ID: 1086325495

View in Genome Browser
Species Human (GRCh38)
Location 11:85694553-85694575
Sequence TTGTACCTATGGCCAGTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086325490_1086325495 16 Left 1086325490 11:85694514-85694536 CCTATTTTAGAATTAAGTCAAAA 0: 1
1: 0
2: 4
3: 83
4: 564
Right 1086325495 11:85694553-85694575 TTGTACCTATGGCCAGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086325495 Original CRISPR TTGTACCTATGGCCAGTGGG TGG Exonic