ID: 1086325490

View in Genome Browser
Species Human (GRCh38)
Location 11:85694514-85694536
Sequence TTTTGACTTAATTCTAAAAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 4, 3: 83, 4: 564}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086325490_1086325493 12 Left 1086325490 11:85694514-85694536 CCTATTTTAGAATTAAGTCAAAA 0: 1
1: 0
2: 4
3: 83
4: 564
Right 1086325493 11:85694549-85694571 TGAATTGTACCTATGGCCAGTGG 0: 1
1: 0
2: 1
3: 3
4: 93
1086325490_1086325494 13 Left 1086325490 11:85694514-85694536 CCTATTTTAGAATTAAGTCAAAA 0: 1
1: 0
2: 4
3: 83
4: 564
Right 1086325494 11:85694550-85694572 GAATTGTACCTATGGCCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 54
1086325490_1086325492 5 Left 1086325490 11:85694514-85694536 CCTATTTTAGAATTAAGTCAAAA 0: 1
1: 0
2: 4
3: 83
4: 564
Right 1086325492 11:85694542-85694564 CAACAACTGAATTGTACCTATGG 0: 1
1: 0
2: 0
3: 5
4: 114
1086325490_1086325495 16 Left 1086325490 11:85694514-85694536 CCTATTTTAGAATTAAGTCAAAA 0: 1
1: 0
2: 4
3: 83
4: 564
Right 1086325495 11:85694553-85694575 TTGTACCTATGGCCAGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086325490 Original CRISPR TTTTGACTTAATTCTAAAAT AGG (reversed) Exonic