ID: 1086322372

View in Genome Browser
Species Human (GRCh38)
Location 11:85664490-85664512
Sequence GGCCCCGGCGAGCTAAGCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 126}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086322359_1086322372 26 Left 1086322359 11:85664441-85664463 CCCTCTCCACAGGCCGCCGCTAT 0: 1
1: 0
2: 1
3: 9
4: 84
Right 1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 126
1086322358_1086322372 27 Left 1086322358 11:85664440-85664462 CCCCTCTCCACAGGCCGCCGCTA 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 126
1086322368_1086322372 -5 Left 1086322368 11:85664472-85664494 CCGCCAGACGAGGAGAGAGGCCC 0: 1
1: 1
2: 3
3: 18
4: 229
Right 1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 126
1086322362_1086322372 13 Left 1086322362 11:85664454-85664476 CCGCCGCTATCCGAGCCTCCGCC 0: 1
1: 0
2: 1
3: 15
4: 249
Right 1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 126
1086322360_1086322372 25 Left 1086322360 11:85664442-85664464 CCTCTCCACAGGCCGCCGCTATC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 126
1086322366_1086322372 -2 Left 1086322366 11:85664469-85664491 CCTCCGCCAGACGAGGAGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 126
1086322365_1086322372 3 Left 1086322365 11:85664464-85664486 CCGAGCCTCCGCCAGACGAGGAG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 126
1086322363_1086322372 10 Left 1086322363 11:85664457-85664479 CCGCTATCCGAGCCTCCGCCAGA 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 126
1086322361_1086322372 20 Left 1086322361 11:85664447-85664469 CCACAGGCCGCCGCTATCCGAGC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 126
1086322369_1086322372 -8 Left 1086322369 11:85664475-85664497 CCAGACGAGGAGAGAGGCCCCGG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG 0: 1
1: 0
2: 1
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086322372 Original CRISPR GGCCCCGGCGAGCTAAGCCC GGG Exonic
900191236 1:1353198-1353220 GCCCCCGACGAGCAGAGCCCTGG + Exonic
900654222 1:3747142-3747164 GGCCCCGGGGACCCAAGGCCGGG + Intergenic
901319212 1:8329590-8329612 GGCACCGGCCAGCCCAGCCCTGG - Intronic
901525946 1:9823632-9823654 GGGCCGCGCGAGGTAAGCCCCGG - Exonic
902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG + Intergenic
904128640 1:28259926-28259948 GGCCCCGGAGAGGTAAGCGGCGG + Exonic
904301922 1:29559719-29559741 GGCCCTGGGGAGCTCTGCCCAGG + Intergenic
904497494 1:30895434-30895456 GGCCTCTGGGAGCTGAGCCCTGG - Intronic
912301861 1:108526094-108526116 GGCACCTGCCAGCTCAGCCCTGG - Intergenic
912844652 1:113068743-113068765 GGCGCCGGCGAGCGCCGCCCGGG + Intergenic
915238299 1:154501924-154501946 GGCCCCGGCCGGCTCGGCCCAGG + Exonic
915344149 1:155190369-155190391 GGCCCCGGAGAGTTCCGCCCCGG - Intronic
918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG + Exonic
1063553251 10:7053350-7053372 GGCCCGGGCTAGCTGAGCCAGGG - Intergenic
1063663845 10:8050529-8050551 GGCCCTGGCGAGCTGGGCCTGGG - Intergenic
1064255730 10:13741567-13741589 GGCCCCAGGGAGCTCAGCCCGGG - Intronic
1067436899 10:46284792-46284814 GGCTCCGGGGAGCTGAGCCGGGG - Intergenic
1068955359 10:62815617-62815639 CGCCCCGGCGCGCCCAGCCCCGG - Intronic
1070793496 10:79203509-79203531 GGCCCCTGCCAGCTGAGCCAAGG - Intronic
1070960973 10:80499994-80500016 GGGCCAGGCCAGGTAAGCCCTGG - Intronic
1071568673 10:86684693-86684715 GGCCCCGGCCAGCCTGGCCCTGG - Intronic
1076405016 10:130205865-130205887 GGCCCCAGCATGCTAAGGCCAGG - Intergenic
1076908155 10:133373432-133373454 GGCCCTCGCGAGATCAGCCCGGG + Exonic
1077454748 11:2671848-2671870 TGCCCCAGGGAGCCAAGCCCTGG + Intronic
1077537267 11:3130394-3130416 GGCCCCCCCCAGCAAAGCCCAGG - Intronic
1079131163 11:17747663-17747685 GGCCCCAGCCAGCTGAGCTCAGG + Intronic
1083333964 11:61912241-61912263 CGCCCCGGGGAGCCAGGCCCTGG - Intronic
1083560626 11:63670918-63670940 GGCCCCGCCGAGCCCCGCCCTGG - Intronic
1084095057 11:66905851-66905873 GGCCCTGGCGAGCTTAGCCCAGG + Intronic
1084122076 11:67075463-67075485 GGCCCCAGTGAGCTAGGACCAGG + Intergenic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1088796294 11:113269209-113269231 GGCCCCAGAGAGCTGAGTCCAGG + Intronic
1091090185 11:132763757-132763779 GGCCCTGCCTAGCTAAGCACAGG + Intronic
1102289287 12:111685815-111685837 GGCCCCGGCGGGCTCAGGCGAGG + Exonic
1106194772 13:27483773-27483795 GGCCCCTGTGAGGGAAGCCCAGG - Intergenic
1119608939 14:76045546-76045568 AGCCCCGGGCTGCTAAGCCCTGG - Intronic
1121535721 14:94689608-94689630 GGCCCCGGCCAGCCGCGCCCAGG - Intergenic
1122178513 14:99938073-99938095 GGCCACGGCCAGGCAAGCCCAGG - Intronic
1122278506 14:100607853-100607875 GTCCCCAGCAGGCTAAGCCCCGG + Intergenic
1122602400 14:102928293-102928315 AGCCCGGGCGAGCTCAGGCCCGG - Intronic
1122793748 14:104195412-104195434 GGGCCCAGCAAGCTAAGGCCCGG - Intergenic
1124318655 15:28694278-28694300 GGCCACGGGGAGCTGAGACCGGG - Intergenic
1125510602 15:40290566-40290588 GGCCCAGGAGAGGTGAGCCCTGG - Exonic
1129184865 15:73899885-73899907 GGCCCCAGGGAGCTCAGCCTGGG + Intergenic
1129364558 15:75046401-75046423 GGCCTCTGGGAGCTAAGCCCCGG + Intronic
1129382666 15:75177971-75177993 GGCCCCAGTGAGCCAGGCCCTGG + Intergenic
1132087059 15:98917075-98917097 GGCCCCAGCAACCCAAGCCCTGG - Intronic
1133031422 16:3013018-3013040 GGCCTGTGCGAGCTCAGCCCAGG + Exonic
1133303244 16:4795660-4795682 GTCCCCGCTGAGCTGAGCCCAGG + Intronic
1137614179 16:49837177-49837199 GGCCCTGGCGAGCTGAGGCCTGG + Intronic
1139840109 16:69871844-69871866 GCAACCGGCGAGCAAAGCCCCGG + Exonic
1140442557 16:74999045-74999067 AGCGCCGGCGAGCGCAGCCCGGG + Exonic
1142195280 16:88736714-88736736 GGCCCAAGCGGGCTGAGCCCAGG - Exonic
1142365397 16:89647295-89647317 GGCCCAGGTGACCAAAGCCCTGG - Exonic
1143116634 17:4584993-4585015 GGCCGCGGCCAGGTGAGCCCGGG + Exonic
1147588378 17:41666030-41666052 AGCCCCGCACAGCTAAGCCCGGG + Intergenic
1147623298 17:41882732-41882754 AGCCCCGCCCAGCTGAGCCCAGG + Intronic
1149996655 17:61409354-61409376 GGGCCGGGCGAGCCAAACCCGGG - Exonic
1151342531 17:73481144-73481166 AGCCCAGGCGAGCTGAGCACGGG + Intronic
1151507879 17:74541352-74541374 CGCCCCGGCCAGCTAAGCCTCGG - Exonic
1151566334 17:74900679-74900701 GGCCCAGGAAGGCTAAGCCCTGG - Intergenic
1160745407 19:709027-709049 GGCCGGGGCGGGCTAAGGCCTGG - Intergenic
1161224760 19:3138351-3138373 GGCCCCGTTGGCCTAAGCCCGGG + Intronic
1163554500 19:17984461-17984483 GGCTCAGGTGATCTAAGCCCTGG + Intronic
1163563645 19:18036413-18036435 GGCCCCTCTGAGCTCAGCCCCGG + Intergenic
1163655619 19:18543400-18543422 GCCCCCGGCGCGCTAGCCCCCGG + Intronic
1163906098 19:20150754-20150776 GGCGCCGGCGAGCGCCGCCCGGG - Intergenic
1165072756 19:33265048-33265070 GGCCCCCTGGAGCTAAGGCCAGG - Intergenic
1165419501 19:35715953-35715975 GGCCCCGCACAGCTCAGCCCTGG + Exonic
1165932656 19:39369987-39370009 GGCCCTGCAGAGCTAGGCCCTGG + Exonic
1167096145 19:47375965-47375987 GGCCGCTGCCAGCTCAGCCCAGG + Exonic
925419953 2:3703721-3703743 GGCCCCGGCGAGCGAGGAGCGGG + Exonic
925610400 2:5696845-5696867 GGCCCCGGGGAGCTGATTCCGGG - Exonic
932564054 2:72894596-72894618 CACCCCAGAGAGCTAAGCCCTGG + Intergenic
934713869 2:96532037-96532059 GGGCCCTGCCAGCTGAGCCCTGG - Intergenic
937919703 2:127120544-127120566 GGCGCCGGCGAGCGCCGCCCGGG - Intergenic
944565610 2:200987391-200987413 GGCTCCGGCGAGCCATGCTCAGG + Intronic
946161355 2:217837911-217837933 GGCTCCGGGGAGCTAAGGCCTGG - Intronic
946397270 2:219449228-219449250 GGGCCCGGCGACCTTTGCCCTGG - Exonic
1172106228 20:32518756-32518778 GGCCCCTGCGGCCTAAACCCTGG + Intronic
1174873879 20:54207787-54207809 GGCCCCGCCGCGCTGAGCCTTGG + Intergenic
1175419923 20:58824990-58825012 AGCCCCAGCGAGATGAGCCCGGG - Intergenic
1175859483 20:62142852-62142874 CGCCCCGGCGAGCAGAGGCCGGG - Intronic
1175911354 20:62406884-62406906 GGGCCCGGCCAGGTCAGCCCAGG - Intronic
1176178998 20:63740900-63740922 GGCCCCAGCGAGCCAGGCCAGGG - Intronic
1178944611 21:36936543-36936565 GGCCCCGTCCGGCTCAGCCCCGG - Exonic
1179499284 21:41796909-41796931 GGCCCCGGCCAGCTTTGTCCGGG + Intergenic
1181311411 22:21946802-21946824 GGCTCAGGCCTGCTAAGCCCTGG + Intronic
1183481760 22:38069147-38069169 GGCCCCGGGGACTCAAGCCCAGG + Intronic
1183845094 22:40536394-40536416 GGCGCCGGCGAGCGCCGCCCGGG + Intronic
953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG + Exonic
953492637 3:43364071-43364093 GGCCCCAGTGAGTTAAGCCCAGG - Intronic
954887760 3:53891646-53891668 GGCCGCGGGGCGCTAAGCCCGGG + Intronic
965648346 3:170908348-170908370 GGCCGGGCCGAGCTGAGCCCTGG - Intronic
968835904 4:2963969-2963991 GTGCCCGGCGAGCTATGCACGGG + Exonic
969304568 4:6318377-6318399 GCCCCCGCCAAGCCAAGCCCCGG + Intergenic
973774592 4:54232190-54232212 GGACCCGGCGAGTTAGACCCGGG - Intronic
983254095 4:165379136-165379158 AGCGCCGGCGGGCTAAGCCCAGG + Exonic
985697182 5:1347185-1347207 GACCCAGGCCAGCTAAGCCTGGG - Intergenic
998377040 5:141698142-141698164 GGCCCCTGCGAGCTCAGCCAAGG + Intergenic
1001824092 5:174732193-174732215 GCCCCGGGCGATCTCAGCCCGGG + Intergenic
1007477321 6:42127574-42127596 GGCCCCTGAGAGCTCAGACCAGG + Intronic
1014057252 6:117030559-117030581 GGCCCAGGCCAGCCCAGCCCTGG + Intergenic
1016584911 6:145673625-145673647 GGACCCGCCGAGCTAGGCACGGG - Intronic
1018892313 6:167990681-167990703 GCCTCCGGGGAGCTAAGCCCAGG - Intergenic
1019321410 7:417083-417105 GGGCCCGGGGAGCGAACCCCAGG - Intergenic
1019577075 7:1742694-1742716 GGCCTCGGGGAGCTAACCCAGGG - Intronic
1019603579 7:1897483-1897505 TGCCCCGGTGAGCTAACCTCCGG - Intronic
1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG + Intronic
1023822266 7:43986770-43986792 GGCCCTGGCGAGAGCAGCCCGGG + Intergenic
1024242032 7:47443113-47443135 GGTGCCGGTGAGCTCAGCCCTGG + Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1029436196 7:100565300-100565322 AGCGCTGGCGAGCTAGGCCCAGG - Exonic
1029563825 7:101321719-101321741 GGCTCCGGCCGGCTAAGCCGCGG - Exonic
1029750531 7:102540184-102540206 GGCCCTGGCGAGAGCAGCCCGGG + Intronic
1029768484 7:102639292-102639314 GGCCCTGGCGAGAGCAGCCCGGG + Intronic
1031164656 7:118214121-118214143 GGCCCCGTGGAGCTGAGCCCAGG - Intergenic
1033654364 7:143362808-143362830 GGCCGCGGCGAGCCGAGCCGGGG - Intergenic
1033741883 7:144282426-144282448 TGCCGCGGAGAGCTAGGCCCGGG + Intergenic
1033752018 7:144367188-144367210 TGCCGCGGAGAGCTAGGCCCGGG - Exonic
1034534621 7:151719255-151719277 GGCCCCGGCACGCTCAGCCCTGG + Intronic
1035587333 8:786115-786137 GGCCCAGCTGAGCTAAGCTCAGG - Intergenic
1037879442 8:22565817-22565839 GGCGCCGGCGAGCTCTGCGCGGG - Exonic
1048375339 8:133818152-133818174 GGCCAGGGCGAGCTGAGACCAGG - Intergenic
1048402646 8:134086409-134086431 GGACCTGGCCAGCAAAGCCCAGG + Intergenic
1049156858 8:141072718-141072740 AGCCCCGGCGAGCAAGGCCTGGG + Intergenic
1049707832 8:144050995-144051017 GAAGCCGCCGAGCTAAGCCCTGG + Intergenic
1055771362 9:79720183-79720205 GGCCCCCGCCTGCTATGCCCTGG + Exonic
1055934352 9:81590893-81590915 GGCCCCCGCCTGCTACGCCCTGG - Exonic
1056985617 9:91361733-91361755 GGGCCCGGCGATCTGGGCCCAGG - Exonic
1060182873 9:121546089-121546111 GTCCTCGGCCAGCTCAGCCCAGG + Intergenic
1061882897 9:133576924-133576946 GGCCCCGCCGGGCAGAGCCCTGG + Intergenic
1061996093 9:134186873-134186895 GACACCGGAGAGCTGAGCCCTGG - Intergenic
1187976708 X:24710095-24710117 GGCGCCGGCGAGCGCCGCCCGGG - Intronic
1190246922 X:48696879-48696901 GGCCCCGGCGTCCGAGGCCCCGG + Intronic
1190326224 X:49208648-49208670 AGCCCCGGCGAGCTGAGGGCTGG + Exonic
1192393635 X:70755944-70755966 GGACCCGCCGAGCCAAGCACGGG - Intronic
1195069343 X:101264179-101264201 GGACTCTGCGAGCTGAGCCCTGG - Exonic
1196404627 X:115348295-115348317 GGCGCCGGCGAGCGCCGCCCGGG - Intergenic
1199721321 X:150544577-150544599 GGCCTCGGTGAGCCAGGCCCTGG - Intergenic
1200224462 X:154409469-154409491 GGGCCTGGCGAGCGAAGCTCGGG - Exonic