ID: 1086322386

View in Genome Browser
Species Human (GRCh38)
Location 11:85664524-85664546
Sequence AGTCCGGTTGCCTGGGGTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 197}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086322379_1086322386 -7 Left 1086322379 11:85664508-85664530 CCGGGGTCCAGGTGCCAGTCCGG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322368_1086322386 29 Left 1086322368 11:85664472-85664494 CCGCCAGACGAGGAGAGAGGCCC 0: 1
1: 1
2: 3
3: 18
4: 229
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322378_1086322386 -6 Left 1086322378 11:85664507-85664529 CCCGGGGTCCAGGTGCCAGTCCG 0: 1
1: 0
2: 1
3: 8
4: 209
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322375_1086322386 8 Left 1086322375 11:85664493-85664515 CCCGGCGAGCTAAGCCCGGGGTC 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322374_1086322386 9 Left 1086322374 11:85664492-85664514 CCCCGGCGAGCTAAGCCCGGGGT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322376_1086322386 7 Left 1086322376 11:85664494-85664516 CCGGCGAGCTAAGCCCGGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322369_1086322386 26 Left 1086322369 11:85664475-85664497 CCAGACGAGGAGAGAGGCCCCGG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086322386 Original CRISPR AGTCCGGTTGCCTGGGGTCC AGG Exonic
900190990 1:1352134-1352156 AGGCCCGTGGCCCGGGGTCCTGG - Intergenic
901127241 1:6938323-6938345 AGACTGGTTGGCTGGGGTCAGGG + Intronic
902053751 1:13583847-13583869 TGTCCGGCTGCCTAGGGTCTGGG + Exonic
902243236 1:15102444-15102466 AGTCCTGTTGGGTGGGGTGCTGG + Intronic
902747350 1:18482615-18482637 TGTCCGGCTGCCAGGGGCCCGGG + Exonic
903181310 1:21606260-21606282 AGACCAGATGCCTGGGCTCCTGG - Intronic
903535581 1:24064222-24064244 AATCCGGAGGCCTGGGCTCCAGG + Intronic
903542015 1:24101882-24101904 AGTGGGGTGGCCTGGGGTCCTGG + Intronic
904827595 1:33284228-33284250 AGTCCGGTTTCCTGGAGGCCCGG + Intronic
913362116 1:117992878-117992900 AATCCTGTTGCATGGTGTCCTGG + Intronic
915095119 1:153457218-153457240 TGTCCTGTGGCCTGGGCTCCAGG - Intergenic
917821184 1:178765864-178765886 AGTCTGGCTGCCTGTGGGCCGGG - Intronic
918744418 1:188182084-188182106 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
1062813821 10:484800-484822 AGGCCGGTTCCCTGCGGTGCTGG + Intronic
1064922136 10:20531117-20531139 AGTTAGGCTGCCTGGGGTCAGGG + Intergenic
1065936183 10:30522541-30522563 AGTCTGGCTGCCTGTGGGCCAGG + Intergenic
1066331370 10:34427199-34427221 AGTCTGGCTGCCTGTGGGCCGGG + Intronic
1066987133 10:42477446-42477468 AGTCCGGGAGTCTGGGGTGCCGG + Intergenic
1067478953 10:46583322-46583344 AGGCCGGTGCCCTGGGCTCCTGG + Intronic
1067615785 10:47758479-47758501 AGGCCGGTGCCCTGGGCTCCTGG - Intergenic
1067634155 10:47990457-47990479 AGTCTGCTTCCCTGGGGGCCAGG + Intergenic
1069752290 10:70752273-70752295 AGCCCCGCTGCCTGGGGCCCGGG - Intronic
1070168150 10:73913286-73913308 CCTCCGGTTGTCTGGGTTCCTGG - Exonic
1070913610 10:80138641-80138663 GGTCAGGGTGCCTGAGGTCCAGG + Intronic
1070948844 10:80414654-80414676 ATTCCTGTTGACTTGGGTCCAGG + Intronic
1071516629 10:86301988-86302010 AGTCAGGTGGCCTGGGAGCCAGG - Intronic
1073003312 10:100301580-100301602 AGTCTGGCTGCCTGTGGGCCGGG - Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1076478520 10:130768877-130768899 AGTCTGGCTGCCTGTGGGCCAGG - Intergenic
1076507346 10:130986932-130986954 ATTCTGGGTGCCTGGGGGCCTGG + Intergenic
1076569361 10:131422253-131422275 TGACTGGTTGCCTGGGATCCTGG - Intergenic
1076720442 10:132390043-132390065 AGTGTGGTGGCCTGGGGCCCAGG - Intergenic
1076777459 10:132705657-132705679 AGTCTGCTTACCTGGGGCCCGGG + Intronic
1077851284 11:6076456-6076478 AGTCTGGTTGCCTGTGGGCTGGG + Intergenic
1081237156 11:40659414-40659436 TGTCCTGAAGCCTGGGGTCCAGG + Intronic
1083306339 11:61764001-61764023 AGTCTGTGTGCCTGGGTTCCAGG - Intronic
1084474041 11:69378668-69378690 ATTCAGGCTGCGTGGGGTCCCGG - Intergenic
1084684794 11:70687244-70687266 AGTTCAGGTGCCAGGGGTCCTGG - Intronic
1084782923 11:71422966-71422988 AGTCCTGGAGCCAGGGGTCCTGG - Intergenic
1084857377 11:71997770-71997792 TGTCCTGTGGCCTGGGGGCCTGG + Intergenic
1085386544 11:76161258-76161280 AGTCCAGTGGGATGGGGTCCAGG + Intergenic
1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG + Exonic
1086754222 11:90538689-90538711 AGCCCAGGTGCCTGGGGTCCAGG + Intergenic
1087141398 11:94768735-94768757 GGTCCAGTTGCCTGCGGGCCGGG + Intronic
1091998433 12:5013896-5013918 TGTCAGGTTTCCTTGGGTCCAGG + Intergenic
1094377151 12:29802179-29802201 AGTCTGGCTGCCTGTGGGCCAGG - Intergenic
1096156173 12:49342569-49342591 AGACCGGAGGCCCGGGGTCCAGG + Intergenic
1102079848 12:110089161-110089183 AGTCAGGCTTCCTGGAGTCCAGG - Intergenic
1102506716 12:113388680-113388702 AGTCCGGTGGCCTTGGGACGGGG - Exonic
1104358643 12:128111619-128111641 GGTCCGGAAGCCTGGGATCCAGG - Intergenic
1106132850 13:26953885-26953907 AGTCGGGTGGCCCGGGGTCAGGG - Intergenic
1106308904 13:28535536-28535558 AGTCCTGAAGCCTGGGGTCAGGG + Intergenic
1106390901 13:29335063-29335085 AGTCTGGCTGCCTGTGGGCCAGG + Intronic
1110288097 13:73773235-73773257 TGTCCTGTTCTCTGGGGTCCTGG - Intronic
1113547406 13:111164767-111164789 ATTCCGCTTGCCTGGGGTCACGG - Intronic
1114372389 14:22104311-22104333 AAGCCGGTTGCCTGGGGCCAGGG - Intergenic
1117583874 14:57180185-57180207 AGTCTGGCTGCCTGTGGGCCCGG - Intergenic
1120186474 14:81398470-81398492 AGTACGGTAGACTTGGGTCCAGG + Exonic
1121252634 14:92511345-92511367 AGACCGCTTCCCTGGGGTCCAGG + Intergenic
1121305772 14:92906125-92906147 AGTCAGGCTGCCTGGGTTCAAGG + Intergenic
1121844428 14:97160357-97160379 TGTCCCTTTGCCTGTGGTCCAGG - Intergenic
1122842521 14:104473324-104473346 AGCCCCCTTTCCTGGGGTCCTGG + Intergenic
1123018598 14:105387102-105387124 ACACTGGCTGCCTGGGGTCCTGG + Intronic
1202841455 14_GL000009v2_random:124987-125009 AGTCCAGTTACCTGGAGACCCGG + Intergenic
1124248229 15:28089143-28089165 AGTCTGGTGGCCTGTGGGCCGGG - Intronic
1124503444 15:30251059-30251081 AGTCCAGCTGCCTGGAGTCAAGG + Intergenic
1124740111 15:32287579-32287601 AGTCCAGCTGCCTGGAGTCAAGG - Intergenic
1125694302 15:41622205-41622227 AATTCGGAGGCCTGGGGTCCAGG + Intronic
1132579697 16:679380-679402 GGTCAGGGTGCCTGGGGTGCTGG + Intronic
1132733457 16:1374465-1374487 GGTGCGGTTGCCTGGGGCCATGG - Intronic
1134036251 16:11033429-11033451 AGTCCGGTGCCCTGAGGCCCAGG + Intronic
1134129218 16:11637291-11637313 AGTGTGGCTGCCTTGGGTCCAGG + Intergenic
1136008350 16:27346473-27346495 TGTCAGGTTTCCTGGGGCCCTGG - Exonic
1142415541 16:89939151-89939173 AGTCAGGGTGCCTGGAGGCCGGG - Intergenic
1144726161 17:17503767-17503789 AGGCCGGTTGCCAGGGAACCAGG + Intergenic
1144726452 17:17504884-17504906 AGTCAGGGGGCCTGGAGTCCTGG + Intergenic
1145260222 17:21350374-21350396 ATGCCGGGTGCCTGGTGTCCTGG + Intergenic
1145316397 17:21737566-21737588 ATGCCGGGTGCCTGGTGTCCTGG - Intergenic
1146314773 17:31798291-31798313 AGTCCAGCTCCCTGGGGTCCTGG + Intergenic
1151438637 17:74114216-74114238 AGTCCGGGTGCTTGGGGGCCGGG - Intergenic
1152486460 17:80597410-80597432 ACTGCGGTAGCCTGGGGACCAGG + Intronic
1152760304 17:82103988-82104010 TGTCCGCTGCCCTGGGGTCCTGG - Intronic
1152863653 17:82709847-82709869 GGTGTGGATGCCTGGGGTCCAGG - Intergenic
1153810759 18:8749717-8749739 AGCCCTGTTCGCTGGGGTCCAGG - Intronic
1155586796 18:27375655-27375677 AGTCAGGTCTCCTGGTGTCCTGG - Intergenic
1156282230 18:35650717-35650739 AGTCTGGCTGCCTGTGGGCCGGG - Intronic
1156883870 18:42111980-42112002 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
1157200271 18:45653713-45653735 ATTCCTGCTGACTGGGGTCCTGG - Intronic
1157441044 18:47711869-47711891 AGACCTGTGGCCTGGGGACCTGG - Intergenic
1157734052 18:50030732-50030754 ATTGCTGTTGCCTGGGGTCCTGG - Intronic
1159280116 18:66274300-66274322 AGTCTGGCTGCCAGTGGTCCAGG + Intergenic
1160248654 18:77181920-77181942 AGTCCTGGTGCCTGGGTCCCAGG - Intergenic
1160249263 18:77186684-77186706 AGTCTGGCTGCCTGTGGGCCAGG - Intergenic
1160539693 18:79613822-79613844 AGGCGGGAGGCCTGGGGTCCGGG - Intergenic
1161586708 19:5109602-5109624 AGCCGGCTTGCCTGGGGTCTTGG - Intronic
1162348653 19:10136000-10136022 AGGCCAGGTGCCTGGGGTCCTGG + Intronic
1162524839 19:11201231-11201253 GGTCTGGTGCCCTGGGGTCCAGG + Intronic
1165319384 19:35076074-35076096 ATTCAGGATGCCTGAGGTCCGGG - Intergenic
1166061525 19:40328569-40328591 AGTCCGGTCGGGTGGGGTCCTGG + Intronic
1167575907 19:50317278-50317300 AGCCCGGAAGCCTGGGGTCTCGG + Intronic
925350716 2:3199190-3199212 AGTCTGGCTGCCTGGGAGCCGGG - Intronic
926823733 2:16881685-16881707 AGTCCGGCTGCCTGGTATCAGGG + Intergenic
927123443 2:19990268-19990290 AGTCCTGTTCCCTGGCGTCTGGG + Intergenic
928708343 2:33976619-33976641 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
929859679 2:45666260-45666282 AGTCTGGTTCCCTGGAATCCAGG + Intronic
930480288 2:51940451-51940473 AGTACAGTGGCTTGGGGTCCTGG - Intergenic
934567104 2:95346993-95347015 AGCCGGGCTGCCTGGGGCCCTGG - Intronic
940020573 2:149152344-149152366 AGTTCTGTTACCTGGGGTCCTGG + Intronic
942464007 2:176189115-176189137 ACTACGGCTTCCTGGGGTCCGGG + Exonic
943322752 2:186465749-186465771 AGTCCCGTTGCCCTGGGCCCAGG + Intergenic
946765316 2:223035383-223035405 GGTCTGGATGCCTGGGTTCCAGG - Intergenic
947276520 2:228397757-228397779 AGTCTGGCTGCCTGTGGGCCGGG - Intergenic
948153899 2:235765547-235765569 AGTCCGGTTGGCTGTGCTCACGG - Intronic
948893479 2:240917893-240917915 AGTCCCCTGCCCTGGGGTCCCGG + Intergenic
1169473689 20:5911332-5911354 AGTCCAGTCGCCTGGTGTGCAGG - Intergenic
1170506108 20:17027357-17027379 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
1171771844 20:29327804-29327826 AGTTGAATTGCCTGGGGTCCGGG + Intergenic
1172113209 20:32559651-32559673 AGTCCTGGCGCCTGGGGGCCTGG - Intronic
1172484932 20:35292274-35292296 AGGCCCGGGGCCTGGGGTCCTGG - Exonic
1173784608 20:45783689-45783711 AGTCAGGTTGCCTGAGGGCAAGG - Intronic
1175535300 20:59706811-59706833 AGCCTGGTTCCCTGGGGTCTGGG + Intronic
1176220928 20:63969183-63969205 ACCCCGGTGGCCTGGGGTGCAGG + Intronic
1176789435 21:13302258-13302280 AGTGTGGGTCCCTGGGGTCCAGG - Intergenic
1176914611 21:14610119-14610141 AGTCTGGCTGCCTGTGGGCCGGG + Intronic
1177988596 21:28010449-28010471 AGTGTGGGTCCCTGGGGTCCAGG - Intergenic
1179366032 21:40759290-40759312 AGTCCTGATGCATGGGGTCATGG - Intronic
1180317241 22:11285639-11285661 AATTGAGTTGCCTGGGGTCCGGG + Intergenic
1180894587 22:19320514-19320536 AGTCTGGCTGCCTGTGGGCCGGG - Intergenic
1181467053 22:23115948-23115970 AGTGCGGTTGGCTGAGGGCCTGG + Intronic
949638866 3:6013263-6013285 AGTCTGGCTGCCTGTGGGCCAGG + Intergenic
949787865 3:7761551-7761573 AGTCTGGCTGCCTGTGGGCCAGG + Intergenic
950154057 3:10708766-10708788 AGTCAGGTGGCCTGGCTTCCTGG - Intergenic
956374933 3:68603910-68603932 AGTCAGGATGCATGGGGTCAAGG - Intergenic
958684182 3:97371675-97371697 AGTCTGGCTGCCTGTGGGCCAGG + Intronic
958777213 3:98500317-98500339 AGTCAGGCAGCCTGGGGTTCAGG - Intronic
959907735 3:111729418-111729440 AGTCAGGTTGCCTGATGTCCTGG + Intronic
960829834 3:121834884-121834906 CGTCCAGGAGCCTGGGGTCCTGG + Intronic
962079034 3:132117606-132117628 AGTGCTGTTGCCAGTGGTCCAGG - Intronic
962143106 3:132811292-132811314 AATCCTGTTGGCTGGGGACCTGG + Intergenic
964908122 3:161743732-161743754 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
966820388 3:183919743-183919765 AGTCCCGCTGCCTGTGTTCCTGG - Intergenic
967223071 3:187265545-187265567 AGGCCAGTAGCCTGGGGCCCTGG + Intronic
967825079 3:193871059-193871081 AGCCAGGTTGCCTGGGGCCACGG + Intergenic
970437330 4:16048235-16048257 AGTACGATGGCCTCGGGTCCTGG + Intronic
973347123 4:49068539-49068561 AGTTAGGTTGCTTGGGGTCAAGG - Intergenic
975764750 4:77655420-77655442 AGTCAGGTGGCATGGGGTCAGGG - Intergenic
976222988 4:82773085-82773107 AGTCCTGTGTCCTGGGGTGCTGG - Intronic
978505661 4:109453557-109453579 AGTCTGGCTGCCTGTGGGCCAGG - Intronic
984905997 4:184626262-184626284 AGTCTGGCTGCCTGTGGGCCGGG - Intergenic
987571958 5:19675565-19675587 AGTCTGGCTGCCTGTGGGCCAGG - Intronic
987825672 5:23027311-23027333 TTTCCGTTTGCCTGTGGTCCTGG + Intergenic
988245536 5:28675606-28675628 AGTCTGGCTGCCTGTGGGCCAGG - Intergenic
990300453 5:54444653-54444675 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
990593758 5:57293007-57293029 AGTCCAGTAGCCTGGGAGCCTGG + Intergenic
992499340 5:77326404-77326426 AGTCCAGTTGCATGGGGAGCTGG + Intronic
993411263 5:87576260-87576282 AGTCTGGCTGCCTGTGGGCCAGG + Intergenic
996862543 5:128083284-128083306 AGCCCCGTTGCCTGGGCTGCAGG + Intergenic
997091363 5:130862852-130862874 AGTCCGTTTGCCTAGGTTCTGGG - Intergenic
999308666 5:150537289-150537311 AGTCTGGCTGCCTGTGGGCCAGG + Intronic
1005753863 6:28908329-28908351 AGTCAGGCTGCCTGGGTTCTGGG - Intronic
1005839026 6:29728335-29728357 AGGCCTGTAACCTGGGGTCCAGG + Intronic
1006726716 6:36204380-36204402 AGTCCCGTTTCCTATGGTCCTGG - Intronic
1007077120 6:39075045-39075067 AGTCAGGAGGCCTGGGTTCCAGG - Intronic
1007649944 6:43413067-43413089 AGTCCTGTGACCTGGGGGCCAGG + Intergenic
1009039049 6:58155783-58155805 AGTCTGGCTGCCTGGGAGCCGGG + Intergenic
1009214943 6:60910622-60910644 AGTCTGGCTGCCTGGGAGCCGGG + Intergenic
1011124785 6:83995586-83995608 AGTCTGGCTGCCTGTGGGCCAGG + Intergenic
1013233063 6:108174596-108174618 TGTCCGCTTTCTTGGGGTCCGGG + Intronic
1017668312 6:156743548-156743570 ACTCCTGATGCCTGGGGACCTGG - Intergenic
1017911769 6:158799251-158799273 AGACCCTTAGCCTGGGGTCCAGG - Intronic
1018974573 6:168555331-168555353 GGTCCTGTGACCTGGGGTCCTGG + Intronic
1024213053 7:47223452-47223474 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
1024403051 7:48946941-48946963 AGTCTGGCTGCCTGTGGGCCAGG - Intergenic
1024565023 7:50673687-50673709 ATTCTGGTTGCCAGGGGTCGTGG - Intronic
1024891990 7:54213562-54213584 AGTCTGGCTGCCTGTGGGCCGGG - Intergenic
1024946096 7:54808901-54808923 AGTCTGGCTGCCTGTGGGCCAGG + Intergenic
1026232301 7:68495989-68496011 GGTCCAAGTGCCTGGGGTCCAGG + Intergenic
1026353547 7:69538192-69538214 AATCTGGATGCCTGGGTTCCAGG - Intergenic
1026794435 7:73357583-73357605 TGTCCCGTTGCCTGTGGTTCTGG + Intronic
1031513862 7:122679128-122679150 AGTCTGGCTGCCTGTGGGCCGGG + Intronic
1032723479 7:134569975-134569997 AGTCTGGCTGCCTGTGGGCCGGG + Intronic
1033677117 7:143553578-143553600 AGTCTGGCTGCCTGTGGGCCGGG - Intergenic
1033694718 7:143775859-143775881 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
1037204221 8:16294643-16294665 AGTCTGGCTGCCTGTGGGCCAGG + Intronic
1037638507 8:20721898-20721920 AGTCAAGCTGCCTGGGCTCCTGG - Intergenic
1037929269 8:22868013-22868035 AGCCCGGCTGGCAGGGGTCCAGG + Intronic
1038824871 8:30989337-30989359 TGCCCTGTTCCCTGGGGTCCTGG - Intergenic
1039111418 8:34044208-34044230 AGTCTGGCTGCCTGTGGGCCGGG - Intergenic
1045148724 8:99378261-99378283 AGTCTGGCTGCCTGTGGGCCGGG - Intronic
1045798694 8:106077201-106077223 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
1046868902 8:119182156-119182178 AGTCTGGCTGCCTGTGGGCCAGG - Intronic
1048492507 8:134907043-134907065 AGGCCTGTTGCCGGGGGTCGGGG - Intergenic
1049686293 8:143940540-143940562 CCTCCGGCTCCCTGGGGTCCGGG + Intronic
1050606686 9:7309100-7309122 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
1053087616 9:35239832-35239854 AGTCTGGCTGCCTGTGGGCCGGG - Intronic
1058549025 9:106093519-106093541 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
1059450706 9:114370104-114370126 AGCCTGCTTGCCTGGGGGCCAGG - Intronic
1060889538 9:127179327-127179349 TGTGGGGTGGCCTGGGGTCCTGG + Intronic
1061899602 9:133666164-133666186 GGTGGGGTTGCCTGGGGTCAGGG + Intronic
1062189781 9:135242103-135242125 AGGCCGGGGGCCTGGGGTCGGGG - Intergenic
1062518197 9:136946433-136946455 AGACAGGGTTCCTGGGGTCCTGG - Intronic
1203365482 Un_KI270442v1:251354-251376 AATTGAGTTGCCTGGGGTCCTGG + Intergenic
1186994580 X:15106148-15106170 AGTCTGGCTGCCTGTGGGCCAGG - Intergenic
1187644711 X:21334674-21334696 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
1188776557 X:34226770-34226792 AGTCTGGCTGCCTGTGGGCCGGG - Intergenic
1188822804 X:34796413-34796435 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
1188823540 X:34802779-34802801 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic
1191596178 X:62946407-62946429 AGTCTGGCTGCCTGTGGGCCAGG - Intergenic
1191762560 X:64661659-64661681 AGTCAGGATGCCTGGGGGTCAGG + Intergenic
1195838288 X:109144062-109144084 AGTCTGGCTGCCTGTGGGCCGGG + Intergenic