ID: 1086337909

View in Genome Browser
Species Human (GRCh38)
Location 11:85817588-85817610
Sequence GTACCCAGTCAGCTTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086337909_1086337915 13 Left 1086337909 11:85817588-85817610 CCTGCTTGAAGCTGACTGGGTAC No data
Right 1086337915 11:85817624-85817646 GTTTTCCCACTTGGGAGAAGAGG No data
1086337909_1086337912 4 Left 1086337909 11:85817588-85817610 CCTGCTTGAAGCTGACTGGGTAC No data
Right 1086337912 11:85817615-85817637 CCTACCTCAGTTTTCCCACTTGG No data
1086337909_1086337913 5 Left 1086337909 11:85817588-85817610 CCTGCTTGAAGCTGACTGGGTAC No data
Right 1086337913 11:85817616-85817638 CTACCTCAGTTTTCCCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086337909 Original CRISPR GTACCCAGTCAGCTTCAAGC AGG (reversed) Intergenic
No off target data available for this crispr