ID: 1086325495

View in Genome Browser
Species Human (GRCh38)
Location 11:85694553-85694575
Sequence TTGTACCTATGGCCAGTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086325490_1086325495 16 Left 1086325490 11:85694514-85694536 CCTATTTTAGAATTAAGTCAAAA 0: 1
1: 0
2: 4
3: 83
4: 564
Right 1086325495 11:85694553-85694575 TTGTACCTATGGCCAGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086325495 Original CRISPR TTGTACCTATGGCCAGTGGG TGG Exonic
900645670 1:3707643-3707665 TTGTGCGTAGGGCGAGTGGGTGG - Exonic
902755406 1:18546120-18546142 TGGTCTCTATGGCAAGTGGGAGG - Intergenic
903221107 1:21870164-21870186 TTGTACCTAGGGCCACAGCGAGG - Intronic
903296946 1:22350047-22350069 TTCTTCCTCTGGGCAGTGGGAGG + Intergenic
907409333 1:54273684-54273706 TTGCTCCTCTGTCCAGTGGGGGG - Intronic
908626527 1:66050273-66050295 TTGTATCGGTGGCCAGTGGCAGG + Intronic
918259205 1:182779542-182779564 TTGGACAGATGGACAGTGGGTGG - Intergenic
920591720 1:207225800-207225822 TAGGACCCATGGCCAATGGGAGG - Intergenic
922911526 1:229221717-229221739 TTGTTCCTTTGGCAAGTGTGGGG + Intergenic
1063299925 10:4842168-4842190 TTGTTCTAATGTCCAGTGGGGGG + Intronic
1065839131 10:29686019-29686041 TTGGTCCTAGGGCCAATGGGTGG - Intronic
1067934158 10:50594274-50594296 TTATACCCATGGGCAGTGTGTGG - Intronic
1067990098 10:51202166-51202188 CGTTATCTATGGCCAGTGGGAGG + Intronic
1074364424 10:112846467-112846489 TTTGAAATATGGCCAGTGGGCGG + Intergenic
1078401271 11:11029417-11029439 ATGTAGCTGTGGACAGTGGGAGG + Intergenic
1078798899 11:14623220-14623242 TTGTTCCTATGGCCATATGGGGG + Intronic
1080382763 11:31791030-31791052 TTCTAGCTGTGGCCAGTGGAAGG - Intronic
1080419129 11:32094484-32094506 TGGGACCTATGGCCACTTGGAGG - Intronic
1086325495 11:85694553-85694575 TTGTACCTATGGCCAGTGGGTGG + Exonic
1087086514 11:94224699-94224721 TTTCATCTTTGGCCAGTGGGAGG + Intergenic
1087884383 11:103460463-103460485 TTGTACATTGGGGCAGTGGGTGG + Intronic
1093203633 12:16220502-16220524 TTGTACCTCAGACCAGTGGTTGG + Intronic
1093534693 12:20209669-20209691 TGGTACCTATGGCCGGTTGAGGG + Intergenic
1097234363 12:57529311-57529333 CTGCACCTGTGGACAGTGGGTGG + Exonic
1101513031 12:105409814-105409836 TTGTCCCCATGGGCATTGGGAGG - Intergenic
1102723526 12:115038050-115038072 TTGTGCCTATGGTCAGCTGGGGG - Intergenic
1103057639 12:117834251-117834273 TTGTACCACTGACCAGAGGGTGG - Intronic
1109779267 13:67085779-67085801 TTGTTCAAATGGCCAGTGGATGG + Intronic
1116324350 14:43512927-43512949 TTTTAGCTATTGCCATTGGGAGG + Intergenic
1119199407 14:72741771-72741793 CTGTACCTCTGCCCACTGGGAGG - Intronic
1119786204 14:77316084-77316106 TGGTACCTATGTCCAGCAGGTGG - Intronic
1121379418 14:93449832-93449854 TTGTATCTAGGGCGAGTGAGGGG + Intronic
1127011602 15:54636577-54636599 TGGTACCTATGTCCAATGAGTGG - Intergenic
1131071259 15:89467594-89467616 TTATAGCTATGGCCTGTGGCAGG - Intergenic
1133479868 16:6159769-6159791 TTGTACATGTGGGCAATGGGTGG - Intronic
1137543712 16:49383112-49383134 TAAGACCAATGGCCAGTGGGTGG + Intronic
1140041434 16:71410982-71411004 GTGTACCTACGGCAAATGGGTGG - Intergenic
1140691868 16:77492339-77492361 TTGTATCTCAGCCCAGTGGGTGG - Intergenic
1140872657 16:79121415-79121437 TTTTACTTATGGCCAGTAGATGG + Intronic
1144726916 17:17506781-17506803 TTGCACCTGTGGCCAGGGGCTGG - Intronic
1145737559 17:27243696-27243718 TTTTACTTATGGCAGGTGGGTGG - Intergenic
1147384882 17:40075280-40075302 CTGTGCCTATGGCCAGGGAGAGG + Intronic
1149999867 17:61427240-61427262 TTCTAGCTTTGGCCACTGGGAGG - Intergenic
1151220131 17:72606000-72606022 CTCTTCCCATGGCCAGTGGGGGG - Intergenic
1153900162 18:9611515-9611537 TTGGACATATGGCCAGTTGAAGG - Intronic
1165472658 19:36012226-36012248 TTGTTCCTATTGCCTGGGGGAGG + Intronic
1165843300 19:38802310-38802332 TTATACCTCTTGCCTGTGGGAGG + Exonic
926055273 2:9770752-9770774 ATGTGCCTATGGCCTCTGGGAGG + Intergenic
935410211 2:102753735-102753757 TTTTGCCTATGGCCAGCAGGTGG + Intronic
935654060 2:105406797-105406819 TTCTACCTGCGGCCAGTGAGGGG + Intronic
937693563 2:124782505-124782527 TTCTACCTATGGCTTGTGGTTGG - Intronic
944068366 2:195643204-195643226 TAGTAACTAAGGCCATTGGGTGG + Intronic
944667523 2:201969787-201969809 CTGTTCCTATGGCCAGTCGTGGG - Intergenic
1170949911 20:20927009-20927031 CTGTTCCTACAGCCAGTGGGAGG + Intergenic
1172113760 20:32562156-32562178 TTCTGCCTATGGCCAGTGAGTGG - Intronic
1172634441 20:36400688-36400710 TTGTTCGTATGGAAAGTGGGAGG + Intronic
1173267374 20:41496928-41496950 TTGTACCTATAGCAAGAGGAAGG - Intronic
1173819999 20:46013597-46013619 TTGGACACAGGGCCAGTGGGCGG - Intronic
1179403953 21:41110236-41110258 TTGATGCTATGGCCTGTGGGAGG - Intergenic
1181862290 22:25828521-25828543 TTTTACTTTGGGCCAGTGGGAGG + Intronic
1182572063 22:31247017-31247039 TTGTCCCTGTGTCCAGTTGGTGG + Intronic
953533609 3:43759683-43759705 TTGTACCTGTGGACAATAGGGGG - Intergenic
953735617 3:45491753-45491775 CTGAAGCCATGGCCAGTGGGGGG - Exonic
954844605 3:53544612-53544634 TTGTGCCTGTTCCCAGTGGGAGG + Intronic
955655465 3:61240495-61240517 TTGTTTCTATAGCCAGTTGGAGG - Intronic
956041516 3:65149984-65150006 TTCTACCTCTTGCCAGTGAGAGG + Intergenic
963959119 3:151288165-151288187 TTGTCCCTATGTTCAGTGGCTGG + Intronic
966620329 3:181956255-181956277 GTGTACCCATGGCCTGTGAGTGG - Intergenic
970078744 4:12255236-12255258 TTGCACAGATGGCCAGGGGGAGG - Intergenic
979611318 4:122691800-122691822 TTCTACCTATGTGCGGTGGGGGG - Intergenic
982031768 4:151308413-151308435 TGGGACCTAGGGCCTGTGGGGGG - Intronic
982032391 4:151313694-151313716 GTGTAACTATTGCCAGTGGAGGG - Intronic
984830848 4:183971453-183971475 TAGTACCTCTGGCCAGAGGGTGG + Intronic
985879720 5:2628987-2629009 TTGCAGCTATGGACAGTGTGAGG - Intergenic
987946108 5:24610730-24610752 TTGTACCTATGTGCACTGAGGGG + Intronic
988278693 5:29115435-29115457 ATGGAACAATGGCCAGTGGGTGG + Intergenic
988609235 5:32710185-32710207 CTGTGGCTATGGCCAGTGGGAGG + Intronic
1005255767 6:24001441-24001463 TTCTACCTGTGGCCAGCGGTGGG + Intergenic
1008541935 6:52553049-52553071 TTCTAGCTATGGATAGTGGGAGG - Intronic
1010624465 6:78120044-78120066 TTGAGCTTATGGCCAGTGAGGGG + Intergenic
1012963117 6:105643829-105643851 ATGTACCTAATGCCAGTGTGGGG + Intergenic
1016192586 6:141288862-141288884 TTGTCCCTAGGGCAAGTGTGGGG + Intergenic
1017091891 6:150766500-150766522 ATGTACTTATGATCAGTGGGGGG + Intronic
1019221085 6:170473354-170473376 TTGTACCTCCTGGCAGTGGGAGG - Intergenic
1024879371 7:54068350-54068372 TTGTAGCTATGTCCACTGAGAGG + Intergenic
1025258385 7:57400279-57400301 TTCTACCCAGGGTCAGTGGGTGG - Intergenic
1028515068 7:91669237-91669259 GTGTTCCTATGGGCAGTGGTTGG - Intergenic
1030025190 7:105316803-105316825 TAGTAAGTATGGCCAGTGGGCGG - Intronic
1032089780 7:128905680-128905702 TTTTTTCTATGGGCAGTGGGGGG - Intronic
1032092465 7:128917851-128917873 TTTTTTCTATGGGCAGTGGGGGG + Intergenic
1032762949 7:134961737-134961759 TTGTACCTATTGAGAGGGGGAGG - Intronic
1034736820 7:153436897-153436919 TTCTAACTCTGGCCATTGGGAGG + Intergenic
1034820338 7:154211266-154211288 ATGTACCTATGCCCAGGTGGGGG - Intronic
1043282573 8:78486375-78486397 GTCTATCTATGGCCAGTGGCAGG + Intergenic
1043770705 8:84196233-84196255 TTGTACCACTGTCCAGTGGGAGG - Intronic
1044297444 8:90545271-90545293 TTGGACATATGGCCTTTGGGAGG - Intergenic
1048027541 8:130600597-130600619 TAGTACCTAAGGCCAGTGTGAGG + Intergenic
1048134086 8:131729118-131729140 TTGTACCTGTGGTGAGTTGGGGG + Intergenic
1050309553 9:4339273-4339295 ATGTAGCTAAAGCCAGTGGGAGG + Intronic
1051870382 9:21730697-21730719 TTGAATCTATGGACATTGGGAGG - Intergenic
1053146294 9:35714410-35714432 TTGTACCCAAGCCCAGAGGGAGG - Intronic
1055997872 9:82181229-82181251 TCTTACCTATGGGGAGTGGGGGG - Intergenic
1060991073 9:127849493-127849515 GTTTCCCTATGGCTAGTGGGTGG + Intronic
1190463719 X:50704896-50704918 TTAGACCTCTGACCAGTGGGAGG + Intronic
1191173393 X:57473896-57473918 TTGTGCCTTTGGCCAGTAGGTGG + Intronic
1192303934 X:69938140-69938162 CTGTCTCTATGGCCAGGGGGAGG - Intronic
1199950460 X:152701791-152701813 TTGCAGCCAGGGCCAGTGGGAGG + Exonic
1199952725 X:152718065-152718087 TTGCAGCCAGGGCCAGTGGGAGG + Exonic
1199955326 X:152737120-152737142 TTGCAGCCAGGGCCAGTGGGAGG + Exonic
1199956958 X:152750383-152750405 TTGCAGCCAGGGCCAGTGGGAGG - Intronic
1199959224 X:152766670-152766692 TTGCAGCCAGGGCCAGTGGGAGG - Exonic
1200018619 X:153183327-153183349 TTGCAGCCAAGGCCAGTGGGAGG + Exonic