ID: 1086322497

View in Genome Browser
Species Human (GRCh38)
Location 11:85664935-85664957
Sequence AAGGATCCCAGGCCCCAGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 327}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086322483_1086322497 10 Left 1086322483 11:85664902-85664924 CCCCGGCCGCTAAGAGTGGGCCT 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1086322497 11:85664935-85664957 AAGGATCCCAGGCCCCAGGGCGG 0: 1
1: 0
2: 4
3: 41
4: 327
1086322485_1086322497 8 Left 1086322485 11:85664904-85664926 CCGGCCGCTAAGAGTGGGCCTCA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1086322497 11:85664935-85664957 AAGGATCCCAGGCCCCAGGGCGG 0: 1
1: 0
2: 4
3: 41
4: 327
1086322487_1086322497 4 Left 1086322487 11:85664908-85664930 CCGCTAAGAGTGGGCCTCACGGG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1086322497 11:85664935-85664957 AAGGATCCCAGGCCCCAGGGCGG 0: 1
1: 0
2: 4
3: 41
4: 327
1086322484_1086322497 9 Left 1086322484 11:85664903-85664925 CCCGGCCGCTAAGAGTGGGCCTC 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1086322497 11:85664935-85664957 AAGGATCCCAGGCCCCAGGGCGG 0: 1
1: 0
2: 4
3: 41
4: 327
1086322480_1086322497 20 Left 1086322480 11:85664892-85664914 CCGCGGTAGGCCCCGGCCGCTAA 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1086322497 11:85664935-85664957 AAGGATCCCAGGCCCCAGGGCGG 0: 1
1: 0
2: 4
3: 41
4: 327
1086322490_1086322497 -10 Left 1086322490 11:85664922-85664944 CCTCACGGGCCCCAAGGATCCCA 0: 1
1: 0
2: 0
3: 17
4: 184
Right 1086322497 11:85664935-85664957 AAGGATCCCAGGCCCCAGGGCGG 0: 1
1: 0
2: 4
3: 41
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086322497 Original CRISPR AAGGATCCCAGGCCCCAGGG CGG Exonic
900368078 1:2319606-2319628 GAGGCTCCCAGAGCCCAGGGCGG - Intergenic
900416203 1:2535873-2535895 AAGGAACTGAGGCCACAGGGAGG - Intergenic
900591211 1:3460838-3460860 GAGCCTCCCAGGCCCCAGGGAGG - Intronic
901491170 1:9597081-9597103 AAGCATCCCTGGCCCCAGCCAGG - Intronic
901868188 1:12121516-12121538 AAGGTGCCCAGTCCCCAGGCAGG + Intronic
902055903 1:13600193-13600215 AAGGATCTCAGAACCCAGGGAGG + Intronic
902679226 1:18031252-18031274 AAGGCTCACTGGCCCCGGGGTGG + Intergenic
903784708 1:25852040-25852062 AAGGATCACTGAACCCAGGGAGG - Intronic
903859141 1:26354606-26354628 CAGGCTCTCAGGCCCCAGGGAGG + Intergenic
904128723 1:28260187-28260209 AAGGATCCGCGGCCCTGGGGTGG - Intronic
904253090 1:29238289-29238311 TAGGATCCCAGGCCTCAGGGTGG - Intronic
904360439 1:29967768-29967790 CAGGAGCCCAGGCCCCTGGAAGG - Intergenic
904437481 1:30508116-30508138 GAGGCTCCCAGTCCCCAGGGGGG + Intergenic
904902260 1:33866706-33866728 AAGGAGCAAGGGCCCCAGGGAGG - Intronic
905301703 1:36990191-36990213 CAGGATCCCAAGCCTAAGGGAGG - Intronic
905674350 1:39815344-39815366 AAGGATCGCTGGACCCTGGGAGG - Intergenic
905865547 1:41374444-41374466 AAAGACCCCAGGTACCAGGGAGG + Intronic
906141313 1:43535373-43535395 TAGAAGCCCAGGGCCCAGGGAGG - Intronic
906559417 1:46745071-46745093 AAGGATGTCAGGGCCCAGAGTGG + Intergenic
906951022 1:50334574-50334596 GAGGATCCCAGGTCAGAGGGTGG + Intergenic
907276201 1:53317849-53317871 AAGGAACCTGGGCCTCAGGGTGG + Intronic
907525743 1:55052973-55052995 AAGAAACCCAGGCCCCAAGAGGG + Intronic
908918112 1:69157106-69157128 CAGGATCTCAAGCCCCTGGGTGG + Intergenic
913446217 1:118953435-118953457 GAGGATCCCAAGGCCCAGAGTGG - Intronic
913688729 1:121258157-121258179 AAGGATTTCAGGCCACAAGGAGG - Intronic
913996798 1:143657441-143657463 AAGGATCCTTGGCCCCAAGGGGG + Intergenic
914148871 1:145022119-145022141 AAGGATTTCAGGCCACAAGGAGG + Intronic
914196463 1:145450513-145450535 AAGGACCTCAGGCCACGGGGAGG - Intergenic
914370432 1:147019889-147019911 AGGGATCTCAGGACACAGGGAGG - Intergenic
914376129 1:147075565-147075587 GAGGATCCTTGGCCCCAGGAGGG - Intergenic
914484262 1:148093521-148093543 AGGGATCTCAGGACACAGGGAGG + Intergenic
914505458 1:148285355-148285377 AATGATCCTTGGCCCCAAGGGGG - Intergenic
914507104 1:148298796-148298818 AATGATCCTTGGCCCCAAGGGGG + Intergenic
915014163 1:152717916-152717938 AATGATCCTAGGCCCCAGGCTGG - Intergenic
915285027 1:154847043-154847065 GAGGAGCCCAGGGCTCAGGGAGG - Intronic
915562170 1:156693724-156693746 CAGGAGCCCAGGGCCCAGTGGGG - Intergenic
915595558 1:156894641-156894663 CAGGAGCCCAGGCCCCAGCAAGG + Intronic
915643601 1:157250312-157250334 GAGAATTCCAGGCCCCAGGCAGG - Intergenic
916026653 1:160838888-160838910 CAGGATCCAAGGCCTCAGGCAGG + Intronic
917744609 1:177995637-177995659 ATGGAGCCTAGGCACCAGGGAGG + Intergenic
920400088 1:205670856-205670878 GAGAATCCCAGGCCCTAGGGGGG + Intronic
920476052 1:206276657-206276679 AAGGATTTCAGGCCACAAGGAGG - Intronic
920669303 1:207991079-207991101 AAAGAGCCCAGTCCCCAGTGAGG - Intergenic
920695249 1:208176866-208176888 GAGGATCCCAGGACTCAAGGAGG - Intronic
924732449 1:246724389-246724411 AGCGAGCCCAGGCCCCGGGGCGG - Exonic
924949243 1:248867382-248867404 AAGCGTCCCTGGCCCCAGGCTGG + Intergenic
1062937536 10:1399526-1399548 AGGGACCCCAGGCACCAGGCCGG - Intronic
1063519159 10:6725349-6725371 ACAGATCACAGGCCACAGGGAGG - Intergenic
1066131099 10:32394948-32394970 AAGAATCCCTGGAACCAGGGAGG - Intergenic
1067431620 10:46249435-46249457 AAGCAGCCCAGGACCCACGGCGG + Intergenic
1067441800 10:46312739-46312761 AAGCAGCCCAGGACCCACGGCGG - Intronic
1067580763 10:47444101-47444123 AAGCAGCCCAGGACCCATGGTGG + Intergenic
1067765256 10:49081108-49081130 CAGGATCCCAGGGCACAGGATGG + Intronic
1068297658 10:55095009-55095031 AAGGATCCCTTGAGCCAGGGTGG - Intronic
1069590983 10:69641703-69641725 CTGGGTCCCAGGCACCAGGGAGG + Intergenic
1069638224 10:69938379-69938401 ATGGAGCCCGGGCTCCAGGGAGG - Intronic
1069750453 10:70742010-70742032 GTGGAGCCCAGGCTCCAGGGAGG - Intronic
1069852412 10:71418468-71418490 GAGGATCCCAGATCCCAGAGAGG - Intronic
1069959316 10:72070287-72070309 GAGGAGCCCAGGCCCCAGGTAGG - Intronic
1072532421 10:96331865-96331887 AAGGATCCCTGGAGCCTGGGAGG - Intronic
1072635430 10:97174596-97174618 CAGGAGCCCAGGCGCAAGGGTGG - Intronic
1072740144 10:97904282-97904304 AAGGCTCTCAGGGCCCAGAGTGG - Intronic
1072806204 10:98425403-98425425 AAGGATCGTAGGCCCGGGGGAGG + Intronic
1074760420 10:116663477-116663499 CAGAATCCCAGTCCCCAGGAGGG - Intergenic
1075093051 10:119454032-119454054 GAGCCTCCCAGGCTCCAGGGCGG - Intronic
1075833125 10:125428130-125428152 CAGGATCCCAGGCTGCATGGTGG - Intergenic
1076606118 10:131691103-131691125 CAGGATCCCACGCCCCACTGAGG + Intergenic
1077923780 11:6660744-6660766 AAAGACACCAGGCCACAGGGAGG + Intergenic
1078542484 11:12223062-12223084 ATGGACCCCAGGACCAAGGGTGG - Intronic
1081640228 11:44748050-44748072 AAGGAAACCAGGGCCCAGAGAGG - Intronic
1083652794 11:64212981-64213003 AAGGATCACATGACCCTGGGAGG - Intronic
1084359729 11:68661566-68661588 CAGCATCCCCAGCCCCAGGGTGG - Intergenic
1084968191 11:72755275-72755297 ATGGAGCCTAGGGCCCAGGGAGG - Intronic
1086322497 11:85664935-85664957 AAGGATCCCAGGCCCCAGGGCGG + Exonic
1087179889 11:95131427-95131449 AAGGAACCCAAGGCCCTGGGAGG + Exonic
1088818412 11:113436975-113436997 AAGGATCCCAGGCCATAGAAAGG - Intronic
1089316277 11:117593356-117593378 CAGGCCCCCAGGCCCCAGCGAGG - Intronic
1089939135 11:122397144-122397166 AAGGTTCTCAGTCCCCAGGGAGG + Intergenic
1090364042 11:126191558-126191580 CAGGATGCCAGGCCCCAGAAAGG + Intergenic
1091262035 11:134242277-134242299 CAGGATCCTAGTCCCCAGGCTGG - Intronic
1091727727 12:2857290-2857312 CTGGCTCCCAGGCCTCAGGGTGG + Intronic
1092954884 12:13540798-13540820 AAGGAGAGCCGGCCCCAGGGAGG + Exonic
1093123955 12:15306547-15306569 AGGTACCCCAGGCCCCAGGTGGG + Intronic
1095943671 12:47741470-47741492 CAGGGTGCCAGGGCCCAGGGAGG - Intronic
1096242210 12:49965517-49965539 AGGGATCCCAGCCCCTAGGTGGG + Exonic
1096606737 12:52772063-52772085 CAGGATCCAAGGACACAGGGAGG + Intronic
1097196203 12:57243622-57243644 AGGTATCCGAGGCCCCAGGCTGG + Exonic
1097690321 12:62728760-62728782 AGGGAACTCAGACCCCAGGGAGG + Intronic
1098142181 12:67461359-67461381 AATAATCCCAGGCACTAGGGAGG - Intergenic
1100391048 12:94147100-94147122 CCAGACCCCAGGCCCCAGGGAGG - Intergenic
1102252466 12:111396968-111396990 AAGCTTCCCAGGCTCCAGGTTGG - Intergenic
1102519058 12:113467831-113467853 AGGGATCCCGGACCCCAGAGAGG + Intronic
1102830914 12:115998507-115998529 AAGGAACCAAGGCCCCAAGGGGG - Intronic
1103880183 12:124159985-124160007 AAAGGCCCCAGGCCCCAGGCTGG - Intronic
1103948161 12:124538434-124538456 AAGGAACCCAGGGCCCTGGCTGG + Intronic
1104069144 12:125329518-125329540 TAGGACCCCAGACCCAAGGGTGG - Intronic
1104221220 12:126786742-126786764 GTGCATTCCAGGCCCCAGGGTGG - Intergenic
1104848044 12:131856914-131856936 GAGGAGCCCAGGCCCCATGGAGG - Intergenic
1104955767 12:132465187-132465209 AGGGGGCCCAGGCCCCAGTGTGG + Intergenic
1104955803 12:132465339-132465361 AGGGGGCCCAGGCCCCAGTGTGG + Intergenic
1105022901 12:132828969-132828991 GAGGGTCCCCGGCCCTAGGGTGG - Intronic
1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG + Intergenic
1106920774 13:34561126-34561148 AAGGTTTCCAGGGCCCAGGTGGG + Intergenic
1108725831 13:53180160-53180182 AGGGATCCCAGTCCTTAGGGAGG - Intergenic
1111835459 13:93383299-93383321 AAGGATCCCATGAGCCTGGGAGG - Intronic
1112822301 13:103351270-103351292 AAGGGATCCAGGCACCAGGGTGG + Intergenic
1113505882 13:110815513-110815535 AAGGCTGTCCGGCCCCAGGGCGG - Intergenic
1116481153 14:45392550-45392572 AGTTCTCCCAGGCCCCAGGGAGG - Intergenic
1117176558 14:53152476-53152498 ACGGGTGCCCGGCCCCAGGGCGG - Exonic
1118318743 14:64741274-64741296 AAGGCTCTCAGGCTCCTGGGCGG - Exonic
1118475172 14:66109694-66109716 AAGGGCCCCAGGTCCCAAGGGGG + Intergenic
1119382346 14:74237308-74237330 AAGGAGTCCAGCTCCCAGGGTGG + Intergenic
1119484422 14:74978547-74978569 AAAGATCCCTGGCCCCCAGGGGG + Intergenic
1119552749 14:75527077-75527099 AAGGAAACCAAGCCCAAGGGAGG - Intronic
1119774564 14:77240338-77240360 AAGGAGCCCAGGACCCTGGCTGG - Intronic
1119805150 14:77477601-77477623 AAGGAGCTCAGGTCCCATGGGGG - Intronic
1119888680 14:78165910-78165932 AAGGATGCCAGGCCCCTCTGTGG + Intergenic
1122113052 14:99514959-99514981 ATGGAGCCCAGGGCCCAGAGGGG + Exonic
1122273304 14:100578009-100578031 AGGGATCCCAGCCCCATGGGAGG - Intronic
1122276051 14:100591337-100591359 AAGGAGCCCAGACCCCCAGGTGG - Intergenic
1122427624 14:101620964-101620986 AATGTTCCCAAGCCCCAGCGGGG - Intergenic
1122429146 14:101628978-101629000 CAGCCTGCCAGGCCCCAGGGTGG + Intergenic
1122597232 14:102902227-102902249 CAGGCTGCCAGGCCCCAGCGAGG - Intronic
1122770113 14:104094046-104094068 GATGCTCCCAGGCCCCAGGCTGG - Intronic
1122796053 14:104206831-104206853 AAGGAGGCCAGGCCCCAGTCAGG + Intergenic
1122859753 14:104577287-104577309 AAGGACCCCAGGCACAAGAGAGG - Intronic
1122941740 14:104984631-104984653 CAGGGCCCCAGGCCCCAGGGTGG + Intergenic
1125259145 15:37802311-37802333 TAAGATCCTGGGCCCCAGGGTGG + Intergenic
1125674095 15:41493587-41493609 AAGGCTGCGAGGCCCCAGCGCGG + Intronic
1128411254 15:67400572-67400594 AAGGATCCCTTGAGCCAGGGAGG - Intronic
1128469873 15:67943306-67943328 AACGATCCCAGGGCCCAGTGAGG + Intergenic
1128721779 15:69955486-69955508 GAGGAGCCCAGGCTCCACGGTGG + Intergenic
1129060338 15:72856006-72856028 AATGTTCCCGGGCCCCAGAGAGG + Intergenic
1129062094 15:72868300-72868322 AAGGCTCCCAGCCACCTGGGTGG + Intergenic
1129186557 15:73910877-73910899 AAGCATACCATCCCCCAGGGGGG - Intergenic
1129660690 15:77551246-77551268 GAGGATCCCAAGGCCCAGGGAGG + Intergenic
1130507178 15:84556096-84556118 AAGGAAGCCAAGCCCCAGTGTGG + Intergenic
1131034782 15:89215014-89215036 AGGGAACCCAGCCCACAGGGTGG + Intronic
1132252655 15:100345836-100345858 GAGGAGCCCAGAGCCCAGGGTGG - Intergenic
1132721725 16:1319872-1319894 TGGGAACACAGGCCCCAGGGTGG - Intronic
1132853950 16:2036550-2036572 AAGGACCCAGGGCCCCAGTGTGG - Intronic
1132989012 16:2783608-2783630 CAGGATGCCAGGCACCAGGCTGG + Intergenic
1133002115 16:2856953-2856975 AGGGATCCCAGTGCCCAGTGAGG + Intronic
1133018366 16:2955220-2955242 AAAGATCCCAAGCCCCAGGCCGG + Intergenic
1133026403 16:2990699-2990721 CAGGCTCCCAGGCCTCAGAGAGG + Intergenic
1133065553 16:3204232-3204254 CAGGATCCCAGGCCCATGAGCGG + Exonic
1133267396 16:4593362-4593384 AGGGTTCCCAGGCTCCAGAGTGG - Intronic
1135647675 16:24177232-24177254 ATGGATCCCAGATCCCAGTGCGG - Intronic
1137719322 16:50618702-50618724 ATGGATCACAGGCCCCATGCTGG + Intronic
1138376130 16:56565174-56565196 AAGGTTCCCAGACCCCAGGGAGG - Intronic
1139470683 16:67176613-67176635 CAGGTCCCCAGACCCCAGGGAGG + Exonic
1141480299 16:84301881-84301903 AAGCATCCCAGGTCCCTGTGTGG + Intronic
1141894318 16:86948859-86948881 AAGAATCCCAGGACCCAGAGAGG + Intergenic
1142436152 16:90058902-90058924 AAAGTGCCCAGGGCCCAGGGAGG - Intronic
1143038628 17:4016138-4016160 CAGAATCCCTGGCCTCAGGGAGG + Intronic
1143103938 17:4519220-4519242 CAGGCTCCAAGGCCACAGGGCGG + Intronic
1143118546 17:4593774-4593796 AACAAACCCTGGCCCCAGGGAGG - Intronic
1143871041 17:9957451-9957473 ATGGTGCCCAGGCCACAGGGTGG - Intronic
1144586976 17:16492700-16492722 GCGGATCCCAGGCCCCACCGAGG - Intergenic
1144945894 17:18969294-18969316 AGGGGGCCCTGGCCCCAGGGAGG - Exonic
1145267182 17:21385535-21385557 AAGGCTCCCAGGGCCTGGGGAGG - Intronic
1147418088 17:40307990-40308012 AAGGATGGAAGGCCCCAGGGTGG - Intergenic
1148189585 17:45669217-45669239 ATGTATCCCAGGCCCTTGGGTGG + Intergenic
1148332657 17:46821495-46821517 AGGTACCCCAAGCCCCAGGGTGG + Intronic
1148694840 17:49552577-49552599 AGGGCTCCCAGGCCCCACCGCGG - Intergenic
1148709057 17:49663076-49663098 AGGGGTCCCCAGCCCCAGGGCGG + Intronic
1148714760 17:49708064-49708086 ATGGAGCCAAGGTCCCAGGGCGG - Exonic
1148833484 17:50452151-50452173 AAGGCTCTCAGGGCCCAGGTGGG - Intronic
1148966158 17:51437842-51437864 AAGGATCACAGGAGCCTGGGAGG + Intergenic
1149444798 17:56705273-56705295 TGGGATCCCAAGCCCCAGAGAGG + Intergenic
1151807923 17:76418092-76418114 AGCTATCCCAGACCCCAGGGTGG - Intronic
1152241632 17:79164158-79164180 AGAGATCCCAGGCCTCTGGGAGG + Intronic
1154028319 18:10727116-10727138 CAGATCCCCAGGCCCCAGGGAGG - Intronic
1157619458 18:49007939-49007961 CAGGATCCCAGGCCCCAAGCTGG + Intergenic
1157761463 18:50268505-50268527 ACGGAGACCACGCCCCAGGGCGG + Intronic
1157802017 18:50628376-50628398 AGGGAACCCAGGCCCCAGGGAGG - Intronic
1159927366 18:74281396-74281418 GAAAAGCCCAGGCCCCAGGGGGG + Intronic
1160167982 18:76530538-76530560 AAGAATGGCAGGACCCAGGGTGG + Intergenic
1160343202 18:78107580-78107602 AAGGAACGCAGGCCAGAGGGAGG - Intergenic
1160544424 18:79643286-79643308 CAGGAACCCAAGCCCCATGGGGG + Intergenic
1161579182 19:5071348-5071370 AAGGCTGCCAGGGCCCAGGGAGG + Intronic
1161593073 19:5137426-5137448 AAGGAACCCAGGCCCACGGAGGG - Intronic
1162067995 19:8137311-8137333 AGGGATCTAAGGCCCCAGGTTGG - Intronic
1162068003 19:8137334-8137356 AGGGATCTAAGGCCCCAGGTTGG - Intronic
1162785687 19:13033290-13033312 AAGGGACCCAGGCACCTGGGGGG - Intronic
1163559592 19:18010760-18010782 AAGGCTCCCAGGGCCCAGAGAGG - Intronic
1163815386 19:19461920-19461942 GAGGATCTCAGCCCCCAGGACGG + Intronic
1164587378 19:29484448-29484470 TGAGCTCCCAGGCCCCAGGGAGG - Intergenic
1164715118 19:30385345-30385367 AGGGCACCCAGGCCCCAGGCAGG - Intronic
1165695467 19:37897498-37897520 AAGGATCCCAGGGCCAGGCGTGG - Intronic
1165797045 19:38525598-38525620 AAGGCTCCCAGGGACCTGGGGGG - Intronic
1166262815 19:41653266-41653288 AAGGCTACCAGGCTCCAGGCTGG - Intronic
1166798663 19:45443187-45443209 AAGGAGGCCAGGCTCCAAGGAGG + Intronic
1166882969 19:45940275-45940297 AAGGACCCCAGGGCTCCGGGAGG + Exonic
1167411527 19:49347002-49347024 GAGGAGGCCAGCCCCCAGGGTGG - Intronic
1167423769 19:49418875-49418897 CAGGATGGCTGGCCCCAGGGTGG + Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
925184190 2:1836018-1836040 CAGGATCCCAGGTCCCTGGAGGG - Intronic
925314089 2:2908057-2908079 GTGCATCCCAGGCCCCAGTGTGG + Intergenic
926095547 2:10079254-10079276 AAGCCTCCCGGGCCTCAGGGAGG + Intronic
927515116 2:23667738-23667760 ACAGACCCCGGGCCCCAGGGTGG - Intronic
928673436 2:33626165-33626187 AAGGATCCCAAGACCCAAAGGGG - Intergenic
929388577 2:41441933-41441955 AAGGTCCCCAGGCCTCAGGTAGG + Intergenic
929414864 2:41737030-41737052 GAGGCTCCCTGGCCCCAGGGAGG + Intergenic
929934741 2:46286462-46286484 AAGGGTCCCAGGCCCCAGGAAGG - Intergenic
931264264 2:60646614-60646636 AAGATTCCCAGGCCCCTGGTGGG + Intergenic
931598639 2:63978707-63978729 AAGGATCCCATGAACCTGGGAGG - Intronic
932079177 2:68695940-68695962 AAGGGTTACAGGCCCCAGTGAGG + Intronic
932298015 2:70642879-70642901 AATGTTCCTCGGCCCCAGGGAGG - Intronic
933354524 2:81196089-81196111 AAGGATTCCAGCCCGGAGGGAGG + Intergenic
933710517 2:85322335-85322357 ACAGAGCCCGGGCCCCAGGGAGG + Exonic
936983165 2:118283132-118283154 AAGGACACCAGACCCAAGGGTGG + Intergenic
937283952 2:120738032-120738054 GCCGTTCCCAGGCCCCAGGGAGG - Intronic
937935356 2:127239507-127239529 AAGGATGACAGGCCCCATGCAGG - Intergenic
938169864 2:129065680-129065702 AAAGAGCCCAGGCCACAGAGTGG + Intergenic
941593781 2:167451486-167451508 AAGGCTGCCAGGCTCCAGGCTGG + Intergenic
944093605 2:195942040-195942062 AAAGATCCCAGCCTCCATGGGGG + Intronic
946208477 2:218128389-218128411 ATGCATCCCAGGGCCCAGAGGGG - Intronic
946433622 2:219638377-219638399 AAGGCCCTCAGCCCCCAGGGCGG - Intronic
947739505 2:232478703-232478725 GAGGACCCCAGGCCCCATGGAGG - Intergenic
947860320 2:233353730-233353752 CCGGATCACAGGCCCCAGCGTGG + Intergenic
948508312 2:238446200-238446222 GAGGAGAGCAGGCCCCAGGGAGG - Intronic
948604517 2:239126417-239126439 AGCGCTCCCAGGCCCCAGGGCGG - Intronic
948770149 2:240247708-240247730 GGCGATCCCAGGCCCCAGAGCGG - Intergenic
948858313 2:240740868-240740890 CAGGTTCCAGGGCCCCAGGGTGG - Intronic
949060493 2:241953788-241953810 GATGTACCCAGGCCCCAGGGAGG + Intergenic
1169877794 20:10316739-10316761 AAGGACCCCAGGCCTAAGGAGGG - Intergenic
1171248412 20:23631640-23631662 AAGGATCCCTCTCCCCAGGACGG - Intronic
1171992269 20:31705730-31705752 TAGTATCCCAAGCCCCAGTGAGG - Intronic
1172009541 20:31838395-31838417 AAGGATCCCTGCAGCCAGGGAGG + Intergenic
1173217967 20:41104484-41104506 AAGGATCTCAGCCCTCAGAGAGG - Intronic
1173320530 20:41983452-41983474 GGGGAGCCCAGGGCCCAGGGAGG + Intergenic
1175196208 20:57244926-57244948 ATGGAACCCAGGCCTCAGGAAGG - Intronic
1175986251 20:62765475-62765497 AAGGATGCTGAGCCCCAGGGCGG - Intergenic
1176037067 20:63044742-63044764 AGGGCTCCCAGGCCCCGGTGAGG + Intergenic
1176083393 20:63285067-63285089 GAGGAGCCCAGGCCCCGAGGAGG - Intronic
1176138345 20:63534761-63534783 CAGTGACCCAGGCCCCAGGGAGG + Intronic
1176150676 20:63589193-63589215 ATGGATCTCAGACCCCTGGGAGG + Exonic
1176372796 21:6072613-6072635 GAGGACCACAGGCCCCAGGGAGG - Intergenic
1177629756 21:23711291-23711313 GAGGATCACAGGAACCAGGGAGG + Intergenic
1178551509 21:33543283-33543305 ATGGATCCCAGGCCCAGGCGGGG - Intronic
1179750681 21:43465630-43465652 GAGGACCACAGGCCCCAGGGAGG + Intergenic
1179791760 21:43759901-43759923 AAGGACCCCAGGCCCTGGGGAGG + Exonic
1180242281 21:46517817-46517839 AGGGATTCCAGCCCCCACGGGGG - Intronic
1180936107 22:19626190-19626212 TAGGATAGCAGACCCCAGGGAGG - Intergenic
1180954251 22:19734485-19734507 AAGGACCCCAGGGCAGAGGGTGG - Intergenic
1180985148 22:19899584-19899606 AAGGACCCCAGGGACAAGGGAGG + Intronic
1181390408 22:22576501-22576523 GAGGAGCCCAAGCCCCAGGGAGG - Intergenic
1182124062 22:27803902-27803924 CAGGGTCCTAGGCCCCGGGGCGG - Intergenic
1183264851 22:36818850-36818872 CTGGGTCCCAGGCACCAGGGAGG - Intronic
1183284451 22:36953380-36953402 CAGGCCCCCAGGCTCCAGGGTGG - Intergenic
1183376754 22:37469780-37469802 AGGCACCCCAGGCCCCTGGGAGG - Exonic
1183459451 22:37941107-37941129 TAGGGTCCCAGGGTCCAGGGAGG + Exonic
1183464143 22:37971024-37971046 AAGTAGCCCAGTCCCCAGGGTGG - Intronic
1183489774 22:38110233-38110255 AGGGAGCCCAAGGCCCAGGGTGG - Intronic
1183604531 22:38860747-38860769 CAGGACCCCAGGCTGCAGGGCGG + Intergenic
1184614157 22:45626523-45626545 AAGGTTACCAGGCTCCAGGATGG + Intergenic
1184831841 22:46993830-46993852 AAGGCTTCCTGGCCCCAGAGCGG + Intronic
949890536 3:8730614-8730636 AAGGACCCCAGGCCTCAGAGAGG + Intronic
950118859 3:10468473-10468495 ACGCATGGCAGGCCCCAGGGAGG + Intronic
950487241 3:13281061-13281083 AAGGAAGCCATTCCCCAGGGTGG + Intergenic
952617474 3:35292212-35292234 ATGGAACCCAGGGCTCAGGGAGG + Intergenic
952880994 3:37986389-37986411 AAGGCTCCCAGTGCCCAGGTGGG - Intergenic
954296350 3:49676537-49676559 AAGGGTCCCAGACTCCAGGGGGG - Intronic
956059949 3:65339338-65339360 AAGCATCCAATGCCCAAGGGGGG - Intergenic
957811706 3:85230103-85230125 GAGCATACCAGGGCCCAGGGAGG - Intronic
958034102 3:88149913-88149935 CAGTATTCCAGGCCCCTGGGCGG - Exonic
958700965 3:97589045-97589067 GAGGCTCCCAGGCCACAGGTTGG - Intronic
963304716 3:143638814-143638836 AAGCATCCCATGCCCCAGTAAGG + Intronic
964711377 3:159675008-159675030 AAGGAGCCCAGGCCACAGACTGG + Intronic
966715748 3:183011450-183011472 AAAAATCCCAGGTCCCAGGATGG - Intergenic
967322035 3:188204213-188204235 AAGAACCCCTGGCCCCAGGCAGG - Intronic
967968888 3:194984960-194984982 AAGGATATCAGGCCCCGTGGAGG + Intergenic
968501580 4:952603-952625 CAGGACCCCAGGCCCCAAGAGGG - Intronic
968736127 4:2297407-2297429 AATGACCCCAGGCCACACGGAGG + Intronic
968936907 4:3615976-3615998 CAGGACCCCAAGCCCCATGGTGG + Intergenic
969260756 4:6031798-6031820 AAGGACACCAAGCCTCAGGGAGG - Intronic
969529070 4:7719823-7719845 AAGGGTCCCGGCCCCCTGGGCGG - Intronic
969701734 4:8771366-8771388 GAGGATGCCAGGACCCAGGCCGG + Intergenic
970007384 4:11424771-11424793 CAAGATTCCAGGCCCCAGGTGGG + Intronic
970757458 4:19443489-19443511 CCTGATCTCAGGCCCCAGGGAGG - Intergenic
971649866 4:29257735-29257757 GAGGATCCCATGAGCCAGGGAGG - Intergenic
972595528 4:40526661-40526683 GAGGATCCCTGGAGCCAGGGAGG - Intronic
972909612 4:43797986-43798008 ATGTTTCCCAGGCCCCAGGTGGG - Intergenic
973714499 4:53662011-53662033 ATGGACCCCAGGCCCCCTGGAGG + Intronic
975814224 4:78201147-78201169 CATGATCCCTGACCCCAGGGAGG - Intronic
976908310 4:90267396-90267418 AAGGTCCCCAGGCCCCAGGTGGG - Intronic
976911048 4:90306148-90306170 ATGGCTACCAGGCCCCAGGATGG + Intronic
978542454 4:109832743-109832765 AAGAGCCCCAGGCCCCAGGAAGG + Intronic
981705194 4:147651802-147651824 CTGGATGCCAGGACCCAGGGTGG + Intronic
985651933 5:1111544-1111566 AGGGAGCCCGGGCCCCTGGGTGG - Intronic
985749985 5:1668150-1668172 AGGGAACCCAGGCCCCAAGGGGG - Intergenic
986050242 5:4083626-4083648 AAGGGTCCCAGCTCCCAGGAGGG + Intergenic
986561221 5:9062228-9062250 AATGTGCCCAGGGCCCAGGGAGG + Intronic
986562227 5:9072258-9072280 AAGGTTCCCAGGCCACAGCATGG + Intronic
987889764 5:23862361-23862383 AAGGATCTCAAGCCCAAGGATGG + Intergenic
989342277 5:40389372-40389394 CAGAATCCCAGGCCCCATGCTGG + Intergenic
989361713 5:40608871-40608893 AAGAATCACAGGCACCTGGGAGG - Intergenic
990263696 5:54053159-54053181 AAGGATCCCTGGGGCCCGGGAGG + Intronic
990550906 5:56877397-56877419 AAGGATACCAGGCTCCATGGAGG + Intronic
992333670 5:75743219-75743241 AAGGATCCCATGAACCTGGGAGG - Intergenic
992528839 5:77637002-77637024 AAGCAGCCCGGGCCCCAGGGCGG - Exonic
992710984 5:79455864-79455886 AAGGATCCCCCGTCCCAGCGCGG + Intronic
995777905 5:115745511-115745533 AACTATCCCATGCCCCAGGTGGG + Intergenic
997530853 5:134580323-134580345 TGGGATCCCGGGGCCCAGGGCGG + Exonic
998391323 5:141788786-141788808 AAGGATTCCAGGCTCAAGGGAGG - Intergenic
1000455004 5:161437950-161437972 AAGGCCTCCAGGCCCCAGGTGGG - Intronic
1001042797 5:168348803-168348825 AAAGATCCCAGGCTGCAGTGTGG - Intronic
1001297316 5:170507013-170507035 AAGAAACCGAGGCCCCAGTGGGG - Intronic
1001592263 5:172873591-172873613 AAGGCTCCCAGGGCCCAGTGGGG + Intronic
1002643263 5:180640545-180640567 ATGGAGGCCAGGCCCCAAGGAGG - Intronic
1007295719 6:40819207-40819229 AGGGATCTTAGGCCCCAGGGTGG + Intergenic
1008438294 6:51501890-51501912 AAGGATCCCAGCCACCTGGAGGG - Intergenic
1011583908 6:88903279-88903301 AAGGATCACTGAACCCAGGGAGG + Intronic
1011654937 6:89543566-89543588 TAGGATCACAGGCCACAGGCGGG - Intronic
1017359764 6:153554037-153554059 AAGGATTCCAGGCCCAGGGTGGG + Intergenic
1018063396 6:160108126-160108148 AAGAATCCCATGGCTCAGGGAGG + Intronic
1018900520 6:168049708-168049730 AAGGAGCCCAGGCCCCGAGGAGG + Intergenic
1019133366 6:169893380-169893402 AAGCAACCCAGGCCACAGGCAGG - Intergenic
1019293191 7:260442-260464 CAGGAGCCGAGGCCCCAGGAAGG - Exonic
1019513311 7:1429156-1429178 GAGGCTCCCAGGCCCGAGGTGGG + Intronic
1019595128 7:1854866-1854888 GAGGGTGCCAGGCCCCAGGCAGG + Intronic
1020673976 7:11157121-11157143 GAGGATCTCATGCCCCAGTGTGG - Intronic
1023360923 7:39414490-39414512 GAGGGTCCCAGGCCTCAGGACGG - Intronic
1023788451 7:43731860-43731882 AAGGATCCCAGCACTCTGGGAGG - Intergenic
1023909048 7:44541043-44541065 AGGGATGCCAGGCCCCACAGAGG - Intronic
1024548498 7:50541283-50541305 AGGGATGACAGGGCCCAGGGAGG - Intronic
1026377059 7:69762394-69762416 AAGGATCACTGGAGCCAGGGAGG - Intronic
1026807338 7:73436498-73436520 AATTTTCCAAGGCCCCAGGGAGG - Intergenic
1027200869 7:76063177-76063199 GAGGATGCCAGGCCCGGGGGGGG + Intronic
1029203617 7:98855375-98855397 GAGGCTCCCAGGGCACAGGGTGG + Intronic
1029286650 7:99470397-99470419 AAGGATAGCAGCCCCCAGGGTGG - Intergenic
1032537803 7:132678923-132678945 AGAGATCCCAGGGCCCAGTGTGG + Intronic
1034253720 7:149713538-149713560 AGGGATCCCGGGCCGGAGGGTGG + Intergenic
1034324659 7:150219974-150219996 TAGGATCTCCAGCCCCAGGGTGG + Intergenic
1034545570 7:151786528-151786550 AAGGAGCTCAGGTCCTAGGGTGG + Exonic
1034768533 7:153749257-153749279 TAGGATCTCCAGCCCCAGGGTGG - Intergenic
1034900531 7:154905659-154905681 AAGGATACAAGGCCGGAGGGAGG - Intergenic
1035000819 7:155610959-155610981 ATGGCTTCCAGGACCCAGGGAGG - Intergenic
1035407206 7:158606968-158606990 TGGGTTCCCAGGCCCCAGGTGGG + Intergenic
1036203472 8:6788211-6788233 AAAGATCCCAGGCTCCATGGAGG + Intergenic
1037403384 8:18516016-18516038 GAGGATCCCAGCTACCAGGGAGG + Intergenic
1038715407 8:29986651-29986673 AGGGATCCCTGCCCCCAGAGGGG - Intergenic
1039881822 8:41629986-41630008 AGGGGTCCCCTGCCCCAGGGAGG - Intergenic
1039942682 8:42104582-42104604 AAGAGTCCCAGACACCAGGGAGG + Intergenic
1039996976 8:42542038-42542060 AAGCAGCCCGGGTCCCAGGGCGG - Intronic
1043116158 8:76255693-76255715 AAGCATGCCTGTCCCCAGGGAGG - Intergenic
1044157915 8:88873108-88873130 AATGCTGCCAGGCCCCAGGCAGG + Intergenic
1049454470 8:142680120-142680142 TAGGAGCACAGGGCCCAGGGAGG + Intronic
1052063386 9:23987523-23987545 AGGTCTCCCAGGCCCCAGGGAGG - Intergenic
1052641144 9:31166824-31166846 GAGGATGCCAGTCCCCAGGAAGG - Intergenic
1053137183 9:35658525-35658547 ACGGGTCCCAGGCCCCAGCTCGG + Intronic
1055629836 9:78212264-78212286 AAGGCACCCTGGCCCCAGGTCGG - Intergenic
1056666761 9:88587568-88587590 ATGGAGCCCAGGCACCAGGCTGG + Intergenic
1060548812 9:124475731-124475753 GAGGCCCCCAGGCCCCTGGGAGG + Intronic
1060911945 9:127358184-127358206 CAGGCTGCCAGGCCTCAGGGTGG - Intronic
1061249548 9:129418491-129418513 GCAGATCCCAGGGCCCAGGGTGG - Intergenic
1061999921 9:134210774-134210796 AAGGGCCACAGCCCCCAGGGTGG + Intergenic
1062065133 9:134522604-134522626 AAAGGTCCCAGGCTCCTGGGAGG + Intergenic
1062138831 9:134944313-134944335 AAGGAACCCATACCCCAGGCTGG - Intergenic
1062698270 9:137886322-137886344 AAGGACCTCAGGCCACGGGGAGG + Intronic
1187172264 X:16863639-16863661 AAGAAACTGAGGCCCCAGGGAGG - Intronic
1189104362 X:38220939-38220961 AAGGAGGGCAGGCCCCAGGCAGG - Intronic
1190717248 X:53114922-53114944 ACAGTTCCCAGGCTCCAGGGTGG - Intergenic
1192027213 X:67466416-67466438 AGGTCTCCCAGGCCCCAGGTGGG - Intergenic
1192559501 X:72116758-72116780 AAGGATGGCTGGCCCCAGTGAGG + Intergenic
1192869376 X:75171873-75171895 AGGGCTCCCAGGCTCCAGGTTGG + Intergenic
1193234844 X:79094187-79094209 AAGGAAACCAAGCCCCAGAGAGG - Intergenic
1193683656 X:84552282-84552304 GAGGTCCCCAGGCCCCAGGTGGG + Intergenic
1193907642 X:87262115-87262137 AGGTTTCCCAGGCCCCAGGTGGG - Intergenic
1195479119 X:105322444-105322466 AAGGATCCCAAGCTCCAGATGGG - Intronic
1202375647 Y:24233958-24233980 AAGGAAGCCAAGCCCCAGTGTGG + Intergenic
1202495133 Y:25436160-25436182 AAGGAAGCCAAGCCCCAGTGTGG - Intergenic