ID: 1086333662

View in Genome Browser
Species Human (GRCh38)
Location 11:85778339-85778361
Sequence ACTATTTGATAGTGTTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 100}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086333651_1086333662 20 Left 1086333651 11:85778296-85778318 CCCAAAGCAATTAGCAAGCAGTG 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1086333662 11:85778339-85778361 ACTATTTGATAGTGTTACCCAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1086333646_1086333662 29 Left 1086333646 11:85778287-85778309 CCCTCACCCCCCAAAGCAATTAG 0: 1
1: 0
2: 1
3: 18
4: 229
Right 1086333662 11:85778339-85778361 ACTATTTGATAGTGTTACCCAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1086333648_1086333662 23 Left 1086333648 11:85778293-85778315 CCCCCCAAAGCAATTAGCAAGCA 0: 1
1: 0
2: 1
3: 11
4: 181
Right 1086333662 11:85778339-85778361 ACTATTTGATAGTGTTACCCAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1086333647_1086333662 28 Left 1086333647 11:85778288-85778310 CCTCACCCCCCAAAGCAATTAGC 0: 1
1: 0
2: 1
3: 32
4: 356
Right 1086333662 11:85778339-85778361 ACTATTTGATAGTGTTACCCAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1086333649_1086333662 22 Left 1086333649 11:85778294-85778316 CCCCCAAAGCAATTAGCAAGCAG 0: 1
1: 0
2: 1
3: 12
4: 136
Right 1086333662 11:85778339-85778361 ACTATTTGATAGTGTTACCCAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1086333645_1086333662 30 Left 1086333645 11:85778286-85778308 CCCCTCACCCCCCAAAGCAATTA 0: 1
1: 0
2: 0
3: 30
4: 270
Right 1086333662 11:85778339-85778361 ACTATTTGATAGTGTTACCCAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1086333652_1086333662 19 Left 1086333652 11:85778297-85778319 CCAAAGCAATTAGCAAGCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1086333662 11:85778339-85778361 ACTATTTGATAGTGTTACCCAGG 0: 1
1: 0
2: 0
3: 11
4: 100
1086333650_1086333662 21 Left 1086333650 11:85778295-85778317 CCCCAAAGCAATTAGCAAGCAGT 0: 1
1: 0
2: 3
3: 17
4: 198
Right 1086333662 11:85778339-85778361 ACTATTTGATAGTGTTACCCAGG 0: 1
1: 0
2: 0
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086333662 Original CRISPR ACTATTTGATAGTGTTACCC AGG Intronic
905906345 1:41621004-41621026 AGTAATTGACAGTGTGACCCTGG + Intronic
909034069 1:70577161-70577183 CTTATTTGATAATGTTTCCCAGG - Intergenic
915115083 1:153593132-153593154 ACTATCAGATAGTGCTACTCTGG + Intergenic
916855263 1:168742712-168742734 ACTATTTGGCAGTGTGACCTTGG - Intergenic
916927838 1:169541701-169541723 AATGTTTGATAGTGTTCCTCTGG + Exonic
918564639 1:185914319-185914341 GATATTAGATAGTGTTTCCCTGG + Intronic
1064932479 10:20642749-20642771 TCTATCTGAGAGTGTTTCCCAGG - Intergenic
1079884213 11:25966164-25966186 AATACATGATAGTGTTACCAGGG + Intergenic
1086333662 11:85778339-85778361 ACTATTTGATAGTGTTACCCAGG + Intronic
1090574720 11:128088455-128088477 ACTATTTAATACTGTTACATTGG + Intergenic
1092684510 12:11027071-11027093 AGGATTTCACAGTGTTACCCAGG - Intronic
1093120163 12:15260473-15260495 AGTTGTTGATAGTGTTATCCAGG - Intronic
1093959956 12:25261674-25261696 ACTTTTTAATATTGTTACACTGG - Intergenic
1095883590 12:47165060-47165082 ACTGCTTGAGAGTTTTACCCTGG + Intronic
1100828690 12:98498235-98498257 ACTGTTTCATAATGTTGCCCAGG - Intronic
1104486891 12:129159181-129159203 AGTATTTGGTTCTGTTACCCTGG + Intronic
1105050354 12:133044399-133044421 ACTATTTGATAGGGTGAGGCAGG - Intronic
1105637793 13:22232155-22232177 GCTATTTGACAGTGTTGCACAGG - Intergenic
1105870725 13:24504121-24504143 ATTATTTGATAGTGAAACCATGG + Intronic
1112143513 13:96672509-96672531 ACTATTTCATAGTGATATCCTGG + Intronic
1119019035 14:71090536-71090558 ACTATTTGAGGATGTTGCCCTGG + Intronic
1121116019 14:91343353-91343375 ACGATTTGCTAATGGTACCCTGG + Intronic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1124171050 15:27374320-27374342 ACTGTTTCACAGTGTTGCCCAGG + Intronic
1126130474 15:45336449-45336471 ACTTTTTGATTGTGTGACCTTGG + Intergenic
1126286666 15:47020244-47020266 CATATTTGATAGTGTTTCACAGG - Intergenic
1127620601 15:60730100-60730122 ACTATTTAAAAGTGATACCAAGG - Intronic
1135625241 16:23989274-23989296 ATTATTTAAGAGTGTTGCCCAGG + Intronic
1139179473 16:64729019-64729041 ACTATTTGGTAATGTGACCCAGG + Intergenic
1139343481 16:66287143-66287165 GATATTTAATGGTGTTACCCGGG + Intergenic
1139343741 16:66288883-66288905 GATATTTGATGGTGTTACACAGG + Intergenic
1144077763 17:11734323-11734345 ACTATTTTGTAGAATTACCCAGG - Intronic
1148059580 17:44826337-44826359 ACTGTTTCATCGTGTTAACCAGG - Intronic
1158703773 18:59772139-59772161 AATATTTGCTGGTGATACCCAGG + Intergenic
1159982114 18:74795549-74795571 ATTAATTGATAGTTTTACCATGG + Intronic
1165119951 19:33552592-33552614 ACAATTTGATTGGGTTCCCCAGG + Intergenic
927536692 2:23867286-23867308 ACAACTTGAGAGTATTACCCAGG - Intronic
928796367 2:35026228-35026250 ACTATCTGATACTGTTATACAGG - Intergenic
929408786 2:41673017-41673039 ACTATTTGATTTTGTTTCCATGG + Intergenic
931203496 2:60124202-60124224 GCTGTTTGATATTGTTACACAGG - Intergenic
933246603 2:79982987-79983009 ATTATTTGATAGAGAGACCCAGG - Intronic
933934151 2:87187179-87187201 ACTCTATGAATGTGTTACCCAGG + Intergenic
936358993 2:111778716-111778738 ACTCTATGAATGTGTTACCCAGG - Exonic
936858971 2:116993363-116993385 ACAGTTGGATAGTGTTACCCTGG + Intergenic
937259761 2:120577917-120577939 GCTATTTGCTCGTGTTCCCCTGG - Intergenic
937808773 2:126176481-126176503 ACTTTCTGGTAGTGTTACCTCGG - Intergenic
938835592 2:135100428-135100450 ACTCTTTGTTTCTGTTACCCAGG + Intronic
939212721 2:139197506-139197528 AATATTTGCTAATGTTTCCCAGG - Intergenic
940687913 2:156876976-156876998 ATTTTTTGGTGGTGTTACCCAGG - Intergenic
941610157 2:167651836-167651858 AACATTTAATGGTGTTACCCAGG + Intergenic
1171040659 20:21759576-21759598 AGCTTTTGATAGTGGTACCCTGG - Intergenic
1172471691 20:35202824-35202846 ACCAGTTGATAATGTTATCCAGG - Intergenic
1173666378 20:44766247-44766269 AGTAATTGATAGTGGTTCCCTGG - Intronic
1177378355 21:20303822-20303844 AGAATTTGATAATGTTACCCAGG + Intergenic
1178518862 21:33270565-33270587 ACTGTTTCACCGTGTTACCCAGG + Intronic
1179120806 21:38544038-38544060 ACTATTCAATAGTGTTCCCCAGG - Intronic
1181575981 22:23795213-23795235 ACGATTTGACTGTGTTGCCCAGG + Intronic
952833056 3:37581400-37581422 ACTGTTTGACAGTGTAGCCCAGG + Intronic
953186187 3:40640521-40640543 ACTATTTCCCAGTGTTTCCCAGG - Intergenic
956491160 3:69773576-69773598 AGGTTTTGATACTGTTACCCTGG + Intronic
962113701 3:132478165-132478187 ACTATTTGATAGTGTCACTAGGG + Intronic
966295804 3:178421328-178421350 AATATTTAATATTGTTTCCCAGG - Intronic
968568918 4:1329220-1329242 TCTATTTGCCTGTGTTACCCTGG + Intronic
972711991 4:41606708-41606730 GCTAGTACATAGTGTTACCCAGG + Intronic
976150090 4:82082861-82082883 AGTATGTGATAGGGTTACCATGG - Intergenic
980062313 4:128144470-128144492 ACTATTTGATAATATTTCACAGG + Intronic
988471259 5:31541398-31541420 AATGTTTGAGAGTCTTACCCAGG - Exonic
991601716 5:68357649-68357671 AATATTTGATTGTGCTACACCGG + Intergenic
992084318 5:73264302-73264324 AATGTTTGATAATGTTACACAGG + Intergenic
993382724 5:87226144-87226166 TCTATTTCATAATCTTACCCAGG - Intergenic
999503125 5:152166554-152166576 ACTAATTTACAGTGTCACCCTGG - Intergenic
1000670816 5:164060914-164060936 AGTATTTGGATGTGTTACCCTGG - Intergenic
1001759675 5:174197076-174197098 ATTATTTGATGGTGATACTCTGG + Intronic
1005042801 6:21614648-21614670 ACTGGTTGAGAATGTTACCCTGG - Intergenic
1006657627 6:35609530-35609552 GCCAGTTGATAGTGGTACCCAGG - Intronic
1009743003 6:67772217-67772239 AGTATCTGATACTGTTTCCCTGG + Intergenic
1011013202 6:82725218-82725240 ACTATTTCATAATGTTCCCGGGG + Intergenic
1011029044 6:82901345-82901367 ACTATTTGAAAGTGTTTCCTGGG - Intronic
1012143618 6:95653837-95653859 ACTATTTTATATTGTTACAATGG + Intergenic
1013997028 6:116321116-116321138 AGTATTTGAAAGTGTGACCTGGG - Intronic
1014249009 6:119096973-119096995 AAGATTTTATTGTGTTACCCTGG + Intronic
1015262052 6:131249235-131249257 AGTATTTGAGAGTGTTATCAAGG - Intronic
1016184430 6:141181820-141181842 ACTTTTTGATGGGGTTGCCCTGG - Intergenic
1020863524 7:13525149-13525171 AATATTTGATAATGTTAAACTGG + Intergenic
1021486198 7:21170733-21170755 ATTATTTGACATTGTTATCCCGG + Intergenic
1022015159 7:26343344-26343366 ACTCTTTCATAGTGTGACCTTGG + Intronic
1029281878 7:99440545-99440567 ACTATTTCATCATGTTTCCCAGG + Intronic
1031725580 7:125233902-125233924 ATTATGTGATAGTGTAACCTCGG + Intergenic
1032513500 7:132490616-132490638 AGTATTTCATCATGTTACCCAGG + Intronic
1033580631 7:142730475-142730497 ACTATTTGAAAATGCAACCCTGG - Intergenic
1039170287 8:34737691-34737713 ACTATTTGATAGAATTCCCATGG - Intergenic
1040499211 8:47992483-47992505 TCTATTTGCCAGTGTTCCCCTGG + Intergenic
1040857668 8:51965962-51965984 CATATTTGATGGTGTTACACAGG + Intergenic
1042154813 8:65832983-65833005 ACTACTTAATTGTGTTACCTTGG + Intronic
1043570523 8:81597811-81597833 ACTATATAATAGTGTTTCCCAGG + Intergenic
1043592663 8:81848233-81848255 TCTAATTGACAGTGTTCCCCTGG - Intergenic
1044146063 8:88715276-88715298 ACTATTTCAGAATTTTACCCAGG - Intergenic
1046072306 8:109271569-109271591 ACCATTTGATATTGTTCCACAGG - Intronic
1050025644 9:1331922-1331944 AATATTTAGTAGTGTTATCCAGG - Intergenic
1052412906 9:28145831-28145853 ACTAATTGATAATCTTACCCAGG + Intronic
1052575071 9:30281263-30281285 ACCATTTGCCAGTGTTCCCCTGG + Intergenic
1053043520 9:34894289-34894311 ACTAGTTGAGAGAGTTACCAGGG - Intergenic
1059573492 9:115465983-115466005 ACTTTTTGGTAGTGTGACTCAGG - Intergenic
1059871440 9:118582362-118582384 ACGAATTGATAGTGATACCAAGG - Intergenic
1062102402 9:134735249-134735271 CATGTTTGATAGAGTTACCCAGG + Intronic
1188369657 X:29353122-29353144 ATTATTTGATTGTGTGATCCAGG + Intronic
1190421970 X:50294315-50294337 ACTGTTTAATAGTGTTAGTCAGG + Intronic
1193415402 X:81216503-81216525 ACTATTTGACAGTGCAACCAGGG - Intronic
1193557156 X:82969128-82969150 AGAATTTCATAGTGATACCCTGG - Intergenic
1195169292 X:102250197-102250219 ACTATTTGATAATGAAAGCCAGG - Intergenic
1195189565 X:102436891-102436913 ACTATTTGATAATGAAAGCCAGG + Intronic
1198517363 X:137423311-137423333 AGTATTTGTAAGTGTTACCCAGG + Intergenic