ID: 1086320372

View in Genome Browser
Species Human (GRCh38)
Location 11:85640661-85640683
Sequence GTTTGCAAATGTAATCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086320367_1086320372 9 Left 1086320367 11:85640629-85640651 CCTGTGAATATGTCCTTATTTGG No data
Right 1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG No data
1086320371_1086320372 -4 Left 1086320371 11:85640642-85640664 CCTTATTTGGAAATAGGGTGTTT No data
Right 1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG No data
1086320366_1086320372 22 Left 1086320366 11:85640616-85640638 CCTAAGCTCAGTACCTGTGAATA No data
Right 1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086320372 Original CRISPR GTTTGCAAATGTAATCAAGT TGG Intergenic
No off target data available for this crispr