ID: 1086342120

View in Genome Browser
Species Human (GRCh38)
Location 11:85857385-85857407
Sequence CTGGAAGGGCGAAACAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086342113_1086342120 3 Left 1086342113 11:85857359-85857381 CCAAGGCTGGCATTCCAGTTGTA 0: 1
1: 0
2: 0
3: 17
4: 223
Right 1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG 0: 1
1: 1
2: 2
3: 20
4: 189
1086342112_1086342120 9 Left 1086342112 11:85857353-85857375 CCATTGCCAAGGCTGGCATTCCA 0: 3
1: 3
2: 3
3: 23
4: 219
Right 1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG 0: 1
1: 1
2: 2
3: 20
4: 189
1086342109_1086342120 23 Left 1086342109 11:85857339-85857361 CCATGAGGCAGCTGCCATTGCCA 0: 1
1: 0
2: 8
3: 22
4: 297
Right 1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG 0: 1
1: 1
2: 2
3: 20
4: 189
1086342107_1086342120 30 Left 1086342107 11:85857332-85857354 CCCAGGACCATGAGGCAGCTGCC 0: 1
1: 0
2: 7
3: 32
4: 351
Right 1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG 0: 1
1: 1
2: 2
3: 20
4: 189
1086342108_1086342120 29 Left 1086342108 11:85857333-85857355 CCAGGACCATGAGGCAGCTGCCA 0: 1
1: 0
2: 7
3: 45
4: 376
Right 1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG 0: 1
1: 1
2: 2
3: 20
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086342120 Original CRISPR CTGGAAGGGCGAAACAGAGG AGG Intronic
900926602 1:5710015-5710037 CTGAAAAGGGGACACAGAGGGGG - Intergenic
901176078 1:7300276-7300298 CTGGAAGGGAGGACCAGAGTGGG - Intronic
902373642 1:16019918-16019940 CGGGAAGGGGGAAAAAGGGGAGG - Intronic
903240317 1:21978383-21978405 CTGGAAGGGCGAGAGGAAGGTGG - Exonic
903986791 1:27234657-27234679 CTGGAGGAGATAAACAGAGGAGG + Exonic
904808049 1:33145577-33145599 CCGGAAGAGCTAAACACAGGGGG - Exonic
904948594 1:34217491-34217513 CTGAAAGAGAGAAACAGAGGTGG + Intronic
905793402 1:40802239-40802261 GTGGAAGGGCGAGGCCGAGGCGG + Intronic
907401416 1:54227161-54227183 CTGGAAAGGAGAAGCAGAGAAGG + Intronic
908340388 1:63172469-63172491 CTGGATGATCAAAACAGAGGGGG - Intergenic
908459713 1:64337666-64337688 CTGGAAGGTGGAAACAGATGGGG - Intergenic
911252950 1:95599292-95599314 TTGGAAGAGAGAAACAGAGATGG + Intergenic
913169833 1:116222007-116222029 CTGGAAGGGAGGAAGTGAGGAGG + Intergenic
913489694 1:119367489-119367511 CTGGAAGGGAGAGACAGAGTCGG + Intergenic
915108480 1:153548627-153548649 CTGGGAGGGCTACTCAGAGGAGG - Intronic
915939051 1:160106863-160106885 CTGGAAGGGAGAGACTGATGGGG - Intergenic
916200107 1:162263340-162263362 ATGGAAGGGCAAGAGAGAGGGGG + Intronic
917448136 1:175123985-175124007 CTGGAAGATGGAAACAGAAGAGG - Intronic
920765702 1:208831705-208831727 CTGGAAGGGTGTAGCAGAGAGGG + Intergenic
922637274 1:227186510-227186532 CAGGAAGGGAGGTACAGAGGTGG + Intronic
923014837 1:230118777-230118799 GAGGAAGGGCGTCACAGAGGAGG - Intronic
1064239506 10:13613171-13613193 CTGGAAGTAGGAAACAGAGAAGG - Intronic
1065111549 10:22444861-22444883 CTGGGAGGGAAAAAAAGAGGTGG + Intronic
1066511533 10:36103805-36103827 CTGGAAAGGCAAAACTGTGGAGG + Intergenic
1067048481 10:42999137-42999159 CTGGAGGGGCCAATCACAGGTGG - Intergenic
1067455326 10:46415018-46415040 GTGGAAGGGAGAAGCAGAAGAGG + Intergenic
1067631878 10:47969617-47969639 GTGGAAGGGAGAAGCAGAAGAGG - Intergenic
1068962125 10:62877459-62877481 CTGGAGAGGGGAAACAGAAGGGG + Intronic
1073441697 10:103556145-103556167 CTGGAGGGGTTAAAGAGAGGGGG + Intronic
1075095620 10:119468914-119468936 CTGGAAGGGAGTAAGAGAGGAGG + Intergenic
1078210220 11:9264788-9264810 CTGGAGGGGGGAAACGGATGAGG - Intronic
1078525242 11:12095896-12095918 CTGGAAGGGGCACACAGTGGGGG - Intronic
1079092903 11:17493296-17493318 TTGGAATGGGGAAACAGAGACGG + Intergenic
1081726683 11:45334666-45334688 CTGGCAGGGCAAAATAGATGAGG + Intergenic
1083257501 11:61505739-61505761 CTGGGAGGGGGAAGCAGGGGAGG - Intergenic
1083857297 11:65399595-65399617 AGGGAAGGGAGAAACAGAGGTGG - Intronic
1084115642 11:67041573-67041595 CTGGAAGGGCGTAACAGGAGGGG + Intronic
1084383786 11:68829522-68829544 CTGGAAAGGCAGAAAAGAGGAGG + Intronic
1086330530 11:85749494-85749516 CTGGGAGTGGGAAAAAGAGGGGG + Intronic
1086342120 11:85857385-85857407 CTGGAAGGGCGAAACAGAGGAGG + Intronic
1087723581 11:101694076-101694098 ATGGAAGGGCTCTACAGAGGTGG + Intronic
1090145839 11:124321623-124321645 CTGGAAAGGTGAGACAGAGCTGG + Intergenic
1090609922 11:128461917-128461939 CTGGGAGGGCAAAAAAGAGGTGG - Exonic
1091058541 11:132441019-132441041 CGGGCAGGGAGAAACAGATGAGG + Intronic
1092632545 12:10398034-10398056 CTGGAGGAGAGAAAAAGAGGGGG - Intronic
1093479206 12:19587185-19587207 ATGGAAGGGAGAAAGAGAAGAGG + Intronic
1096709211 12:53443195-53443217 CTGGAAGGGCTAGGGAGAGGAGG - Intronic
1096736066 12:53655857-53655879 AAGGAAGGAAGAAACAGAGGAGG + Intronic
1096748034 12:53741226-53741248 CTGGGAGGGTGATAAAGAGGTGG + Intergenic
1097294019 12:57943764-57943786 GTGGAAGGGCCACACAGTGGAGG + Intronic
1100316431 12:93448983-93449005 CTGAAAGGGTGACACACAGGCGG - Intergenic
1102888422 12:116538952-116538974 CTGGATGGTTGAAATAGAGGAGG - Intergenic
1103566621 12:121819381-121819403 CTGGATGGGGGACACAGACGAGG - Intronic
1104325023 12:127787484-127787506 CTGGAAGGGCGAGAAGGTGGAGG - Intergenic
1104475718 12:129068900-129068922 CTGCAAGGGCAAAACAAAGGGGG + Intergenic
1105618445 13:22043036-22043058 TTAGAAGGGCACAACAGAGGTGG - Intergenic
1106090401 13:26587363-26587385 CTGAAAGGGCTACACAGTGGAGG + Intronic
1109276659 13:60311410-60311432 CTGGAATGGAGGAAAAGAGGAGG + Intergenic
1110625663 13:77652978-77653000 CTGGAAAGGGGAAGCAGAGCTGG - Intergenic
1112503390 13:99958715-99958737 CAGGAACGACGAAAGAGAGGGGG + Intergenic
1113757401 13:112822804-112822826 CTGGAAAGGCTAAAGAGGGGTGG - Intronic
1115959940 14:38824364-38824386 CTAGAAGGGAGAAAGGGAGGAGG - Intergenic
1118356406 14:65017430-65017452 CTGGAAGAGAGAATCACAGGGGG + Intronic
1119583618 14:75811106-75811128 GTGGGAGGGAGAAATAGAGGGGG + Intronic
1122986531 14:105214205-105214227 CTGGAAGGGGGACAAAGTGGGGG - Intronic
1123981348 15:25607418-25607440 CGGGAAGGGGCAAACAGCGGAGG - Intergenic
1128913294 15:71536355-71536377 GTGGAAGGGCCAGGCAGAGGAGG - Intronic
1129208939 15:74054265-74054287 GTGGTAGGGCGAGGCAGAGGTGG + Intergenic
1129376823 15:75138737-75138759 CTGGAAGGGGGACACAGGGAAGG + Intergenic
1130395155 15:83494965-83494987 CTGGAAGGGGGAGAGGGAGGAGG - Intronic
1131809712 15:96160355-96160377 TTGGAAGGGGGAAAAAGATGAGG - Intergenic
1131829458 15:96344846-96344868 CTGAGAGGAGGAAACAGAGGAGG - Intergenic
1132498650 16:275334-275356 CTGCACGGGAGAGACAGAGGTGG + Intronic
1134636360 16:15794847-15794869 CTGGAGGGCCACAACAGAGGAGG + Intronic
1136985802 16:35103113-35103135 CTGGAAGGGAGATAGAAAGGAGG - Intergenic
1137242893 16:46673417-46673439 CTGGAAGGGAGATAGAAAGGAGG + Intronic
1138125145 16:54432599-54432621 ATGGCTGGGCGGAACAGAGGGGG + Intergenic
1138433462 16:56983914-56983936 TTGGAAGGGCTGAAAAGAGGTGG - Intergenic
1141164320 16:81650371-81650393 CTGGAAGGAGGAAAGAAAGGTGG + Intronic
1141859292 16:86705517-86705539 CTGGCAGTGAGATACAGAGGTGG + Intergenic
1142743052 17:1941806-1941828 CTGGCAGGGGGTACCAGAGGCGG - Intronic
1142765861 17:2063895-2063917 CTGGCTGAGCCAAACAGAGGAGG - Intronic
1144777333 17:17791473-17791495 CAGGAAGGGACAAAGAGAGGGGG - Intronic
1145835749 17:27953034-27953056 GTGGGAGGGGGAAAAAGAGGTGG - Intergenic
1145890418 17:28410933-28410955 CTAGAAGTGAGACACAGAGGTGG - Intergenic
1147186429 17:38715799-38715821 CTGGAAGGGCCCCCCAGAGGAGG - Exonic
1147332712 17:39708298-39708320 CTGGGAGGGGGAAGCAGAGTGGG - Intronic
1147413411 17:40270488-40270510 CTGGAATGGCAAAATAGAGCAGG - Intronic
1147686227 17:42288334-42288356 CTGCAAGTGCGCAACAGCGGCGG - Exonic
1150803068 17:68296943-68296965 CTGGCAGGGCGAGGCAGAGCAGG + Intronic
1151701141 17:75743183-75743205 CTGGAAGGGCCAGGCAGAGGAGG - Intronic
1152304156 17:79511542-79511564 CAGGAAGGGCTTAATAGAGGAGG + Intronic
1154242796 18:12667886-12667908 CAGTAAGGGAGAAACAAAGGGGG + Intronic
1155519045 18:26651152-26651174 GTGGCAGGGAGATACAGAGGTGG + Intronic
1156325261 18:36069006-36069028 TTGGGAGGCCGACACAGAGGAGG - Intergenic
1157145317 18:45156766-45156788 ATGGAAGGAAGAAAAAGAGGGGG - Intergenic
1161500276 19:4610526-4610548 CTGGGAAGGGGAGACAGAGGAGG + Intergenic
1163275601 19:16282354-16282376 CTTGAAAGCCGAAACACAGGTGG + Intergenic
1164050894 19:21585369-21585391 CTGGAAGGTCCAGACAGATGTGG + Intergenic
1164610177 19:29626490-29626512 CTGGAACAGAGACACAGAGGAGG + Intergenic
1164732949 19:30519643-30519665 CTGGAAGGGCAGGTCAGAGGTGG + Intronic
1167279996 19:48561503-48561525 CTGGAAGGGAGAGAGAGAGGAGG + Intronic
1167780042 19:51593217-51593239 CTGGAAGGGTGAAACTAAGCGGG - Intergenic
1168150950 19:54448450-54448472 CTGGAAGGGCGCAGGGGAGGGGG - Intergenic
925099269 2:1231630-1231652 CTGTAAGAAGGAAACAGAGGAGG - Intronic
926365944 2:12133303-12133325 GTGAAAGGGGGAAACAGAAGAGG - Intergenic
927488035 2:23502617-23502639 CTGGAAGGGCCAAACACGAGGGG - Intronic
929667803 2:43846888-43846910 CTGGTAGGGAGAAAGAAAGGTGG - Intronic
930249070 2:49014948-49014970 CTGGAAGGGAGAGATAGAGTTGG + Intronic
935918501 2:107985140-107985162 CTGACAGAGCGAAACAGAGATGG - Intergenic
937408058 2:121649076-121649098 CTGGAAAAGGGAAACAGAGAGGG + Intronic
937932632 2:127218898-127218920 CACGAAGGGCGCAACGGAGGTGG + Intronic
939184897 2:138848678-138848700 CTGCAAGAGAGAAACAAAGGGGG - Intergenic
939189764 2:138902404-138902426 CTGGAAGGGCGAAACAGACGAGG - Intergenic
939884287 2:147664443-147664465 CTGAAAGGGAGAAAGTGAGGAGG - Intergenic
940135138 2:150426951-150426973 ATGGAAGGGTGAGAAAGAGGTGG - Intergenic
942138640 2:172955330-172955352 CTGAAAAGGAGAAACAGAGACGG - Intronic
944062456 2:195583707-195583729 CTGGAAGGGAGAAACAGACGAGG - Intronic
945976629 2:216276213-216276235 ATGGAAGGGGGAAACAGTGGAGG - Intronic
946164063 2:217853189-217853211 CAGGAAGGGCAAAAGAGAGACGG + Intronic
946327165 2:218990683-218990705 CTGGAAGGGAGGAAATGAGGAGG - Intronic
947807041 2:232976218-232976240 GTGGAAGGGAGCAACAGAAGAGG - Intronic
948149568 2:235734309-235734331 CTGGAAGGGAGAAAGACAGGAGG - Intronic
948756852 2:240165117-240165139 CTGGAAGGGCGGGACAGTGGTGG + Intergenic
948826059 2:240573923-240573945 CTGGAAGGAGGAGTCAGAGGGGG + Intronic
1170127025 20:12975232-12975254 CTAGAAGGAGGAAACTGAGGAGG - Intergenic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1172621367 20:36320279-36320301 GGGGAAGGGGGACACAGAGGAGG - Intronic
1173434087 20:43016925-43016947 CTGAAAGGGAGAAACAGAGATGG - Intronic
1175746620 20:61461471-61461493 CTGGAAGGAAGAGACTGAGGGGG + Intronic
1175973979 20:62701249-62701271 GTGGAAGGGTGAAGCAGAGAAGG - Intergenic
1182477445 22:30583875-30583897 CAGGAAGGGGGAAGCAGAGAAGG + Intronic
1183298061 22:37043726-37043748 CTCGAGGGAGGAAACAGAGGGGG + Intergenic
1183386974 22:37520191-37520213 CTGCCAGGGAGGAACAGAGGAGG + Intergenic
1184093743 22:42305647-42305669 CTGGAAGGACGAATGGGAGGTGG - Intronic
949943537 3:9172818-9172840 CTAGAAGGGTGAGACAGAGACGG + Intronic
950756654 3:15178790-15178812 CTGTAAGGGAGTAACAGAAGTGG - Intergenic
953033533 3:39192760-39192782 CTGGGGAGGGGAAACAGAGGGGG + Intergenic
954369173 3:50161237-50161259 CAGGAGGGGCAAAACAGAGAGGG + Intronic
954656722 3:52198418-52198440 CCGAAAGGGGGAAACTGAGGCGG - Intronic
954802434 3:53194881-53194903 CTGCAAGGGCCAAACAGAGCTGG + Intergenic
955337780 3:58101203-58101225 CAGGAAGGAGGAACCAGAGGAGG + Intronic
957253912 3:77812170-77812192 ATGGAAGGGCAAAAGAGAGAGGG + Intergenic
960435588 3:117622591-117622613 CTGCAAGGGGGAAAAAAAGGAGG + Intergenic
961219600 3:125189381-125189403 CTAGATGGGTGAAAGAGAGGAGG - Intronic
963383540 3:144561005-144561027 CTGGAAGGGCACAAAAGAGGAGG + Intergenic
965131846 3:164710805-164710827 CTGCAAGGGTGGCACAGAGGTGG - Intergenic
965737631 3:171838411-171838433 CAGGAAGAGAGAAACAGTGGGGG - Intergenic
966933659 3:184691707-184691729 CTGGAAGGAATAAACTGAGGAGG - Intergenic
967081588 3:186054695-186054717 CTTGAAGGGTGAAGCGGAGGAGG - Intronic
968767649 4:2482170-2482192 CTCGAAGGGCACACCAGAGGGGG - Intronic
969285551 4:6200079-6200101 GTGGAAGGGGGACCCAGAGGGGG + Intronic
969495339 4:7523116-7523138 CTGGAAGGAAGAAAGGGAGGAGG - Intronic
971478444 4:27093370-27093392 CTGGCTGGGATAAACAGAGGCGG + Intergenic
972436937 4:39044445-39044467 CTGGAAGGCCGTGAGAGAGGCGG - Intergenic
976421351 4:84848064-84848086 CTAGAAGGAGAAAACAGAGGAGG + Intronic
977313744 4:95418886-95418908 GGGGAAGGGCAGAACAGAGGAGG - Intronic
981884049 4:149651293-149651315 CTGGAAGGTGGAAATAGATGAGG + Intergenic
984390819 4:179129753-179129775 CTGGAAAGGCCAAAAAGAAGAGG - Intergenic
984995165 4:185423842-185423864 CAGGAAGGGAGAAAGAGAGCGGG + Intronic
986343700 5:6814848-6814870 CTGGAAGCTAGAAACAGGGGTGG - Intergenic
986518891 5:8592787-8592809 CTGGAAAGGGGAAGAAGAGGTGG + Intergenic
992185565 5:74241344-74241366 CTGGAACGGCCAAAGAGGGGTGG - Intergenic
993437171 5:87912191-87912213 CAGGTAGGTTGAAACAGAGGTGG - Intergenic
993646845 5:90473695-90473717 AGGGAAGGGTGAAACAGAAGTGG + Intronic
1000193250 5:158933895-158933917 GTGGAAGTGCAAAGCAGAGGAGG - Intronic
1000292450 5:159883156-159883178 TTGGAAGGGGGAAAAAGAGAAGG - Intergenic
1001446697 5:171790772-171790794 CTGGAAGGCAGACACAGAAGTGG - Intronic
1002295229 5:178227020-178227042 CTGGGAGAGCGAGCCAGAGGGGG + Intronic
1002570122 5:180135474-180135496 CTGGAAGGGGGAAACGTGGGCGG - Intronic
1005494307 6:26375333-26375355 CTGGGAGGGCTAAAAAGGGGAGG + Intronic
1006755658 6:36413045-36413067 CAGGGAGGGTGAAACAGAGGAGG + Intronic
1007752542 6:44079258-44079280 CTGTAAGGGAGAAAAGGAGGAGG - Intergenic
1010172210 6:72987257-72987279 TTGGAAGGAGGAAACAGAGACGG + Intronic
1011398602 6:86936851-86936873 GTGGAAGGGGGGAAGAGAGGTGG - Intergenic
1012861905 6:104570380-104570402 CTGGAAGGGGAAGACAGAGTCGG - Intergenic
1013190480 6:107800871-107800893 CTGGCAGTGTTAAACAGAGGAGG + Intronic
1013614687 6:111830958-111830980 GTGGAAGTGCAAAACAGAAGGGG + Intronic
1014398236 6:120953285-120953307 CTGGAAGGAGGAAACGGAGTGGG + Intergenic
1015908110 6:138138255-138138277 CTAGAAGGGAGAAACATGGGTGG - Intergenic
1017484895 6:154893435-154893457 TTGGGAGGGAGAAAAAGAGGTGG - Intronic
1018040295 6:159915862-159915884 CTGGAAGGGCGAAGGAGCCGTGG + Exonic
1018488043 6:164262511-164262533 CTGCATAGGCGAAACAGTGGTGG + Intergenic
1018721123 6:166573258-166573280 CTGGAAGCTCTAACCAGAGGTGG - Intronic
1019299209 7:295172-295194 CTGGCTGGGCGACACTGAGGAGG - Intergenic
1022298893 7:29083831-29083853 CAGGAAAGGCCAAGCAGAGGAGG - Intronic
1022832161 7:34078962-34078984 CTGGAAGGGCGAGGCAGGGGAGG - Exonic
1026840652 7:73668418-73668440 CTGTAAGGGCCAGAAAGAGGAGG + Intronic
1027236913 7:76303675-76303697 CTGGTAGGGATTAACAGAGGGGG - Intronic
1028986367 7:97012237-97012259 CAGGAAAGGCGAAACAAAAGAGG + Intergenic
1029728292 7:102423034-102423056 GTGGAAGGGAGCAACAGAGGAGG - Intronic
1031439263 7:121773027-121773049 CTGGAAGGGCTATTCTGAGGAGG - Intergenic
1032016893 7:128385799-128385821 CTGGAAGGAGGCAACAGTGGGGG + Intergenic
1032341987 7:131082508-131082530 AAGAAAGGGAGAAACAGAGGTGG - Intergenic
1039318258 8:36397643-36397665 CTGGAAGGGGACAAAAGAGGAGG - Intergenic
1041854475 8:62435033-62435055 CAGACAGGGAGAAACAGAGGAGG + Intronic
1044506149 8:93022249-93022271 GTGGAAGGGGGAGACGGAGGTGG + Intergenic
1046094406 8:109540056-109540078 GTGGAAGGGCGAAAGGAAGGTGG - Intronic
1047024987 8:120814482-120814504 CTGGGAGGGAGACACTGAGGAGG + Intergenic
1050064506 9:1744731-1744753 TGAGAAGGGTGAAACAGAGGAGG - Intergenic
1050274968 9:3987193-3987215 CTGGAAGGGCTCAACAGTAGAGG + Intronic
1052739088 9:32376119-32376141 CTGGAAGGGGGATGCAGATGAGG + Intergenic
1052740081 9:32384566-32384588 CGGGAAGGGCGGAGCAGGGGCGG - Intergenic
1053483303 9:38432566-38432588 CTGGAAGGATGATACAGAAGGGG + Intergenic
1056507124 9:87268034-87268056 ATGGAAGGGCGGAAGAGAGGGGG + Intergenic
1058070496 9:100596835-100596857 CTGGAATGCAGAAACTGAGGAGG - Intergenic
1061101791 9:128497794-128497816 CTGGCAGGGCAGAGCAGAGGTGG - Intronic
1186746166 X:12571642-12571664 CTGGAAGGGGAAGAAAGAGGAGG - Intronic
1189761506 X:44326230-44326252 CTGGAAAGGGGAAGGAGAGGAGG + Intronic
1190789079 X:53683114-53683136 ATGGAAGGGGGAGACAGAGCGGG + Intronic
1194374796 X:93118967-93118989 CGGGAAGGGAGAAAAAGAGAGGG + Intergenic
1195867112 X:109444899-109444921 CTGTGAGGGTGAAACAAAGGTGG + Intronic
1200682818 Y:6233030-6233052 CGGGAAGGGAGAAAAAGAGAGGG + Intergenic