ID: 1086325993

View in Genome Browser
Species Human (GRCh38)
Location 11:85700036-85700058
Sequence TTGTATCTGCACAATGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086325993_1086325995 -6 Left 1086325993 11:85700036-85700058 CCATTCACATTGTGCAGATACAA 0: 1
1: 0
2: 1
3: 16
4: 160
Right 1086325995 11:85700053-85700075 ATACAAATTTTTGGAGAGTGAGG 0: 1
1: 0
2: 2
3: 18
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086325993 Original CRISPR TTGTATCTGCACAATGTGAA TGG (reversed) Intronic
900849215 1:5129070-5129092 GTGTAGCTACACAATGTAAAAGG + Intergenic
903337727 1:22636146-22636168 TTTTATCTGTACACTGGGAACGG - Intergenic
904789696 1:33010109-33010131 TTTTATCTGCACTGTGTGAAGGG - Intronic
905035362 1:34914645-34914667 TTGTAACATCACAATGAGAAAGG - Intronic
907342450 1:53745775-53745797 ATGTATCTGCTCAATGGGTATGG + Intergenic
907626911 1:56039568-56039590 CTGTGTCTTCACAAGGTGAAAGG + Intergenic
907890218 1:58630116-58630138 TTTTATCTGCAATGTGTGAAGGG - Intergenic
911366114 1:96939545-96939567 TTTTATCTGCACAAAATGAATGG + Intergenic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
919506400 1:198403712-198403734 ATATATCTGCACAGTGTGGAAGG - Intergenic
921324951 1:213980410-213980432 GTGTGTCTGCAGAGTGTGAATGG - Intergenic
921598153 1:217077438-217077460 TTTTAGGTGCACAATGTGAATGG - Intronic
1063857247 10:10269003-10269025 TTGTATCTTCACATGGTGGAAGG + Intergenic
1066409603 10:35154054-35154076 TTCTAAGTGCACAATGTGTAAGG + Intronic
1073597255 10:104813276-104813298 TTGTGACTTCACATTGTGAAAGG + Intronic
1074455982 10:113595414-113595436 TTTTATCTGCAAAATGGTAATGG - Intronic
1074654509 10:115569968-115569990 CTGTATCTTCACATGGTGAAAGG + Intronic
1074737896 10:116454739-116454761 TTATACCTGCACAATGAAAAAGG - Intronic
1075748664 10:124745148-124745170 TTGTGTCTGCGCCATTTGAATGG + Intronic
1077735416 11:4785674-4785696 TTCTATTTGCAGAATTTGAAAGG - Intronic
1080239543 11:30110831-30110853 TTGCATCTGCCCAATGCGACGGG + Intergenic
1081646899 11:44796429-44796451 TTTTATCTCCACCGTGTGAAGGG - Intronic
1085156736 11:74302478-74302500 GTGTACATGCTCAATGTGAAAGG - Exonic
1086325993 11:85700036-85700058 TTGTATCTGCACAATGTGAATGG - Intronic
1087882001 11:103427652-103427674 TTGTATCTTCACACTGTGGAGGG + Intronic
1098381584 12:69875865-69875887 TTGTACCTGGACATTGTGAATGG + Intronic
1100168892 12:91949870-91949892 TAATATCTGTATAATGTGAAAGG - Intergenic
1100281458 12:93122168-93122190 TGTTCTCTCCACAATGTGAAGGG - Intergenic
1106497435 13:30293362-30293384 GTGTATGTGCACAGTGTAAAAGG - Intronic
1106754168 13:32805238-32805260 TTGGATCTGCATAGTTTGAATGG - Intergenic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1107462928 13:40621634-40621656 TTGTATCTGCACAATTCAATAGG + Intronic
1107542466 13:41403876-41403898 TTGTATCCTCAAAAGGTGAAAGG + Intergenic
1107759131 13:43657572-43657594 CTGCTTCTGCACAAAGTGAAGGG - Intronic
1109352191 13:61197497-61197519 TTTTATCTGCACTATGTGAATGG + Intergenic
1109444211 13:62412079-62412101 TTGTATCTGCCCAATGACACTGG + Intergenic
1110241164 13:73268671-73268693 TGGTATCTGCTCAAAGAGAAAGG - Intergenic
1111338642 13:86855057-86855079 CTGTGTCTTCACAATGCGAAGGG - Intergenic
1114134668 14:19834371-19834393 TTGTATCTGCCCTATCTGATGGG - Intergenic
1115322972 14:32105171-32105193 TTGTATCTGTTCAATAAGAAAGG + Intronic
1118845627 14:69545897-69545919 TTTTACCCGGACAATGTGAATGG - Intergenic
1119983805 14:79113138-79113160 TTTTATTTGCACAATTGGAAGGG - Intronic
1120257060 14:82134033-82134055 TTGAATCTGCAAAAAGAGAAAGG - Intergenic
1120700736 14:87696370-87696392 TTGTCTCTTCACAAAGTGAGTGG + Intergenic
1121570897 14:94945774-94945796 TAGTGCCTGCACACTGTGAAAGG - Intergenic
1122725293 14:103746537-103746559 TTGTAGCTGAACCGTGTGAATGG - Exonic
1126136686 15:45399494-45399516 TTGTACCTGCACATGGTGGAAGG - Intronic
1127183057 15:56445271-56445293 TTGTCTCTTGACAATGGGAATGG - Intronic
1130792960 15:87175753-87175775 TTTTATATGCAAAATGTAAATGG + Intergenic
1131981401 15:97998272-97998294 TTGTTTGTGAACAATGTCAATGG - Intergenic
1132082298 15:98876890-98876912 TGATTTCTGCACAATGTAAAAGG + Intronic
1132685487 16:1160352-1160374 TTGTATCTGCCCAGGGTGAGTGG - Intronic
1133594709 16:7280395-7280417 CAGTATCTGCACAATGTCCAAGG + Intronic
1133713292 16:8422328-8422350 TTTTAACTGGACAATTTGAAAGG + Intergenic
1137479028 16:48835916-48835938 TTGTGTCTTCACATGGTGAAAGG - Intergenic
1138109276 16:54310742-54310764 TGACAGCTGCACAATGTGAATGG + Intergenic
1142499699 17:325409-325431 TTGTGAGTGCAAAATGTGAAGGG - Intronic
1142562084 17:816177-816199 TTGTAACTGGACAGTGGGAAGGG - Intronic
1146536680 17:33658612-33658634 TTGTGTCTGCACACGGTGGAAGG + Intronic
1148498968 17:48074547-48074569 TAGAATCTGCACAAATTGAAAGG + Intronic
1148891360 17:50809683-50809705 TTGTGTCCTCACAAGGTGAAAGG - Intergenic
1149697401 17:58626907-58626929 TTTTATCTGATCAAGGTGAAGGG - Intronic
1150997653 17:70337589-70337611 CTATATCTGCACCATGGGAAAGG - Intergenic
1154308957 18:13253075-13253097 TTGTATCTGCAGAATATCACTGG - Intronic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1157209597 18:45730480-45730502 CTGTCTCTCCAAAATGTGAAAGG - Intronic
1158013326 18:52754491-52754513 TTGTATCCTCACATGGTGAAAGG - Intronic
1159502169 18:69287834-69287856 TTTTAACTGCACAATGTGAGTGG - Intergenic
1159562776 18:70012997-70013019 GTGCATCAGGACAATGTGAAAGG + Intronic
1159665948 18:71160299-71160321 TTATATCTGCTCTATGTGTATGG + Intergenic
1159937228 18:74378879-74378901 TTCTATCTGCACAAGGTAACAGG + Intergenic
1164413315 19:28023299-28023321 TGGCACCTGCACAATGAGAATGG - Intergenic
1164982901 19:32627776-32627798 TTGAATCTGAACTATGAGAACGG - Intronic
1166422681 19:42651070-42651092 CTGTATCTGCACATGGTGGAGGG - Intronic
1167165861 19:47799416-47799438 TTGTTTCTGCAAAAAGTAAAAGG + Intergenic
926927152 2:17998646-17998668 TTTTATATGCAAAATGTGTAAGG + Intronic
929315796 2:40476848-40476870 TTGTATCAGAAAAATCTGAAAGG - Intronic
929369023 2:41198813-41198835 TTGTATCTTCAAAGTCTGAAGGG + Intergenic
930060736 2:47286420-47286442 TTGTATCTTCACATTGTCAGGGG + Intergenic
930368001 2:50466844-50466866 CTGTATCTGCACATGATGAATGG - Intronic
931910535 2:66894787-66894809 CTGCATCTGCATAAAGTGAAGGG + Intergenic
933069668 2:77841210-77841232 TTGTATCTACACAAGGCAAAGGG - Intergenic
933205142 2:79498653-79498675 TTCTATCTGCATATTCTGAATGG + Intronic
933429526 2:82157766-82157788 TTGGATTTCCACAAAGTGAAAGG + Intergenic
935550326 2:104446117-104446139 CAGTATCTGCACAGTTTGAAAGG + Intergenic
935607849 2:104988493-104988515 TTATATATTCACCATGTGAATGG - Intergenic
937423611 2:121778861-121778883 ATGTATCTGGCCAATGAGAAGGG + Intergenic
937532561 2:122846600-122846622 TTGTAGATGCATCATGTGAAGGG + Intergenic
937977432 2:127590082-127590104 TTGAGTCTGCAGACTGTGAATGG - Exonic
941743581 2:169062670-169062692 TTGTATCTTCACAATGTACCAGG - Intergenic
942442974 2:176055187-176055209 TTGTATCTTCACATAGTGGAGGG + Intergenic
944281264 2:197900722-197900744 TTGTATGTTTACAAAGTGAAAGG + Intronic
946028660 2:216688043-216688065 ATGTATCTGCACATGGTTAATGG - Intronic
947037111 2:225872109-225872131 ATGAATCCCCACAATGTGAAAGG + Intergenic
1177498447 21:21918827-21918849 TTGTATCCTCACATGGTGAAAGG + Intergenic
1178189823 21:30267518-30267540 TTGTATCTTCACACGGTGGAAGG + Intergenic
950998292 3:17528359-17528381 TTGTATCCTCACATGGTGAAAGG - Intronic
953730917 3:45447315-45447337 TTGTATCTGCTAAATGGGAATGG + Intronic
954524458 3:51257494-51257516 TTGTTTGTTCACAATGTGAGAGG + Intronic
955646453 3:61143083-61143105 TTGTATCTTCACAATTTGTAAGG - Intronic
955728222 3:61955261-61955283 TTTTAACTGGAAAATGTGAATGG + Intronic
955871731 3:63445979-63446001 TTGTATCTGCTCAAGTTGAGTGG - Intronic
957169150 3:76715064-76715086 TTGTATTTGCACAATGATTAGGG + Intronic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
957975501 3:87438478-87438500 TTGTATATGCACAAAGTGCAAGG - Intergenic
958433371 3:94068198-94068220 TTGTGTATATACAATGTGAATGG + Intronic
959522136 3:107332944-107332966 TTCTATTGGCACAATATGAATGG + Intergenic
959995829 3:112679366-112679388 TTGTATCCCCACAAGGTGGAAGG + Intergenic
963497670 3:146087872-146087894 TATTCTCTGGACAATGTGAATGG + Intronic
963777519 3:149453897-149453919 ATGTATGTGCACAAAGGGAAGGG + Intergenic
964663229 3:159143964-159143986 TTGTATCTTCACATGGTGGAAGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966942790 3:184757572-184757594 CTGCATATGCACAATGTGAGCGG + Intergenic
967129937 3:186461328-186461350 ATGTATCTCCACAATGAGAACGG - Intergenic
969052748 4:4385050-4385072 TTGTATCTGGGCCCTGTGAAGGG - Exonic
969148216 4:5142859-5142881 TTGATTCTCCACAATGTGGATGG + Intronic
971426783 4:26523839-26523861 TTGTATCTGCAGATTTTAAAAGG - Intergenic
971429319 4:26547822-26547844 TTGAATCTGTACATTGTGATGGG + Intergenic
971662138 4:29432564-29432586 TTTCATCTTCACAATGTGAATGG - Intergenic
971844625 4:31903570-31903592 TTGTATCCTCACATTGTGGAAGG - Intergenic
971933900 4:33121692-33121714 TTGTATCTGAAAACTGTAAATGG - Intergenic
974266613 4:59594014-59594036 TTGCATCAGCACATGGTGAAAGG - Intergenic
974362851 4:60904888-60904910 TAATATCTTCACATTGTGAAAGG + Intergenic
974867172 4:67595489-67595511 GTGTCAATGCACAATGTGAAAGG + Intronic
974869138 4:67617389-67617411 TGGGATATGCACAATGGGAAAGG + Exonic
975588080 4:75971327-75971349 TTGTATCTGGAAAATGAGATAGG - Intronic
976110309 4:81666159-81666181 TTGTGTCTTCACAACTTGAAAGG - Intronic
976205617 4:82620766-82620788 GTGTATTTGGACAATGAGAAGGG + Intergenic
976479984 4:85530896-85530918 TTGCATTTGCATAATGTGCAGGG + Intronic
977087282 4:92618174-92618196 TTATTTCTGCATAGTGTGAAAGG + Intronic
979149373 4:117290066-117290088 TTGAAGCTGCAGAAAGTGAAAGG - Intergenic
986941868 5:12962371-12962393 TTATATATGCAAAATGTGTAAGG + Intergenic
987020100 5:13861610-13861632 TTGTATGTCCAAAATGTGAGGGG + Intronic
989077751 5:37582682-37582704 TTATATCAGCACTATGTTAAGGG - Intronic
990845273 5:60130613-60130635 TGGTATCTGCAAAAAGTAAAGGG + Intronic
991920583 5:71652897-71652919 TTGTTTCTTTACAATCTGAATGG + Intronic
992212981 5:74498535-74498557 ATGTAGCTGCAGAATGTCAAAGG - Intergenic
995624762 5:114064217-114064239 GTGTGTCTGCACAAAGTGAGAGG - Intergenic
998347816 5:141479729-141479751 AAGTATATGCACAATGTGAAAGG + Intronic
1009989839 6:70828656-70828678 TTCTATTTCCACAATGTGGAAGG - Intronic
1013251790 6:108341731-108341753 ATCTATCTGCACAATCTAAAAGG + Intronic
1013834736 6:114320721-114320743 TTGTATCTGCTTTATGTGTAGGG + Intronic
1015481661 6:133718200-133718222 TTGTGTATCCAAAATGTGAATGG - Intergenic
1020211501 7:6161409-6161431 TTGTATCTGAATAATCTGTATGG + Exonic
1020739910 7:12002028-12002050 TTGTATTTGAACACTGTAAATGG - Intergenic
1022865686 7:34417314-34417336 TTGTATCTGCAAAATATCAATGG - Intergenic
1022959565 7:35413594-35413616 TTCCATCTGCACAATGTTTAGGG - Intergenic
1023368299 7:39487202-39487224 TTGAATATGCACATTTTGAAGGG - Intronic
1025157064 7:56616644-56616666 TTTTATCTGAACCATGTCAAAGG - Intergenic
1026666528 7:72345276-72345298 TTGAAACTGCACATGGTGAATGG + Intronic
1026964015 7:74427733-74427755 TTGGGTGTCCACAATGTGAAAGG - Intergenic
1027735702 7:81930494-81930516 TTGTATCTCCACATGGTGGAGGG - Intergenic
1029681101 7:102111317-102111339 TTGTGTCAGCAGAATGTAAATGG + Intronic
1030618961 7:111769019-111769041 CTGTATCTTCACATGGTGAAAGG - Intronic
1033946880 7:146729743-146729765 TTTTCTATGCAAAATGTGAAAGG + Intronic
1037467483 8:19174172-19174194 TTGTAGCTGCACCATCTGGATGG - Intergenic
1037894703 8:22644190-22644212 TTTTATCTCCAGAATGGGAAAGG - Intronic
1039694283 8:39894183-39894205 TTGTATATGATCAATTTGAAAGG + Intergenic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040741566 8:50581712-50581734 TTTTATTGGCACAATGGGAAGGG + Intronic
1043686094 8:83087837-83087859 TTGCATCTGGACAATGTGTGAGG - Intergenic
1046626196 8:116579082-116579104 TTGCTCCTGAACAATGTGAAGGG - Intergenic
1047136124 8:122080244-122080266 TTGGATCTTCCAAATGTGAAAGG - Intergenic
1047325286 8:123830020-123830042 TTGAACCTGCACAATCTGGAGGG - Intergenic
1048298206 8:133231510-133231532 ATGTGTTTGCTCAATGTGAAGGG + Intergenic
1049931761 9:463979-464001 TTGTTTTGGCACAGTGTGAAGGG + Intronic
1050901483 9:10954274-10954296 TTGTTTCTGGACAATGTGTTGGG - Intergenic
1052679632 9:31672945-31672967 TTGTATCCTCACATGGTGAAAGG + Intergenic
1056923949 9:90816575-90816597 TTATATCTGTACAAGGTGGAAGG + Intronic
1057858000 9:98617048-98617070 TTATACCTTCAGAATGTGAATGG - Intronic
1185747913 X:2586173-2586195 TTGAATCTGCAGTCTGTGAAAGG + Intergenic
1186180643 X:6969523-6969545 TTGTGTCTGAAAACTGTGAAGGG + Intergenic
1187469503 X:19556183-19556205 TTCTATCTGCATGATTTGAAAGG - Intronic
1193335391 X:80282116-80282138 TAATATGTGCAAAATGTGAAAGG - Intergenic
1196166361 X:112539403-112539425 TTGTATCCTCAAAATGTTAAAGG - Intergenic
1199079128 X:143556813-143556835 TTGTGTTTGCACATTGTGTATGG - Intergenic
1200709665 Y:6472166-6472188 TTGTCTCTCCACAATGAGAAAGG + Intergenic
1201024447 Y:9692542-9692564 TTGTCTCTCCACAATGAGAAAGG - Intergenic