ID: 1086322537

View in Genome Browser
Species Human (GRCh38)
Location 11:85665081-85665103
Sequence TGGCGCGGTCGAGTCATCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 10}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086322537_1086322541 -2 Left 1086322537 11:85665081-85665103 CCTGCGATGACTCGACCGCGCCA 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1086322541 11:85665102-85665124 CACCCAGACAACGGCGTAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 36
1086322537_1086322544 8 Left 1086322537 11:85665081-85665103 CCTGCGATGACTCGACCGCGCCA 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1086322544 11:85665112-85665134 ACGGCGTAGCCGGAAGTCAGTGG 0: 1
1: 0
2: 0
3: 0
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086322537 Original CRISPR TGGCGCGGTCGAGTCATCGC AGG (reversed) Exonic