ID: 1086322386

View in Genome Browser
Species Human (GRCh38)
Location 11:85664524-85664546
Sequence AGTCCGGTTGCCTGGGGTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 197}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086322379_1086322386 -7 Left 1086322379 11:85664508-85664530 CCGGGGTCCAGGTGCCAGTCCGG 0: 1
1: 0
2: 2
3: 20
4: 188
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322374_1086322386 9 Left 1086322374 11:85664492-85664514 CCCCGGCGAGCTAAGCCCGGGGT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322375_1086322386 8 Left 1086322375 11:85664493-85664515 CCCGGCGAGCTAAGCCCGGGGTC 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322368_1086322386 29 Left 1086322368 11:85664472-85664494 CCGCCAGACGAGGAGAGAGGCCC 0: 1
1: 1
2: 3
3: 18
4: 229
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322369_1086322386 26 Left 1086322369 11:85664475-85664497 CCAGACGAGGAGAGAGGCCCCGG 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322376_1086322386 7 Left 1086322376 11:85664494-85664516 CCGGCGAGCTAAGCCCGGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 47
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197
1086322378_1086322386 -6 Left 1086322378 11:85664507-85664529 CCCGGGGTCCAGGTGCCAGTCCG 0: 1
1: 0
2: 1
3: 8
4: 209
Right 1086322386 11:85664524-85664546 AGTCCGGTTGCCTGGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086322386 Original CRISPR AGTCCGGTTGCCTGGGGTCC AGG Exonic