ID: 1086338771

View in Genome Browser
Species Human (GRCh38)
Location 11:85826230-85826252
Sequence CAGGATGCACAGGAGGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086338765_1086338771 25 Left 1086338765 11:85826182-85826204 CCCCAGGTGATTCTTTTGACATT No data
Right 1086338771 11:85826230-85826252 CAGGATGCACAGGAGGACTGAGG No data
1086338766_1086338771 24 Left 1086338766 11:85826183-85826205 CCCAGGTGATTCTTTTGACATTA No data
Right 1086338771 11:85826230-85826252 CAGGATGCACAGGAGGACTGAGG No data
1086338767_1086338771 23 Left 1086338767 11:85826184-85826206 CCAGGTGATTCTTTTGACATTAA No data
Right 1086338771 11:85826230-85826252 CAGGATGCACAGGAGGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086338771 Original CRISPR CAGGATGCACAGGAGGACTG AGG Intergenic
No off target data available for this crispr