ID: 1086323825

View in Genome Browser
Species Human (GRCh38)
Location 11:85678208-85678230
Sequence GCTGACTTCAGAACTGGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086323825_1086323832 11 Left 1086323825 11:85678208-85678230 CCTACACCAGTTCTGAAGTCAGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1086323832 11:85678242-85678264 GGAGCCTTTCTTCAATTTAGTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1086323825_1086323835 25 Left 1086323825 11:85678208-85678230 CCTACACCAGTTCTGAAGTCAGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1086323835 11:85678256-85678278 ATTTAGTGGAAAACAGTTTTGGG 0: 1
1: 0
2: 2
3: 29
4: 361
1086323825_1086323834 24 Left 1086323825 11:85678208-85678230 CCTACACCAGTTCTGAAGTCAGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1086323834 11:85678255-85678277 AATTTAGTGGAAAACAGTTTTGG 0: 1
1: 0
2: 5
3: 25
4: 393
1086323825_1086323836 28 Left 1086323825 11:85678208-85678230 CCTACACCAGTTCTGAAGTCAGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1086323836 11:85678259-85678281 TAGTGGAAAACAGTTTTGGGAGG 0: 1
1: 0
2: 1
3: 18
4: 242
1086323825_1086323828 -10 Left 1086323825 11:85678208-85678230 CCTACACCAGTTCTGAAGTCAGC 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1086323828 11:85678221-85678243 TGAAGTCAGCCTCTCCTCCAGGG 0: 1
1: 1
2: 1
3: 32
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086323825 Original CRISPR GCTGACTTCAGAACTGGTGT AGG (reversed) Intronic
903392780 1:22976494-22976516 GCTGCCTTCAGAACTGGGCTAGG - Intergenic
903947281 1:26971873-26971895 GCTCTCTGCAGAGCTGGTGTGGG + Intergenic
908005398 1:59722742-59722764 GCTGATTCCAGAACTGGAGCAGG - Intronic
910798397 1:91121037-91121059 GCTGAGCTCAGCACTGGGGTTGG + Intergenic
911521956 1:98940219-98940241 GCATACTTGAGTACTGGTGTGGG + Intronic
912874207 1:113340471-113340493 GGTCACTTCAGACCTGGTATAGG - Intergenic
913714992 1:121524457-121524479 GCTGATTTCAGGGCTAGTGTGGG + Intergenic
915810800 1:158908145-158908167 GCTGACTTCATAAAATGTGTTGG - Intergenic
917441416 1:175072263-175072285 TCTGACTGCAGAAGGGGTGTTGG - Intronic
920793645 1:209117100-209117122 GGTCACTTCAGACCTGGAGTTGG + Intergenic
921110963 1:212036020-212036042 GCTGAGTTCAGAATTGGAGTCGG - Intronic
921533569 1:216315941-216315963 GCTCACTTTAGAACTGATTTAGG - Intronic
922562149 1:226577166-226577188 TCTGGCTTCAGCATTGGTGTTGG + Intronic
1063206246 10:3833806-3833828 GAGGACTTCTGAACAGGTGTTGG - Intergenic
1063719643 10:8566935-8566957 GCTGACGTCATAATTGGAGTTGG - Intergenic
1064348899 10:14558611-14558633 GCTGAGTTCAGAAATGGAGAAGG - Intronic
1067069434 10:43121068-43121090 GCAGATCTCAGAACTGCTGTGGG + Intronic
1067392582 10:45877732-45877754 GCTGATTCCAGAGCTGGTGCAGG + Intergenic
1067860907 10:49846848-49846870 GCTGATTCCAGAGCTGGTGCAGG + Intronic
1068785660 10:60969947-60969969 GCTGACATCAGAACTGAAATGGG - Intronic
1070602748 10:77877267-77877289 GCTAACTACAGGACTGGTTTTGG + Intronic
1071361335 10:84849151-84849173 GCTGTCTTCAGAATTGCTTTTGG + Intergenic
1073477860 10:103766130-103766152 GCTGACTTGAAAACGGATGTAGG - Intronic
1073625545 10:105091979-105092001 TCTGAGTTCTGACCTGGTGTAGG + Intronic
1074167691 10:110899471-110899493 GCTGACTACAGAATAGGTGAGGG + Exonic
1077535225 11:3120755-3120777 GGTGAGTTCCGAACTGGTGTGGG - Intronic
1079329895 11:19524604-19524626 GCTGACGTCAGTACTGGCTTTGG + Intronic
1079358857 11:19753701-19753723 GCTGAAGTCAGAACAGGTGGGGG + Intronic
1080108875 11:28543215-28543237 GCTGACACCAGGAGTGGTGTGGG + Intergenic
1080787053 11:35484884-35484906 GCTGACCACTGGACTGGTGTTGG - Intronic
1080856638 11:36117445-36117467 GCTGACTTCTGAACTGATCTTGG + Intronic
1081525134 11:43922817-43922839 GCTGACTGGAGTAATGGTGTTGG - Intergenic
1084589173 11:70080095-70080117 GCTTACTTAAGAAATGGTGATGG + Intronic
1086323825 11:85678208-85678230 GCTGACTTCAGAACTGGTGTAGG - Intronic
1087419494 11:97903195-97903217 GCTAACTTCAGAATTGATGTTGG + Intergenic
1088205939 11:107392408-107392430 GCTAACTTGAGACCTGGTGATGG - Intronic
1088246959 11:107827975-107827997 GCTGATTTCAGACCTGGGGCAGG + Intronic
1092302564 12:7265943-7265965 GCTGACTTCAGAACTGTGACAGG + Intergenic
1096858926 12:54508810-54508832 GCTGACTTTTTAAATGGTGTGGG + Intronic
1097136570 12:56861976-56861998 GCTGACTTCAGGGCTGATGCAGG - Intergenic
1097316079 12:58172874-58172896 GCTGACTTGAGAACTGGCAGAGG - Intergenic
1099048896 12:77759420-77759442 ACTGACTTAGGAATTGGTGTAGG + Intergenic
1103041326 12:117697892-117697914 GATGAGTTCATAACTGGAGTAGG + Intronic
1103470037 12:121173053-121173075 CCTGACTGCAGCACTGGTGAGGG + Intronic
1109703442 13:66057230-66057252 CCTGACCTCAGAGCTGGGGTTGG - Intergenic
1110037674 13:70709105-70709127 ACTGACTTCATAACTGTTTTTGG + Intergenic
1112403197 13:99094137-99094159 GTTGATTTCAGAACTGGGGTGGG + Intergenic
1112549704 13:100408255-100408277 GCTGGCTTCACAACTGGTAAGGG - Intronic
1113702951 13:112400691-112400713 AATGACTGCAGAACTGGGGTAGG - Intronic
1114155750 14:20101047-20101069 GCTAACTTCAGGACTGGGGTGGG - Intergenic
1117100066 14:52336340-52336362 GCTGACTTCAAAACTGGGGCAGG + Intergenic
1123983264 15:25622478-25622500 GCAGACTTCCTCACTGGTGTGGG - Intergenic
1124785577 15:32676624-32676646 GCTACCTTCAGAGCTAGTGTAGG - Intronic
1124964443 15:34422929-34422951 GCTGTCTTCAGAGCCGGTGGAGG - Intronic
1124981062 15:34569155-34569177 GCTGTCTTCAGAGCCGGTGGAGG - Intronic
1126446322 15:48748944-48748966 GCTGACTCCAGTACTGGGGAGGG + Intronic
1128772032 15:70290023-70290045 GCTGAAGACAGAACTGGTGGAGG + Intergenic
1130026097 15:80271714-80271736 TCTGACTTGAGAAATTGTGTGGG - Intergenic
1130045095 15:80437265-80437287 CCCGACTTCAGAGCTGGTGGCGG + Intronic
1130578909 15:85117404-85117426 GCTGAGGTCAGAGCTGCTGTGGG + Intronic
1131721743 15:95176509-95176531 GCTGATTACACAACTGGAGTAGG - Intergenic
1135501923 16:23003459-23003481 GCTGACTCCAGTCCTGGTCTTGG + Intergenic
1137572305 16:49574817-49574839 GCTGCCCTCAGAACAGCTGTGGG + Intronic
1138247013 16:55475234-55475256 GCTGAATTCAGACCTAGAGTTGG + Intronic
1138777811 16:59745676-59745698 TCTGCCTGCAGAGCTGGTGTTGG + Intronic
1139528318 16:67529544-67529566 GCTCTCTGCAGAACTGGTTTGGG + Intronic
1143275466 17:5706567-5706589 GCTGCCTTCTGAGCAGGTGTGGG + Intergenic
1144154029 17:12480792-12480814 ACTGACCACAGTACTGGTGTAGG + Intergenic
1144550424 17:16236457-16236479 GCTGATTTCAGAATTGGAGCAGG - Intronic
1145125644 17:20298047-20298069 GGTGATGTCAGAACTGGTGTTGG + Intronic
1147915860 17:43885384-43885406 GCTGATTCCAGACCTGGGGTAGG - Intronic
1150048718 17:61938002-61938024 TATGATTTCAGAAATGGTGTGGG - Intergenic
1150584049 17:66501583-66501605 GCTGTCTTCTTACCTGGTGTTGG + Intronic
1150935466 17:69630698-69630720 GCTGATTTCAGAGCTGGGGCAGG + Intergenic
1153083381 18:1255014-1255036 GCTGAGTTTAGAACCAGTGTCGG + Intergenic
1153890342 18:9508337-9508359 GTTGAGTTCAGACCTGGTGTGGG - Intronic
1154386328 18:13895693-13895715 GGTGACGTCAGACCTGGTTTTGG + Intronic
1154978821 18:21485456-21485478 GATGACTGCAGAGTTGGTGTCGG + Intronic
1155860515 18:30891894-30891916 GCTGACTTCACAACCAATGTTGG - Intergenic
1157030181 18:43896536-43896558 GCTGATTTCAGAGCTGGAGTAGG - Intergenic
1157587724 18:48815781-48815803 GCTGAAGTCAGCAGTGGTGTGGG + Intronic
1158545083 18:58389271-58389293 TCTGACTTCAGGACTGATGCTGG + Intronic
1160562228 18:79765761-79765783 TCTGCCTTCAGCCCTGGTGTTGG + Intergenic
1164083587 19:21881322-21881344 GTTGACTTCAGACTTGGTTTCGG + Intergenic
1165276480 19:34756743-34756765 GATGACTTCAGAACTATTCTGGG + Intergenic
1167154355 19:47729298-47729320 GCTGAGATCAGAGGTGGTGTGGG + Intronic
1168703773 19:58456547-58456569 GCTGGCTTCAGGACTGGGCTTGG - Exonic
928804911 2:35139612-35139634 GCTCAGTTCAGAACTCTTGTTGG + Intergenic
931008090 2:57875713-57875735 GCTGATGTCATCACTGGTGTTGG - Intergenic
932321404 2:70824537-70824559 GCTGACTCTAGAACTGGGGCAGG + Intergenic
934712708 2:96526450-96526472 TCTGACCTCAGGACAGGTGTGGG - Intergenic
935227977 2:101070735-101070757 GCTGACTACAGAATAGGTGAGGG - Intronic
936018430 2:108976881-108976903 GCTGACTCCAGAGCTGGGGCAGG - Intronic
936105376 2:109619395-109619417 GCTGACTTCAAGACAGGTGTAGG + Intergenic
936494159 2:113003408-113003430 CCTGAGTTCACAACTGCTGTTGG - Intergenic
937029685 2:118728151-118728173 ACTGACTTCAGTACTGGGGCAGG + Intergenic
943179919 2:184528811-184528833 GCTGACTCCTGACATGGTGTAGG + Intergenic
945541704 2:211095842-211095864 GCTAACTTAATAAATGGTGTAGG + Intergenic
947228949 2:227866337-227866359 GATGACTGCATCACTGGTGTTGG - Intergenic
949012719 2:241690495-241690517 GCTGACCTCAGCCCTGGCGTGGG + Intergenic
1172185252 20:33027471-33027493 GCTGAATTTAGAGCTGGGGTAGG + Intergenic
1172658602 20:36551190-36551212 ACTGGCTTCAGAACTGGCCTGGG + Exonic
1173202739 20:40966202-40966224 GCAGATTTCGGAACTGCTGTTGG - Intergenic
1173321677 20:41992904-41992926 GCTGACTTCGGAACATGTGGAGG - Intergenic
1173625726 20:44471521-44471543 TCTGAATTAAGAACTAGTGTGGG - Intergenic
1174068010 20:47879504-47879526 GCTGAATCCAGAATTGGTGGAGG + Intergenic
1174643286 20:52063644-52063666 GCTGACTCCAGGGCTGGGGTAGG + Intronic
1175487885 20:59358339-59358361 ACTGACTTCAGAGCTGGTCATGG + Intergenic
1176410330 21:6446250-6446272 CATGACTTCAGAGCCGGTGTGGG + Intergenic
1177990079 21:28026863-28026885 GCTGTGTTAAGAACTGATGTTGG - Intergenic
1178590155 21:33902797-33902819 GCTGACCTGGGAACTGGTTTTGG + Intronic
1179685823 21:43054572-43054594 CATGACTTCAGAGCCGGTGTGGG + Intronic
1181771408 22:25128376-25128398 GCTGGCTTCACACCAGGTGTTGG + Intronic
1181795886 22:25310174-25310196 GCTGACTTCATCACCTGTGTTGG + Intergenic
1181836416 22:25613703-25613725 GCTGACTTCATCACCTGTGTTGG + Intronic
1184296602 22:43529075-43529097 GCTGACATCGGAAGTGGGGTTGG - Intronic
949112591 3:280539-280561 GCTGAATTCAGAACTGCTTCTGG + Intronic
950454621 3:13085296-13085318 GCTGACTTCAGCTCTGGTCGGGG + Intergenic
950647022 3:14383320-14383342 GCTGACTTCAGAGCTGGGCCAGG - Intergenic
955172186 3:56577652-56577674 CCTTACTTCATAAATGGTGTTGG - Intronic
955174595 3:56601206-56601228 CCTTACTTCATAAATGGTGTTGG - Intronic
955733901 3:62016572-62016594 ACTGAAGTCAGAAATGGTGTTGG - Intronic
958522395 3:95206110-95206132 GCTGATTTTAGCACTGGTCTTGG - Intergenic
959411850 3:106033951-106033973 GCTATCTTCAGAGCTGGTTTTGG - Intergenic
961794458 3:129399634-129399656 TCTGAGTTGAGACCTGGTGTAGG + Intergenic
962243458 3:133771125-133771147 GCTGACTTCAGGGCTGGGGCAGG + Intronic
962745963 3:138397314-138397336 GCTGTGTCCAGAACTGGGGTGGG - Exonic
963275536 3:143326154-143326176 GATGACTTGAGATCTAGTGTGGG - Intronic
964364815 3:155938782-155938804 GAGGATTTAAGAACTGGTGTAGG + Exonic
964873630 3:161340899-161340921 CCTGGCTCCAGCACTGGTGTGGG - Intergenic
965031503 3:163374829-163374851 TCTGACTTCAGAACAAGAGTGGG - Intergenic
965651790 3:170941673-170941695 GCTGATTCCAGAACTGGGGCAGG + Intergenic
965922093 3:173929441-173929463 TCTGACTTCAGATATTGTGTGGG - Intronic
970323640 4:14900506-14900528 GCTGACTTCTGAACTGGAAAAGG - Intergenic
972209890 4:36824027-36824049 ACCTACATCAGAACTGGTGTTGG + Intergenic
972747581 4:41953250-41953272 GCATACTTCAGAAATGTTGTGGG + Intronic
979176863 4:117676240-117676262 GCTGATTTCAGGACTGGAGCAGG + Intergenic
982115589 4:152096080-152096102 GCTGCCCTCAGAAGTGCTGTGGG + Intergenic
984180434 4:176476150-176476172 GCTGACTTCAGGAGTGATGCGGG + Intergenic
984885679 4:184447143-184447165 GCTGACTCCAGAGCTGGGGCAGG + Intronic
989962741 5:50435996-50436018 GCTGATTTCAGGGCTAGTGTGGG - Intronic
993354585 5:86890216-86890238 GCTGACTTAGGAAGTGGTGAGGG + Intergenic
993573855 5:89577410-89577432 GCTGAATTCAGAATTGTTCTAGG + Intergenic
995482244 5:112604870-112604892 TCTGAATTCAGAAATGGTGGAGG + Intergenic
1001599685 5:172920754-172920776 GCAGAGTTCAGAACTGGGATTGG - Intronic
1002982224 6:2149592-2149614 ACTGGATTCAGAACTGGCGTGGG - Intronic
1002988370 6:2213984-2214006 GCTGATTCCAGATCTGGTGCAGG + Intronic
1004911189 6:20286336-20286358 GCTGATTCCAAAACTGGTATGGG + Intergenic
1010760837 6:79721111-79721133 GCTGACTGTGGACCTGGTGTAGG - Intergenic
1012870411 6:104666635-104666657 CCTCATTTCAGAACTGTTGTTGG - Intergenic
1014267204 6:119293543-119293565 GGTGACTTGAGAACTAGTGATGG - Intronic
1014658906 6:124141951-124141973 GCTGTGTTCAGAACTGGTCTAGG + Intronic
1015747130 6:136522176-136522198 GCTGACTTCAGGACTGGCTTAGG - Intronic
1020084631 7:5303726-5303748 GCTGACTTCAGCCAGGGTGTGGG - Exonic
1020287778 7:6698608-6698630 GCTGCATTCTGAACTGCTGTAGG - Intronic
1021847849 7:24779932-24779954 GCTGCCTTCAGAATGGGCGTGGG - Intergenic
1022378707 7:29840087-29840109 GCTGACTGCGGGACAGGTGTTGG - Intronic
1024097758 7:45998087-45998109 GCTAACTACAAAAATGGTGTTGG + Intergenic
1028008817 7:85614558-85614580 GCTGCTTACAGAAGTGGTGTGGG + Intergenic
1030389567 7:108909849-108909871 GCTGGCTTCAGAAGGGATGTAGG - Intergenic
1030930819 7:115521706-115521728 GCTGGGTTTAGAACTTGTGTGGG - Intergenic
1032822644 7:135538712-135538734 GTTGACTTCAGAACTATTGGTGG - Intergenic
1033830604 7:145247044-145247066 GCTGAATCTAGAACTGGGGTAGG - Intergenic
1035221066 7:157406877-157406899 GCTGCCTTCAGAGCTGCTCTGGG - Intronic
1036282917 8:7416917-7416939 GTAGAGTTCAGAACTGGTATTGG + Intergenic
1036338551 8:7894601-7894623 GTAGAGTTCAGAACTGGTATTGG - Intergenic
1037090248 8:14906650-14906672 GTTGATTTCAGTACTGGTGAGGG - Intronic
1037536400 8:19828343-19828365 GCTGGCTGGAGAACTGATGTGGG - Intronic
1038416031 8:27396804-27396826 GCTGTCTGCAGAACTGGGCTGGG + Intronic
1042897678 8:73688680-73688702 GGTGGCTTCTGAACTGGTTTGGG + Exonic
1043079384 8:75746570-75746592 GCAGACTTCAGTTCTGGAGTTGG - Intergenic
1049236024 8:141512866-141512888 CCTGCCTTGAGAATTGGTGTCGG + Intergenic
1051039661 9:12791908-12791930 GCTGACTTCAGACCTGTCCTAGG + Intronic
1051128017 9:13826769-13826791 GCTGAATTCTGGACTGGAGTAGG - Intergenic
1051958006 9:22720997-22721019 GCTGATTTCATAATTTGTGTTGG - Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1053501295 9:38596118-38596140 GCTGAATTCAGAATTGGAGAAGG - Intergenic
1057723166 9:97548954-97548976 GCTGACTGTAGGCCTGGTGTGGG - Intronic
1057798043 9:98172215-98172237 GCTGAGCTCAGAAGTGGGGTGGG - Intronic
1058816282 9:108685456-108685478 GCTGACTCCAGAAATGGCATAGG - Intergenic
1061477763 9:130880443-130880465 GCAGCCATCAGTACTGGTGTTGG - Intronic
1061914507 9:133742436-133742458 GCTGACCTCAGCCCTGGCGTAGG + Intergenic
1189432004 X:40955479-40955501 GCTGATTTCAGATCTGGGGCAGG + Intergenic
1189811932 X:44788854-44788876 GCTGATTTCAGTACTGGGGTAGG + Intergenic
1190059619 X:47202453-47202475 GCTGAGCACAGAACTGGTGCAGG - Exonic
1190116405 X:47628520-47628542 GCTTACTGCGGACCTGGTGTTGG - Intronic
1192348532 X:70334127-70334149 GTTGATTCCAGAACTGGGGTAGG - Intronic
1196398554 X:115290687-115290709 GCTGACTTTAGAAATGGAGAAGG + Intronic
1196548155 X:116989719-116989741 GCTGATTTTAGAAATGGGGTAGG + Intergenic
1196755342 X:119152535-119152557 GCTGACATTACAACCGGTGTAGG - Intergenic
1197199536 X:123735849-123735871 GCTGTATTCAGAACTGGTTCTGG + Intergenic
1200162125 X:154015029-154015051 TCTGATTTCAGAACTGGAGATGG - Intronic
1201506007 Y:14701099-14701121 GCTGATTTGAGAACTGGGGCAGG + Intronic