ID: 1086338968

View in Genome Browser
Species Human (GRCh38)
Location 11:85827559-85827581
Sequence TAGAATATGGAGGAGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086338968_1086338975 12 Left 1086338968 11:85827559-85827581 CCTGCCAACTCCTCCATATTCTA No data
Right 1086338975 11:85827594-85827616 AAGGCCTGTTTTGTCCACTGTGG No data
1086338968_1086338973 -7 Left 1086338968 11:85827559-85827581 CCTGCCAACTCCTCCATATTCTA No data
Right 1086338973 11:85827575-85827597 TATTCTATGGATCCTAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086338968 Original CRISPR TAGAATATGGAGGAGTTGGC AGG (reversed) Intergenic
No off target data available for this crispr