAGCCAAGTGAAGGTGG + Intergenic
1159134261 18:64318619-64318641 GAGGAGAAGGAGAGATAGGGAGG - Intergenic
1159977139 18:74727971-74727993 GGGGAGAAGGAGAGTGATGGAGG + Intronic
1160077660 18:75693513-75693535 GGGGAGGAGCAGACAGAGGGAGG + Intergenic
1160845623 19:1164806-1164828 GAGGAGGAGCAGGAGGAGGGAGG + Intronic
1161096428 19:2394528-2394550 GAGTAGAAACAGAGTGAGGTTGG + Intronic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161629673 19:5346613-5346635 GAGGAGAAAGAGACAGAGAGAGG - Intergenic
1161842945 19:6693700-6693722 GAGGAGAAGGATATTGAGGGTGG + Intronic
1161847708 19:6721087-6721109 GAGGGGAAGTAGAATGGGGGAGG + Intronic
1161961202 19:7524183-7524205 GAGGAGATGGAGGCTCAGGGAGG + Intronic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162304738 19:9865146-9865168 GAGGAGAAGAAGAAGAAGGGAGG - Intronic
1162971508 19:14183704-14183726 GAGGACAGGGAGACTGAGGTGGG + Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163146190 19:15380369-15380391 GAGCAGGAGGAGGCTGAGGGCGG - Exonic
1163390446 19:17027095-17027117 GAGGAGAGGGAGAGTGGGGGCGG - Intergenic
1163641234 19:18463269-18463291 GAGGAGGAGCAACCTGAGGGGGG + Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163751608 19:19081568-19081590 GAGGAGAATGCCACTGAGGGTGG + Intronic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164723946 19:30452829-30452851 GAGGAGAGGAAGACGAAGGGAGG - Intronic
1165426802 19:35750357-35750379 GAGGAGAGACAGAGTGAGGGTGG - Intronic
1165757690 19:38304013-38304035 CAGGGGAGGCCGACTGAGGGGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166287943 19:41844015-41844037 GAGGACCAGCAGAGAGAGGGAGG + Exonic
1166364544 19:42271970-42271992 GAGGAGGAGGAGGCTGAGCGGGG + Intronic
1166388804 19:42397404-42397426 GACGAGAATCAGGCTTAGGGTGG - Intergenic
1166536766 19:43579564-43579586 GAGGAGAAGCAGAGACAGGGAGG + Intronic
1166562072 19:43739518-43739540 GAGGATAGGCAGTCTGAGGGAGG + Intronic
1166738369 19:45099455-45099477 GAGGAGACTCAGGCTCAGGGAGG - Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1166783012 19:45352106-45352128 GAGGACAGGCAGGCTGAGGGTGG + Intronic
1166814063 19:45531509-45531531 GAGGAGGAGCAGTATGAAGGAGG - Intronic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167043383 19:47036069-47036091 GAGGAAGAGGAGACGGAGGGCGG - Exonic
1167367779 19:49064030-49064052 GATGGGAAGCAGATGGAGGGAGG + Intronic
1167580230 19:50337009-50337031 GAGGACAAGCTGACTGTGAGTGG - Intronic
1167583797 19:50361655-50361677 GAGGACAAGCTGACTGTGAGTGG - Exonic
1167711048 19:51111256-51111278 GAGGAGAACTAGACAGTGGGTGG - Intergenic
1167741406 19:51326754-51326776 GAGGTGAAGCCGTCTGTGGGGGG - Exonic
1168072722 19:53961831-53961853 GAGAGGAGGCTGACTGAGGGTGG + Intergenic
1168207884 19:54865681-54865703 TAGGACAAGCAGCCTGATGGCGG - Intronic
1168290262 19:55354124-55354146 TAGGAGGAGCAGTGTGAGGGAGG - Exonic
925047804 2:787883-787905 GAAGAGAAGCAGGTTGAGGCAGG + Intergenic
925469409 2:4142823-4142845 GAGAGGAAGCAGGCTGAGGCCGG - Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926286918 2:11495968-11495990 GAGGATAACCAGACTGGGAGAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926799964 2:16651685-16651707 GAGGAGATGAAGACCCAGGGAGG + Intronic
926807480 2:16724428-16724450 GATGAGAAGCAGGCTGAGATGGG + Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926891731 2:17644539-17644561 GAGGAGAAGGAGACTGCAGTTGG + Intronic
927003226 2:18821478-18821500 GAGGAGAAGAAAGCTGATGGGGG + Intergenic
927532288 2:23818250-23818272 GAAGAGAGGGAGACGGAGGGAGG + Intronic
927882043 2:26695787-26695809 GGGGAGAGGCAGACAGAGTGCGG + Intronic
928142764 2:28744940-28744962 GAGGAGGAGCAGAATATGGGTGG - Intergenic
929051672 2:37842279-37842301 AAGGAGAGGCAGACTGAGTGTGG + Intergenic
929097617 2:38278844-38278866 GAGGAGAGGGAGAGTGATGGGGG + Intergenic
929491142 2:42397433-42397455 GAGGAGAAAGAGACTGACAGAGG + Intronic
929586039 2:43115074-43115096 GAGGAGGAGCAGAGTGGGAGGGG - Intergenic
929631338 2:43465880-43465902 GAGGAGGAACAGACTGGTGGGGG - Intronic
929971433 2:46580529-46580551 GGGAAAAAGCAGAGTGAGGGAGG - Intronic
929996118 2:46827170-46827192 GTGGGGAAGCAGGCAGAGGGAGG + Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931205340 2:60140843-60140865 GAGGAGAAGGAGGGGGAGGGGGG - Intergenic
932007788 2:67944910-67944932 GAGGAGGAGGAGCCTGAAGGAGG - Intergenic
932124112 2:69127852-69127874 AGGGAGAAGAAGACTTAGGGAGG + Intronic
932624845 2:73289261-73289283 GAGGAAACGCAGACAGTGGGTGG - Intergenic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
934573944 2:95388997-95389019 GAGGACCAGCAGGCTGAGGAGGG + Intergenic
934781279 2:96971254-96971276 GGGGAGAAGGAGAGAGAGGGAGG - Intronic
935063267 2:99626468-99626490 GAAGAGAAGGAGAGGGAGGGAGG - Intronic
935165762 2:100567463-100567485 GAGGAGAAGCAGGCTCAGAGAGG + Intronic
935346429 2:102112477-102112499 GAGGTGAAGCTCACTGAAGGGGG - Intronic
935674114 2:105579737-105579759 GAAGGGAAGGAGACTGAGGGAGG - Intergenic
936514697 2:113174263-113174285 GAGGAGGGGTAGGCTGAGGGAGG - Intronic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938528553 2:132161434-132161456 GAGGAGGAGGAGGCTGTGGGAGG - Intronic
939250150 2:139672267-139672289 AAGGATAAGCAGAGTTAGGGTGG + Intergenic
940226666 2:151408527-151408549 GGGGAGAAGCAGACCGGGCGCGG + Intergenic
942589513 2:177527019-177527041 GAGGACAAGGATACTGAGGCAGG - Intronic
942985413 2:182134781-182134803 GAGGAGCAGCAGGATGAGGGTGG + Intergenic
943259415 2:185640021-185640043 GAGGGAAAGAAGACTGAGTGGGG - Intergenic
943458183 2:188134692-188134714 AAGGAGAAAGAGACTGAGAGAGG + Intergenic
945132372 2:206586535-206586557 GAGAAGGTGAAGACTGAGGGAGG + Intronic
945410581 2:209501530-209501552 GAGGAGAAAGAGACAGAGGATGG + Intronic
946252872 2:218424122-218424144 GAGGAGAAGAAAACTGTGAGGGG - Intronic
946394565 2:219436635-219436657 GAGGAGATGCCGATGGAGGGAGG - Intronic
946685806 2:222268593-222268615 GAGGAGATTCAGAGTGAGGTAGG - Intronic
946688139 2:222291694-222291716 GGGGAGAAGAAAGCTGAGGGAGG - Intronic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
948011748 2:234654256-234654278 GAGGAGAAAAAGGCTGAGGGAGG + Intergenic
948273915 2:236694023-236694045 GATGAGAAGCTGACTCAGTGAGG - Intergenic
948339565 2:237238552-237238574 GAGGAGGAGCTGAATGAAGGAGG - Intergenic
948677632 2:239608139-239608161 GAGGAGAGACAGAGAGAGGGAGG - Intergenic
949021127 2:241742057-241742079 GGGGAGATGCAGGCAGAGGGTGG + Intronic
949071177 2:242025201-242025223 GTGGAGCTGGAGACTGAGGGAGG + Intergenic
1168841473 20:912601-912623 GAGGAGGAGGAGAGAGAGGGAGG + Intronic
1169016924 20:2299612-2299634 AAGGAAAATCAGGCTGAGGGAGG - Intronic
1170064376 20:12294577-12294599 GAGGAGAAGCAGAGAGTGTGGGG + Intergenic
1170456862 20:16541729-16541751 GAAAAGAAGGAGACTGAGGCAGG + Intronic
1170530130 20:17282840-17282862 GGGGAGAATGAGTCTGAGGGAGG + Intronic
1170858458 20:20079490-20079512 GAAGGGAAGCAGAGAGAGGGAGG + Intronic
1171225489 20:23438887-23438909 GAGGAGTAGCGTGCTGAGGGAGG - Intergenic
1171234608 20:23514055-23514077 GAGGAGAAGCAGATTTGGGCAGG - Intergenic
1171299818 20:24050386-24050408 GAGGAGAAGCAGTCTGGTGGGGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172450581 20:35019958-35019980 GTGGAGGAGCAGGCTTAGGGAGG - Intronic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1172584121 20:36070680-36070702 GTGGAGGAGCAGACTGAAAGCGG + Intergenic
1172621267 20:36319984-36320006 GAGGAGAGGGACACAGAGGGAGG - Intronic
1172621285 20:36320038-36320060 GAGGAGAGGGACACAGAGGGAGG - Intronic
1172798060 20:37556878-37556900 GAGGAGAAACAGCCTGTGTGAGG - Intergenic
1173317629 20:41959338-41959360 GAGGAGAAGCTAAGTCAGGGAGG + Intergenic
1173331371 20:42078722-42078744 TGGGAGAAGCAGTCTGGGGGAGG - Exonic
1173410826 20:42808184-42808206 GATGAGCAGCAGGCTGCGGGAGG - Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173560329 20:44000456-44000478 GAGGTGGAGAAGACTGTGGGAGG + Intronic
1174035606 20:47666501-47666523 GAGGAGTGGCAGAGTTAGGGAGG + Intronic
1174070268 20:47894764-47894786 GTGGAGCTGCAGACTGAGGCAGG + Intergenic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174775681 20:53341165-53341187 AAGGACAAGCAAACTGAGGCAGG - Intronic
1174864194 20:54119858-54119880 GAGGAGAGGGAGAGAGAGGGAGG + Intergenic
1175097275 20:56551649-56551671 GAGAAGCAGCTGACTGAGAGAGG + Intergenic
1175400596 20:58697987-58698009 GAGGGGAAGGACACAGAGGGAGG - Intronic
1175460067 20:59145868-59145890 GAGGAGGAGGAGGGTGAGGGTGG - Intergenic
1175780814 20:61680825-61680847 GATGAGAAGAAGACACAGGGGGG - Intronic
1175795110 20:61766191-61766213 GTGGCGAGGGAGACTGAGGGTGG - Intronic
1176078861 20:63261681-63261703 GAGGAGAGGGAGAGAGAGGGAGG - Intronic
1176767943 21:13038456-13038478 GAGGAGGAGGAGGCTGTGGGAGG + Intergenic
1177413747 21:20767920-20767942 GAAGAGAAGGAGAGTGATGGAGG + Intergenic
1177873108 21:26597525-26597547 GAGGAGATGCAGTCTGAAAGTGG - Intergenic
1178000209 21:28153794-28153816 GATCAGAAGAAGACTGGGGGAGG - Intergenic
1178213675 21:30568808-30568830 GAGCAGAAGCAGTCTGTGGTTGG - Intergenic
1178431505 21:32522211-32522233 AAGGAGCAGCAGGCTGAGTGTGG - Intergenic
1178505256 21:33157401-33157423 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505261 21:33157420-33157442 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178526844 21:33337342-33337364 GAGGAGAGGCAGGCAGAAGGAGG + Intronic
1178880970 21:36449875-36449897 GACGAGAAGGAGACTTTGGGAGG - Intergenic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1181622504 22:24100672-24100694 GAGGAGAAGCAGTCACGGGGAGG + Intronic
1181794986 22:25301299-25301321 GAGGAGATGTAGACACAGGGAGG + Intergenic
1181835560 22:25604964-25604986 GAGGAGATGTAGACACAGGGAGG + Intronic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182773259 22:32811212-32811234 AAAGATAAGCAGACTGAGGGGGG + Intronic
1183252094 22:36737420-36737442 GAGGAGAAGCAGAGAGAAGGAGG + Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183723707 22:39576869-39576891 GAGCAGAAGCAGACAGAAGTCGG - Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185057734 22:48589685-48589707 GAAGAGAAGCAAACAGAGAGGGG + Intronic
949611417 3:5707581-5707603 AAGGAGAAGCAGAGAGAGAGAGG - Intergenic
950105972 3:10388680-10388702 GGGGAGAAGGAGACAGAAGGAGG - Intronic
950152766 3:10700822-10700844 TCAGAGAACCAGACTGAGGGAGG + Intronic
950209939 3:11115862-11115884 GAGGAGAAGAAGTCTGCAGGGGG - Intergenic
951135879 3:19103707-19103729 GAGGATGAGCAGAATCAGGGTGG - Intergenic
951666132 3:25125932-25125954 CAGGAAAACCAGACTGAGGGTGG + Intergenic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952354193 3:32570128-32570150 GAGGAGGAGGAACCTGAGGGAGG + Intronic
952899418 3:38099755-38099777 GAGGAGGAGCAGACCGGGGGCGG + Intronic
953261810 3:41346553-41346575 GAGGAGGAACGGACAGAGGGAGG + Intronic
953394093 3:42553255-42553277 CAGGAGAAGCAGTCTGACTGTGG - Exonic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954653367 3:52178695-52178717 GAGGAGCAGCAGGCAGAAGGGGG + Intergenic
954756608 3:52843803-52843825 AAAGAGAAGCAGACTCAGTGAGG + Intronic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
954862824 3:53704405-53704427 GAGGATCAGAAGACTGAGGGAGG + Intronic
955038113 3:55288817-55288839 TATGGGAAACAGACTGAGGGGGG - Intergenic
955239876 3:57169006-57169028 GAGGAGATGGAGACTGGGAGCGG - Intronic
955267223 3:57456775-57456797 GAGGAGAAGCAGATTTGTGGAGG - Intronic
955458423 3:59151483-59151505 GAGATGAAGAAGACTGAGAGGGG - Intergenic
955701332 3:61685011-61685033 GAGGAGTAACAGAGAGAGGGAGG - Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956907930 3:73786196-73786218 GGGGTGAGGTAGACTGAGGGTGG + Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957191401 3:77014683-77014705 GAGTAGTTGGAGACTGAGGGTGG + Intronic
957757029 3:84503484-84503506 AAGAAGAAGCAGAGTGAAGGTGG - Intergenic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
959652604 3:108766014-108766036 GAGAAGAAGGAGAGTGAGAGAGG + Intergenic
959866514 3:111276542-111276564 GAGAGGAAGCAGACTGTGAGAGG - Intergenic
960044873 3:113186902-113186924 GAGGAGCAGGAGGCTGAGGGCGG + Intergenic
960465845 3:117996495-117996517 GAGGAGGAGAAGAGGGAGGGAGG - Intergenic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960855822 3:122101120-122101142 GAGGAGAGGGAGTCTGAGGAGGG + Intronic
960939289 3:122922967-122922989 AAGGAAAAGGAGACTGAAGGAGG + Intronic
960999926 3:123367357-123367379 CAGGAGAAGCAGTTTGTGGGTGG - Intronic
960999952 3:123367536-123367558 GAGGAGGAGGAAGCTGAGGGTGG - Intronic
961460290 3:127045673-127045695 GAGGAGAGGGAGAGGGAGGGAGG + Intergenic
962413243 3:135159993-135160015 GAGGAGATGCAGAGTGACTGAGG - Intronic
962585669 3:136840586-136840608 GAAGAGAAAGAGACGGAGGGAGG - Intronic
962649609 3:137475487-137475509 GAGGAGAGGAAGAGAGAGGGAGG - Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962744936 3:138390039-138390061 GAGGAGAAGCAGAGAAAAGGGGG + Intronic
962744947 3:138390077-138390099 GAGGAGAAGCAGAGAAAAGGGGG + Intronic
963652926 3:148006928-148006950 GAGGAGGAGGAGAGGGAGGGAGG - Intergenic
963712247 3:148759768-148759790 GAGGAAACTCAGACTCAGGGAGG - Intergenic
963774878 3:149428611-149428633 CAGGAGAAAGAGAGTGAGGGAGG + Intergenic
963900211 3:150726406-150726428 CAGGAGAAGCAGACTGAATGTGG + Intergenic
965640984 3:170828813-170828835 GAGAAGAAACAGAGGGAGGGAGG + Intronic
965711632 3:171561527-171561549 GAGGAGAGGCTGGATGAGGGAGG + Intergenic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967469765 3:189848209-189848231 GAGGAGGAGGAGGCAGAGGGAGG - Intronic
968288170 3:197520160-197520182 GAGGGGAAGCAGGGAGAGGGAGG + Intronic
968451159 4:676683-676705 GGGGAGAACCACACCGAGGGGGG - Intronic
968565325 4:1309574-1309596 GAGGAGGAGCAGAGGCAGGGAGG + Intronic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968892039 4:3374583-3374605 GAGATGTGGCAGACTGAGGGAGG - Intronic
969301367 4:6299268-6299290 GAGGAGCAGAGGGCTGAGGGAGG - Intronic
969348644 4:6585050-6585072 GAGAAGGAGCAGCCAGAGGGTGG - Intronic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
969550208 4:7860955-7860977 GGGGAGCAGCAGACAGAGGGCGG - Intronic
969830227 4:9790050-9790072 GAGGAAAAGGAGGCTGAGAGAGG + Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970866937 4:20770092-20770114 CAGAAGAAGCAGGCTGTGGGAGG - Intronic
970947551 4:21712932-21712954 AAAGAGAAGCAGACACAGGGAGG - Intronic
971328012 4:25659745-25659767 GAGGCGAATCACAGTGAGGGAGG - Intronic
971388013 4:26159372-26159394 GAGGAGAAGCTGAGTTGGGGTGG + Intergenic
973288836 4:48449395-48449417 GAGGGAAAGCACGCTGAGGGAGG - Intergenic
973980411 4:56304077-56304099 GAGAAGAGGCAGAGGGAGGGAGG - Intronic
974658399 4:64854994-64855016 TAGGAGATGGAGACTGTGGGAGG - Intergenic
974891602 4:67890763-67890785 GAGGAGAAGTAAACTGATGTTGG - Intergenic
975336570 4:73183564-73183586 GAAGAGAAGGAGGCTGAGGTGGG - Intronic
975468484 4:74736488-74736510 GAGGAGGAGCTGACTGGGAGTGG - Intergenic
975685433 4:76916189-76916211 GAGGCGTAGCAGGCTGAGGCAGG - Intergenic
976235928 4:82896949-82896971 GAGGAGTAGAAGCCTGTGGGAGG - Intronic
976547925 4:86359403-86359425 GAGGGGTAGCAGAGGGAGGGAGG - Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977243232 4:94599451-94599473 GAGGGATAGCAGACTGAGTGAGG + Intronic
977531570 4:98206791-98206813 GAGAAGAGACAGAATGAGGGAGG + Intergenic
979213544 4:118135246-118135268 GAAGAGAAGCAGGCTTAGGAAGG + Intronic
979620319 4:122791334-122791356 GAGGAAAAGCTGACCCAGGGAGG - Intergenic
979704231 4:123702025-123702047 GAGGAGGAGCAGGGTCAGGGTGG + Intergenic
980046733 4:127997541-127997563 GAAGAGAGGCAGACTGAAGAGGG - Intronic
981048908 4:140292042-140292064 GAGGAGCAGGAGGCAGAGGGTGG - Intronic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
981386844 4:144141762-144141784 GCGGAGATGCAGACTTGGGGAGG + Intergenic
982314159 4:154014451-154014473 GAGGAGACCCAAGCTGAGGGAGG + Intergenic
982520662 4:156412643-156412665 GAGGAGAGGCAGAGTAATGGGGG + Intergenic
984403146 4:179292767-179292789 GAGCAGAGGAAAACTGAGGGAGG - Intergenic
984403153 4:179292813-179292835 GAGCAGAGGAAAACTGAGGGAGG - Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984995137 4:185423364-185423386 GAGGAAACTCATACTGAGGGTGG + Intronic
985045524 4:185936811-185936833 GAGCAGAAGCTGAGTGTGGGAGG - Intronic
985123744 4:186669670-186669692 GTGGAGAACGAGACTGAAGGGGG + Intronic
985140939 4:186840376-186840398 GAGGAGAAGGAGGGGGAGGGAGG - Intergenic
985182218 4:187277411-187277433 GAGGAGAAGGAGGCTGGGTGAGG - Intergenic
985520647 5:372663-372685 GAGGCGGTGCAGACGGAGGGTGG - Intronic
985926929 5:3026275-3026297 GAGGAGAAGCAGGGAGAGGCAGG - Intergenic
986050786 5:4088326-4088348 GAGGAGAAACAGACTGTGTGAGG - Intergenic
986055634 5:4134089-4134111 GGGCAGAAGGACACTGAGGGAGG - Intergenic
986517243 5:8576438-8576460 GAGGGGAAGGTGATTGAGGGAGG - Intergenic
986815737 5:11407994-11408016 CAGGAGAAGGAGATTGGGGGAGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987460822 5:18207624-18207646 GAGGAAAAGCTGAGTGATGGAGG - Intergenic
987887507 5:23830962-23830984 GAGTCCAAGCAGACTGGGGGTGG + Intergenic
988979656 5:36553941-36553963 AAGGAGAGGCAGACTCAGGGTGG + Intergenic
991252800 5:64582476-64582498 GAGGACAAGCAGAGTCAGAGGGG - Intronic
991924801 5:71694492-71694514 GAGGAGAAGTAGAAAAAGGGAGG - Intergenic
991956320 5:71998806-71998828 GAGGAGAAGGAGGCTGAGGTAGG + Intergenic
992399825 5:76402408-76402430 CAGGAAAAACAAACTGAGGGAGG - Intergenic
993852153 5:93023756-93023778 GAGGAGAAACAGCCTAAGGGAGG + Intergenic
994455712 5:100004786-100004808 GGAGAGAACCAGAGTGAGGGAGG - Intergenic
995245210 5:109927636-109927658 AAGGAGAAGGAGACTGTTGGAGG - Intergenic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
996118211 5:119642547-119642569 GAGGAGAGGCAGAAGGATGGAGG - Intergenic
996400978 5:123062117-123062139 GAGGTGAAGCAGATGGATGGTGG + Intergenic
997241670 5:132312424-132312446 CAGGTGAAGGGGACTGAGGGCGG - Intronic
997330825 5:133060032-133060054 GAGGAGAAGCAAACTGATTGTGG + Intronic
997744433 5:136286802-136286824 GAGGAGATGAAGACCGAGGAAGG - Intronic
998053239 5:139053736-139053758 GAGGAGATGGAGGCTGAGGGTGG - Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999273221 5:150310381-150310403 GATGAGAAGCAGGTTGAGAGAGG - Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
999802814 5:155053556-155053578 GAGGAGAAGAGGATGGAGGGCGG + Intergenic
1000302479 5:159968722-159968744 GGGAAGAAGTAGAGTGAGGGAGG - Intronic
1001285938 5:170424191-170424213 GGGTAGCAGGAGACTGAGGGAGG + Intronic
1001381851 5:171310769-171310791 GAGGAGAAGGAGAGTGCGAGAGG - Intronic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1001536876 5:172504242-172504264 GAGGAGAAGCAGACGCAAGGTGG + Intergenic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001696708 5:173675676-173675698 GAGGGGAAGGAGACTTGGGGTGG - Intergenic
1001945655 5:175775392-175775414 GAGGGGAAGGAGAGTGAAGGAGG - Intergenic
1001960083 5:175874716-175874738 GAGGGGAGGCAGAGAGAGGGAGG + Intronic
1002465070 5:179404136-179404158 GAGGAGGAGCAGATGGATGGGGG + Intergenic
1002664683 5:180814423-180814445 GAGGAGGAGCAGCCAGAGGAGGG - Intronic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003756367 6:9125557-9125579 GAAGAGGAGCAGACAGAGAGGGG + Intergenic
1003849621 6:10208508-10208530 GAGGAGGAGCAGGCAGAGGAGGG + Intronic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1004233321 6:13852025-13852047 GAGGAGAGGGAGAGGGAGGGAGG - Intergenic
1004356438 6:14933507-14933529 GGGGAGAACAAGGCTGAGGGTGG + Intergenic
1004636105 6:17469257-17469279 GAAGAGAAGCACCCGGAGGGTGG + Intronic
1004726492 6:18316058-18316080 GGGGAGAAAGAGACAGAGGGAGG - Intergenic
1004931180 6:20464576-20464598 GAGCAGAAGCTGACTGCTGGTGG - Intronic
1005102792 6:22191389-22191411 GAGGACAAGCTGAGTGAGGCAGG + Intergenic
1005799399 6:29405161-29405183 GAGGAACAGGACACTGAGGGTGG + Intronic
1007412721 6:41674284-41674306 GAGGAGAGGAAATCTGAGGGTGG - Intergenic
1007484395 6:42170852-42170874 GTGGAGAAGCTGACTGAAGCAGG + Intronic
1007851205 6:44804293-44804315 GAGGAAATGCAGCCTGAGGGTGG - Intergenic
1008480547 6:51981455-51981477 GAGGCGTAGCAGGCTGAGGCAGG - Intronic
1010486429 6:76420088-76420110 GAGGATAAGTAAACTGATGGAGG + Intergenic
1010505068 6:76646998-76647020 TACCAGAAGCAGCCTGAGGGAGG - Intergenic
1011083317 6:83512393-83512415 GAGGAGACGGAGAGGGAGGGCGG - Intergenic
1011792858 6:90916537-90916559 GAAGAGTAGCAGAGTGAAGGGGG - Intergenic
1012306237 6:97661546-97661568 AAGGAAAAGAAGACTGAGAGAGG - Intergenic
1012399922 6:98834651-98834673 GAGGAGAAAGAGAGCGAGGGCGG + Exonic
1012553152 6:100482526-100482548 GAGGGGCAGCAAAGTGAGGGTGG + Intergenic
1012635345 6:101531706-101531728 GAGGAGAAACAGACTGCATGTGG - Intronic
1012719166 6:102719614-102719636 GAGGAGAAGCAGACAAGGAGGGG - Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1013700904 6:112768239-112768261 GAGGAGAAGCAGACAGGAGGTGG - Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1015195286 6:130518784-130518806 GAAGAGCAGGGGACTGAGGGGGG + Intergenic
1017009427 6:150053344-150053366 GAGGAGCTGGAGACTCAGGGAGG - Intergenic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017188215 6:151624002-151624024 GGGGAGAAGAAGACAGAGGTAGG - Intergenic
1018187579 6:161280297-161280319 GGTGAGAAGCAGACTGGAGGGGG - Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1021510568 7:21428273-21428295 GCGGCGAAGGAGACTGAGGGGGG - Intronic
1022091557 7:27110980-27111002 GGGGAGAAGGAGAATGAGTGAGG + Intronic
1022437964 7:30408308-30408330 AAGGAAAAGCAGACGGATGGTGG - Intronic
1022506391 7:30910695-30910717 GAGGAGAGGCAGAGAGCGGGAGG - Intergenic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1022665902 7:32410346-32410368 GAGGAAAAGGAGGGTGAGGGCGG + Intergenic
1022899356 7:34787723-34787745 GAGGAGAGGGAGACAGATGGAGG + Intronic
1023026342 7:36053865-36053887 GAGGAGAAGAAGAATGTAGGAGG - Intergenic
1023412171 7:39899040-39899062 GAGGAGAAGTAGGAGGAGGGTGG - Intergenic
1023581195 7:41684973-41684995 GATGAGAAACAGACTGAATGTGG - Intergenic
1023650257 7:42362010-42362032 AAGGAGAAGCTCACTGAAGGTGG - Intergenic
1023795660 7:43789805-43789827 TAGGAGATGGAGACTCAGGGTGG - Intronic
1024128109 7:46321623-46321645 GAGGAGCACCAGAGTGTGGGAGG + Intergenic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024436793 7:49365884-49365906 GAGAAGAATGAGAGTGAGGGCGG - Intergenic
1024786145 7:52910548-52910570 GAGGAGAAGAAGACCGATGGAGG + Intergenic
1025887775 7:65614523-65614545 GAGGAGGAGCAGATGGAAGGAGG - Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026277303 7:68891292-68891314 GGGGAGAAGCAGACATGGGGAGG + Intergenic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1026767068 7:73166830-73166852 GAGGAGGAGGAGAGGGAGGGGGG - Intergenic
1026837677 7:73649262-73649284 GAGGAGAGGAAGAGAGAGGGGGG - Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1029151921 7:98486322-98486344 GAGGTGAAGCTGGGTGAGGGGGG - Intergenic
1029444963 7:100606652-100606674 AAGGGGAAACAGACTGAAGGGGG + Intronic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1031648210 7:124253338-124253360 GAAGAGCAGCAGTCTGAGGGAGG - Intergenic
1031854602 7:126907187-126907209 GAGGAGGAGCAGATGGAAGGAGG + Intronic
1031936816 7:127743509-127743531 GAAGAGAAGGAGAGAGAGGGTGG - Intronic
1032090919 7:128911057-128911079 CAGAAGAAGCAGACTGAGCTGGG + Intergenic
1032427590 7:131833946-131833968 GAGCAGAAGCCGACTGTGGAAGG + Intergenic
1032955140 7:136961862-136961884 GAGGAGAAGGAGACGTGGGGAGG + Intronic
1033332524 7:140428334-140428356 GAGGAGCAGCAGAATGCGGCTGG - Intergenic
1033668624 7:143468056-143468078 GAGGTGAGGAAGACTGAGAGAGG - Intergenic
1034087795 7:148335967-148335989 GAAGGGAAGGAGAATGAGGGAGG - Intronic
1034549955 7:151814106-151814128 GAGGAGAGACAGACTCAGAGAGG + Intronic
1034574778 7:151987600-151987622 GAGGAGAGCAAGACTGGGGGTGG + Intronic
1035110784 7:156479888-156479910 AAGGAGATGAAGACAGAGGGAGG + Intergenic
1035471207 7:159109926-159109948 GGAGAGAAGCAGAGTGAGGCAGG + Intronic
1036129686 8:6097584-6097606 GAGGAGAGAGAGACCGAGGGGGG + Intergenic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1038056638 8:23864733-23864755 GATGAGAATCAGACTGAGCCTGG + Intergenic
1038242374 8:25821800-25821822 GAGGAGGAGGCCACTGAGGGAGG + Intergenic
1038650100 8:29394713-29394735 GAGTAGAAAGACACTGAGGGAGG + Intergenic
1038942382 8:32319444-32319466 GAGGAGAAGAAGGCTGAGAGAGG + Intronic
1039118293 8:34116852-34116874 GAGGAGAAAGAGAATCAGGGAGG + Intergenic
1040453582 8:47573595-47573617 GAGGAGAAGCAAAGTCTGGGAGG + Intronic
1040575163 8:48645684-48645706 GAGGAGCAGGAGACAGAGGAAGG - Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041602146 8:59731749-59731771 GGGGAGAAGAAGAGGGAGGGTGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042171938 8:66000092-66000114 AAGGAGACACAGACAGAGGGAGG - Intergenic
1043086172 8:75836170-75836192 TAGTAGAAGAAGACTGAGGGAGG - Intergenic
1045866064 8:106866913-106866935 GAGGAGGCCCAGACAGAGGGAGG + Intergenic
1046048058 8:108986856-108986878 GAGGGCAAGCAGAATCAGGGTGG - Intergenic
1047471665 8:125179790-125179812 GAGGAGGTGAAGACTGAGTGGGG - Intronic
1047599568 8:126412709-126412731 GAGTGGAAGCAGTGTGAGGGAGG + Intergenic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048317697 8:133374527-133374549 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048317703 8:133374578-133374600 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048878166 8:138852752-138852774 GAGGAGAACCAGGGAGAGGGAGG + Intronic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049100767 8:140577596-140577618 GAGGAGGAGCAGCTGGAGGGAGG + Intronic
1049325266 8:142018249-142018271 GAGGACAAGCAGCGGGAGGGGGG - Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049428315 8:142547498-142547520 GAGGACACGCAGACTCCGGGTGG + Intergenic
1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG + Intergenic
1049568994 8:143359658-143359680 GGGGTGAAGCACACGGAGGGGGG + Intronic
1049753100 8:144294934-144294956 GTTGAGAAGCTGGCTGAGGGAGG - Intronic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052337175 9:27331825-27331847 GAGAAAAAGGAGACTGAGTGTGG + Intronic
1052540453 9:29804801-29804823 GAGGAGAAGCAGATGGATGTGGG - Intergenic
1052736172 9:32344796-32344818 GTGGAGAGGCAGCCTGTGGGAGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053523225 9:38803182-38803204 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054195453 9:62027601-62027623 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG + Intergenic
1055150677 9:72995258-72995280 GAGGAGAAGGAGAGAGATGGGGG - Intronic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1056126108 9:83537850-83537872 GAGGGGAAGGAGACTGGGCGCGG + Intronic
1056701799 9:88917446-88917468 GGTGAGAAGGAGGCTGAGGGTGG + Intergenic
1056760470 9:89411075-89411097 GAGGAGAGGCAGAGAGAGCGGGG + Intronic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1057369729 9:94459544-94459566 GAGGATGAGCAGAATGATGGCGG - Exonic
1057479686 9:95434740-95434762 CATGAGAAGCAGACTGTGAGAGG - Intergenic
1057537748 9:95931223-95931245 GGGCAGAAACAGACTGAGAGGGG - Intronic
1057758124 9:97853204-97853226 GAGGGGAAGCCGGCGGAGGGAGG + Intergenic
1059730886 9:117055754-117055776 GAGGGCAAGGGGACTGAGGGAGG + Intronic
1059914406 9:119083198-119083220 GAGGAGATTGAGGCTGAGGGAGG - Intergenic
1060556764 9:124511985-124512007 GGGGAGACGCAGTCGGAGGGAGG + Intergenic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1060975528 9:127762709-127762731 GGGCAGAAGCTGACTGTGGGTGG - Intronic
1060998987 9:127891743-127891765 GAGGGGAAGAAGACAGGGGGAGG + Intronic
1061025881 9:128049146-128049168 GTGGAGAAGTTGGCTGAGGGCGG + Intergenic
1061041352 9:128142632-128142654 GAAGAGAAGGAGACAGTGGGAGG + Intergenic
1061213670 9:129207947-129207969 GAGGAGATGGAGACTCAGAGAGG + Intergenic
1061282020 9:129602885-129602907 GAGGAGGGGGAGAATGAGGGAGG + Intergenic
1061799807 9:133107543-133107565 GATGGGGAGCAGACTGAGGCGGG - Intronic
1061910422 9:133719452-133719474 GAGGAGAGGGAGACTGAGCAAGG + Intronic
1061953112 9:133947368-133947390 GAGGAGACCGAGACTCAGGGAGG + Intronic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062606522 9:137351066-137351088 GTGGAGAAGCAGATTCTGGGCGG - Exonic
1185431490 X:14066-14088 GAGGAGCGGCAGTCTGGGGGTGG - Intergenic
1185432675 X:18802-18824 GAGGAGCGGCAGTCTGGGGGTGG - Intergenic
1185440724 X:226463-226485 GAGGAGCGGCAGTCTGGGGGTGG - Intergenic
1185442026 X:231624-231646 GAGGAGCGGCAGTCTGGGGGTGG - Intergenic
1185535127 X:854999-855021 GAGGAGAAGAAGACAGAGAAAGG - Intergenic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1186312734 X:8338369-8338391 GACGAAAAGCAGAATAAGGGAGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1187622963 X:21079007-21079029 GAGGAGATGAAGCCTGAGGAGGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188626657 X:32293414-32293436 GAAGAGAACCAGAAGGAGGGAGG + Intronic
1188702095 X:33277663-33277685 AAGGAGTAGGAGGCTGAGGGTGG - Intronic
1189346853 X:40248337-40248359 GGAGAGAAGCAGAGTGGGGGTGG - Intergenic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1190765580 X:53473196-53473218 GAGGTAGAGCAGACTGAGGTGGG + Intergenic
1190879728 X:54483723-54483745 GAGGAGAAGCAGACCGGGGCTGG - Intronic
1190959850 X:55235116-55235138 GAGGGCAAGCAGAATCAGGGTGG - Intronic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191871149 X:65746688-65746710 GAGGTGAGGAAGATTGAGGGAGG - Intergenic
1191936984 X:66437113-66437135 GAGGTGAAGAAGACCGATGGTGG + Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1192275302 X:69623769-69623791 GTGGAGAAGCAGACCCAGAGGGG + Intronic
1193028132 X:76867679-76867701 GAGAAGAAATAGACTGGGGGGGG + Intergenic
1193236484 X:79113624-79113646 AAGCAGAAGCAGGCTGAAGGTGG + Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194973834 X:100373289-100373311 TAGGAGAAGGAGGCTGGGGGAGG - Intronic
1195318576 X:103702287-103702309 GAGGAAACTGAGACTGAGGGAGG + Intergenic
1195632047 X:107067410-107067432 GAGGAAAAACTAACTGAGGGAGG - Exonic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196122718 X:112067737-112067759 GAAGAGAGGCAGACTCAGAGAGG + Intronic
1196466931 X:115982429-115982451 GAGGAGAAGCTAACTTTGGGAGG + Intergenic
1197862139 X:130982385-130982407 GATGAGAGGCAGAGTGAGAGGGG + Intergenic
1197864832 X:131006809-131006831 GAAGAGGAGCAGATTGGGGGTGG + Intergenic
1197887576 X:131234616-131234638 GAGGAGAAGGTGTCTGAGGAGGG - Intergenic
1198631261 X:138641318-138641340 GAGGAGAAGAAGAGAGAGGTGGG - Intronic
1198685867 X:139227412-139227434 GAGGAGGAGGAGGCTGAAGGAGG + Intergenic
1199086194 X:143633628-143633650 GGAGAGAAGCGGCCTGAGGGGGG + Intronic
1199249582 X:145644626-145644648 GAGGGGAAGGAGAGAGAGGGAGG + Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic
1201312742 Y:12611861-12611883 GAGGACGAGCAGAAAGAGGGTGG + Intergenic