ID: 1086342859

View in Genome Browser
Species Human (GRCh38)
Location 11:85865029-85865051
Sequence TAGAGTAAACAAAAGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086342855_1086342859 -7 Left 1086342855 11:85865013-85865035 CCAGAGGTACCTTATCTAGAGTA 0: 1
1: 0
2: 1
3: 4
4: 90
Right 1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG 0: 1
1: 0
2: 2
3: 15
4: 294
1086342853_1086342859 6 Left 1086342853 11:85865000-85865022 CCAGTATTAAGTCCCAGAGGTAC 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG 0: 1
1: 0
2: 2
3: 15
4: 294
1086342854_1086342859 -6 Left 1086342854 11:85865012-85865034 CCCAGAGGTACCTTATCTAGAGT 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG 0: 1
1: 0
2: 2
3: 15
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086342859 Original CRISPR TAGAGTAAACAAAAGTAGGG AGG Intronic
902584786 1:17432092-17432114 AAGAGAAAAAAAAAGTTGGGGGG + Intronic
903467447 1:23561753-23561775 TAGAGGAAGGAAAAGAAGGGAGG - Intergenic
904271990 1:29356205-29356227 TGGAGTAAGCAAAAGTAGGGTGG - Intergenic
905932445 1:41799024-41799046 TGCAGTAAAGAAAAGGAGGGAGG - Intronic
909509256 1:76432751-76432773 AAGAGAATACAAAAGTAGGCTGG - Intronic
909992546 1:82240449-82240471 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
910977234 1:92919643-92919665 TGGAGTAAATAAACGTAAGGAGG - Intronic
911149211 1:94580679-94580701 GAGAATAAAGAAAACTAGGGTGG - Intergenic
912740633 1:112192028-112192050 TAAAATAAACCAAAGGAGGGTGG + Intergenic
912789232 1:112635374-112635396 TAAAGTATACAAAACTGGGGTGG + Intronic
913544121 1:119850176-119850198 TATAGTAAAAATAATTAGGGAGG - Intergenic
914320651 1:146556412-146556434 TAGAGCAAACTGAAGAAGGGTGG - Intergenic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
916444717 1:164861699-164861721 TGGAGTAAATCAAGGTAGGGTGG + Intronic
916688445 1:167169002-167169024 AAGAGTTAAAAAAAGTGGGGAGG + Intergenic
917262961 1:173189639-173189661 TTAAGTAAAAAAAAGTTGGGGGG + Intronic
920770518 1:208880704-208880726 GAAAGAAAACATAAGTAGGGAGG + Intergenic
921537231 1:216366704-216366726 TAGTTTAAATGAAAGTAGGGTGG - Intronic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
922467477 1:225854068-225854090 TAGAGGAAAACAAAGCAGGGAGG + Intronic
922912326 1:229228196-229228218 TACAGTAAACAAAAGGCAGGTGG + Intergenic
923198776 1:231692213-231692235 CAGAGTAAAGAAAGGAAGGGAGG - Intronic
923420168 1:233806213-233806235 TGGAAAAAGCAAAAGTAGGGAGG + Intergenic
924637619 1:245803703-245803725 TAGAGTTAACAAAAGCTGGAAGG + Intronic
1064555531 10:16543500-16543522 TGAAGAAAACAAAAGCAGGGAGG + Intergenic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1069043194 10:63716111-63716133 TTGAGAAAACAAAAGCAGGAAGG + Intergenic
1070205458 10:74255097-74255119 TATAGAAAACAATAGTAGGTTGG + Intronic
1071151938 10:82646194-82646216 CATCGTAAACAAAAGTAGTGGGG + Intronic
1072133589 10:92521177-92521199 TAGAAAAACCAAAATTAGGGAGG + Intronic
1072289069 10:93945952-93945974 TAGAGCAAACCAAAGCAGAGAGG + Intronic
1073241556 10:102062154-102062176 TAGAATATAAAAAAGTAGGCAGG + Intergenic
1073446867 10:103586115-103586137 TTGAGTTAAGAAAAGAAGGGAGG + Intronic
1075860939 10:125675677-125675699 GAGAGTGAGGAAAAGTAGGGTGG - Intronic
1077717085 11:4592433-4592455 TAGGGTACACAAAAGTATGCAGG + Intergenic
1079377172 11:19903838-19903860 TTGAGGAAACAAATGTGGGGAGG - Intronic
1079484571 11:20922068-20922090 TAGAGTGAACAAAAAGAAGGAGG - Intronic
1079919308 11:26412361-26412383 TTGACTAGACAAAAATAGGGAGG + Intronic
1080330412 11:31130884-31130906 TAAAGAAAACAAAATTAGGCCGG + Intronic
1081280069 11:41198620-41198642 GAGAGGAAAAAAAAGTATGGAGG + Intronic
1083054223 11:59804268-59804290 AAGAGGAAACAGATGTAGGGTGG - Intergenic
1084819692 11:71677299-71677321 TAAAATAAACAAAAATAGGGCGG + Intergenic
1085620541 11:78034849-78034871 GAGAGTGAATAAAAGCAGGGTGG - Intronic
1086326757 11:85709236-85709258 TAAAGTAATCAAGAGGAGGGAGG - Intronic
1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG + Intronic
1086571058 11:88285130-88285152 TAGAATAAATAAAAGAAGGGTGG - Intergenic
1086809271 11:91285520-91285542 AAGTGTAAAAAAAAGAAGGGAGG - Intergenic
1086907403 11:92433528-92433550 GAGGGTGAGCAAAAGTAGGGTGG - Intronic
1088117479 11:106328925-106328947 TAGAGTAAAATAAAATAAGGTGG + Intergenic
1089843215 11:121436907-121436929 ATGATAAAACAAAAGTAGGGAGG + Intergenic
1090134392 11:124181981-124182003 TAGAGAAAACAAAAGAAAAGAGG - Intergenic
1090321049 11:125844258-125844280 GAGAGTGAGCAAAAGCAGGGTGG + Intergenic
1090718568 11:129452351-129452373 GAGAGTGAACCAAACTAGGGGGG + Intergenic
1091662521 12:2395185-2395207 TAGAGAAAAGAAAAGAAGGCTGG - Intronic
1093487925 12:19672683-19672705 TAGACTAATCAAAAGTGGGAAGG + Intronic
1093686512 12:22061107-22061129 TACAGTAAGTAAAAGTAGTGTGG - Intronic
1094801007 12:34035996-34036018 AAGAGTAGACAAAAGAAGGCAGG - Intergenic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097337350 12:58397732-58397754 TAGAGTCAACAAACATGGGGGGG - Intergenic
1097357869 12:58621677-58621699 TAGAGTAATCAATAATATGGAGG - Intronic
1097910722 12:64966253-64966275 GAGAATGAAGAAAAGTAGGGAGG - Intergenic
1098201908 12:68064678-68064700 GAGAGCAAGGAAAAGTAGGGTGG - Intergenic
1098309561 12:69134752-69134774 TAGATTAAACAAAATTAAGCAGG + Intergenic
1098840077 12:75467402-75467424 TAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1099206846 12:79738368-79738390 AAGCATAAACAAAAGTGGGGTGG - Intergenic
1099224169 12:79949346-79949368 TAGAGAAAATTAAAGCAGGGAGG - Intergenic
1099366444 12:81771085-81771107 GAGAGTCAACTAAAGTAGTGGGG + Intergenic
1100300079 12:93298830-93298852 TAAAGGAAACAAAAATCGGGGGG + Intergenic
1100649010 12:96564165-96564187 TAAAGTCAACAGAAGTAGGTTGG + Intronic
1101205642 12:102484324-102484346 TAGGGAAAACAGAAATAGGGAGG + Intergenic
1101856386 12:108446927-108446949 TAGCAAAAAAAAAAGTAGGGAGG + Intergenic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1104628629 12:130380337-130380359 AAAAGTAAAAAAAAGTTGGGGGG - Intergenic
1105694612 13:22875568-22875590 TGGAAGAAACAAAAGGAGGGAGG + Intergenic
1106622056 13:31380157-31380179 TAGTGTGAACAACAGTAAGGTGG - Intergenic
1107136814 13:36954019-36954041 TTGAGTAAAAAAGAGTGGGGTGG + Intronic
1107661463 13:42643464-42643486 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
1108921995 13:55687510-55687532 TAGAGTCACCAAAAGGAGCGTGG - Intergenic
1109994516 13:70107061-70107083 TTGAGTAATCAAAACCAGGGTGG + Intronic
1111962303 13:94825007-94825029 TTGAGGAAAAAAAAGTAAGGTGG - Intergenic
1115213172 14:30988826-30988848 TAGTGTGAACAAAAGTTGGATGG - Intronic
1116070670 14:40040905-40040927 TAGAAGAAAGAAAAGAAGGGAGG - Intergenic
1116428572 14:44820165-44820187 GAGAGCAAAGAAAAGTAGGCTGG + Intergenic
1116609275 14:47046165-47046187 TAAAGTAAATAAAAGAAAGGGGG + Intronic
1116649907 14:47576907-47576929 AAAAATAAACAAAATTAGGGGGG - Intronic
1116925333 14:50629007-50629029 TAGAATAATAAAAAGTAGGCTGG - Intronic
1117063774 14:51988895-51988917 TAGAGTAAGCAAAAGTGATGAGG + Intergenic
1117146478 14:52841148-52841170 TAGAATAAACAAAAGAGGGCCGG - Intergenic
1117543381 14:56770294-56770316 TAGTTTAAACAAAAGTGGGAAGG - Intergenic
1117698312 14:58388737-58388759 TATAGTAATCAAAAACAGGGTGG + Intergenic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1118766813 14:68915415-68915437 TGGAGAAAACCAAAGCAGGGAGG - Intronic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1124026252 15:25968906-25968928 CAGAGTATACAAAATTAGAGAGG + Intergenic
1126612563 15:50544426-50544448 TAGAGTAAGTAAAAGTGGGAAGG - Intronic
1127106162 15:55618670-55618692 TCAAGAAAACACAAGTAGGGTGG + Exonic
1127292274 15:57581323-57581345 TAGGTTAAACAAAAGCAGGCAGG - Intergenic
1127765800 15:62184906-62184928 CAGAGTAATCAAATGTTGGGAGG - Intergenic
1131275574 15:90977888-90977910 AAGAGTAAACATAAATAAGGAGG - Intronic
1131570124 15:93526138-93526160 CAGAGTAAACAAAAATAGAAGGG - Intergenic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1131731650 15:95287879-95287901 TAAATAAAACAAAAGTGGGGCGG + Intergenic
1136180633 16:28549270-28549292 TATTGAAAATAAAAGTAGGGGGG + Intergenic
1139013751 16:62664780-62664802 TTGAGTAAACAAAATTAGGTTGG - Intergenic
1140012882 16:71153693-71153715 TAGAGCAAACTGAAGAAGGGTGG + Intronic
1142931967 17:3292731-3292753 CAGAGTAAACAAGTGTAGTGTGG - Intergenic
1144387100 17:14758906-14758928 TGGAGAAAACAAAGGAAGGGGGG + Intergenic
1146305497 17:31726965-31726987 TGGAGAAAAAAAAAGTGGGGAGG - Intergenic
1147756669 17:42773151-42773173 TAGAGGAAACAAAGGTAGGCTGG + Intergenic
1149080203 17:52647077-52647099 TAGAGAAGACAAAATAAGGGAGG - Intergenic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1152135701 17:78501966-78501988 TACTGTAAACAAAAGCATGGTGG - Intronic
1153132189 18:1867220-1867242 TAGAGTAAATAAAAGAAGACAGG + Intergenic
1155397738 18:25404134-25404156 TAGAGTACACACAGGTAGGCTGG + Intergenic
1155943124 18:31819628-31819650 TAGGCTAAACAAAAGAAAGGGGG - Intergenic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1159346856 18:67216805-67216827 TAGTGTAAAACAAAGTAGGAGGG - Intergenic
1164700336 19:30280249-30280271 GAGGGAAAACAAAAGTAAGGGGG - Intronic
1164811721 19:31162769-31162791 AAGATTAACCCAAAGTAGGGAGG + Intergenic
1166931590 19:46304478-46304500 TACAGTAACGAAAAGTTGGGCGG - Intronic
1167002505 19:46754337-46754359 AAGAAAAAACAAAAGTGGGGTGG - Intronic
925948374 2:8887908-8887930 TAGAGTAAGGAAATGGAGGGAGG - Intronic
926411496 2:12607721-12607743 GAGACTGATCAAAAGTAGGGAGG - Intergenic
930326140 2:49921322-49921344 GAGAGGAAAAAAAAGTATGGAGG - Exonic
933150977 2:78914925-78914947 TAGAGGAAACAAAATCAGAGAGG - Intergenic
933177972 2:79197290-79197312 TAGAGTGAACAAAAGTGGTAAGG + Intronic
934081243 2:88469368-88469390 TACAGTAGAGTAAAGTAGGGTGG - Intergenic
935693488 2:105750556-105750578 TAGAGTAGTCACAAGTAAGGAGG + Intronic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
937257276 2:120564468-120564490 TACATTAAACAAGAGGAGGGCGG + Intergenic
938650297 2:133376032-133376054 TACAGGAAACAAAAGTGTGGTGG + Intronic
939938203 2:148317613-148317635 TAGAGACAACAAAAGGTGGGAGG - Intronic
940016108 2:149106835-149106857 GAGAGTAAAAAAAAGAGGGGAGG - Intronic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
944635321 2:201670904-201670926 AAGGGTAAACCAAAGCAGGGTGG + Intronic
945358066 2:208861972-208861994 TAGAGTAAACACAATCAGGTGGG + Intergenic
945452283 2:210007540-210007562 TAGTGTAAAAAAAAGATGGGAGG - Intronic
945509749 2:210686589-210686611 AAGAGTAAACAAGAGCAGGAGGG + Intergenic
947921390 2:233877942-233877964 TAGAGTAAGAAAAGGGAGGGGGG - Intergenic
1169768569 20:9176163-9176185 TAGAGGAAACAATAGCATGGAGG - Intronic
1169982680 20:11404172-11404194 TAGACTAGACACAAGTAGAGTGG + Intergenic
1170269034 20:14503238-14503260 TAGAGTACACAAGGGAAGGGTGG + Intronic
1170723738 20:18907335-18907357 TAGAGTGGACAAAATTATGGAGG - Intergenic
1171415900 20:24980197-24980219 TGGAGGAAACCAAAGTAGAGAGG + Intronic
1173058486 20:39639078-39639100 TGCAGAAAACAAAAGTATGGTGG + Intergenic
1174267395 20:49341519-49341541 TTGAGTAAAGAAAAGAAGGCTGG - Intergenic
1174626252 20:51916876-51916898 TAAAGAAAAAAAAAGCAGGGTGG + Intergenic
1175590516 20:60186989-60187011 TACAGTAATCAAAAGAATGGTGG - Intergenic
1177508209 21:22046108-22046130 TAAAGTACAAAAAAGTAGGAGGG - Intergenic
1177642366 21:23860415-23860437 AATAGTAAACAAAAGTTGTGTGG + Intergenic
1178141866 21:29693432-29693454 AAGAGTAAAAAAAAGTTGAGAGG + Intronic
1178331552 21:31699180-31699202 TAGTGTATAAAAAAGTAGTGAGG + Intronic
1178448976 21:32674381-32674403 TAGAGAAAAATAAAGCAGGGAGG - Intronic
1180904572 22:19400121-19400143 TACAGTATAAAAAAGTAGAGAGG - Intronic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1185166004 22:49262603-49262625 GAGAGTAAGAAAAAGTAGGCTGG + Intergenic
949843512 3:8347112-8347134 TAGAGAAAAGAAAAGTATTGTGG + Intergenic
949985090 3:9534216-9534238 TAAAAAAAAAAAAAGTAGGGGGG + Intronic
952158369 3:30668523-30668545 TACAGCAAACAAAATTAAGGGGG - Intronic
952487880 3:33834076-33834098 GAGAGAACAGAAAAGTAGGGAGG - Intronic
952770660 3:36996992-36997014 TGGAGAAAACTAAAGCAGGGAGG + Intronic
953658012 3:44869516-44869538 TAGAGTGAAAAAAAGTAGAAGGG + Intronic
957307670 3:78479291-78479313 TACAGTAAAGAAAAATAAGGTGG - Intergenic
958120583 3:89282620-89282642 TAAAGTAAATAAAAATACGGGGG - Intronic
958689524 3:97445698-97445720 TAGATTAAAAAAAAATAGAGGGG + Intronic
958874347 3:99598658-99598680 AATAGTAAATAAAAATAGGGAGG + Intergenic
958985352 3:100774345-100774367 CAGAGTAAACACATGTGGGGTGG + Intronic
959705419 3:109334825-109334847 AAGTGTAAATAGAAGTAGGGTGG - Intronic
960766942 3:121142089-121142111 AATAGTAAACAAAAGTGAGGAGG + Intronic
963073628 3:141326443-141326465 TGGAGGGAACAAAAGCAGGGGGG + Intronic
963885625 3:150579211-150579233 AAGAGTAAATAAAAGAAGAGGGG - Intronic
965219091 3:165903293-165903315 GAGAGGAAACAAAAGTAAGTAGG + Intergenic
965450282 3:168830314-168830336 AAAAGTAAACAAATGTAGGCTGG + Intergenic
966374936 3:179286804-179286826 AAGAGGAAACAAAGGTAGGAGGG - Intergenic
966626768 3:182025324-182025346 TAAAGGAAATAAAAGCAGGGTGG + Intergenic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
967063258 3:185891350-185891372 TAAAGGTGACAAAAGTAGGGTGG - Intergenic
967292743 3:187937069-187937091 TAGAGTAAAAATAAAGAGGGAGG - Intergenic
967456483 3:189692447-189692469 CATAGTAAATAAAAGTGGGGAGG - Intronic
968049038 3:195641639-195641661 TAGAGAAAAATAAAGTAGGTTGG + Intergenic
968098362 3:195947987-195948009 TAGAGAAAAATAAAGTAGGTTGG - Intergenic
968305582 3:197648294-197648316 TAGAGAAAAATAAAGTAGGTTGG - Intergenic
969848597 4:9938993-9939015 TAGAGGACATAAACGTAGGGAGG - Intronic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
971649067 4:29248481-29248503 TGGAGTAAACACAATTTGGGTGG - Intergenic
973600456 4:52537667-52537689 TAGAGTAAGCAGAAGTTGTGAGG + Intergenic
973899389 4:55452167-55452189 TAGAATAGACAAAAGTGGTGAGG + Intronic
974030783 4:56774414-56774436 TAAAGTAAACAAATGTAGTTAGG + Intergenic
974368499 4:60984462-60984484 TGAAGCAAACAAAAGTAGGTGGG + Intergenic
975256332 4:72240057-72240079 AAGATTAAACAAAAGGAAGGAGG + Intergenic
976028179 4:80717197-80717219 TAGGGTAAACTAAGGTGGGGTGG + Intronic
976078014 4:81321320-81321342 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
976152382 4:82105034-82105056 TACAAAAAAAAAAAGTAGGGGGG + Intergenic
976990927 4:91365468-91365490 TAAATTAAACAAAATTAGAGAGG + Intronic
977912413 4:102552856-102552878 TGATGTAAACAAAAGTAGGAAGG - Intronic
979298312 4:119057472-119057494 TAGAGTAACTATAAGTAGGCTGG - Exonic
980071267 4:128244762-128244784 TTCAGTGAACTAAAGTAGGGGGG - Intergenic
980333758 4:131441645-131441667 GAGAACAAAGAAAAGTAGGGTGG - Intergenic
980471677 4:133261417-133261439 TAGAAAAAAAAAAAATAGGGTGG - Intergenic
980512395 4:133811962-133811984 GAAAGCAAACAAAAGCAGGGTGG + Intergenic
980720649 4:136690510-136690532 TAATGTAAACAATAGTACGGAGG + Intergenic
981440756 4:144779113-144779135 TTGAGTAAAAAAAAATTGGGAGG + Intergenic
981596230 4:146425896-146425918 TAGAGGAAGCAGAGGTAGGGAGG - Intronic
983774998 4:171595248-171595270 AAGAGTGAAGAACAGTAGGGTGG - Intergenic
985742606 5:1627485-1627507 TAGAGAAAAATAAAGTAGGTTGG - Intergenic
987261587 5:16209817-16209839 TAAACTACACAAAAGTAGAGAGG - Intergenic
988606550 5:32683545-32683567 GAGAGGAAACAAAAGTTGCGGGG - Intergenic
989192379 5:38683849-38683871 TAGAGTAATCAAATGTCAGGGGG + Intergenic
989300986 5:39893555-39893577 AAAAGTAAACAAAATTAGGTGGG - Intergenic
989473946 5:41852901-41852923 TACAGAAAACAAAAGTAGCTGGG + Intronic
989507946 5:42249032-42249054 TAAAGAAAAAAAAAGTAGGTGGG + Intergenic
990248507 5:53888769-53888791 TAGGGGAAAAAAGAGTAGGGAGG + Intronic
990329997 5:54715880-54715902 TTGAGTAAAGAAATGTAGGAAGG + Intergenic
990429559 5:55720998-55721020 AAGAGTAAGCAAAAGCAGGAGGG + Intronic
992423726 5:76633957-76633979 TAGAATAGCCAAAAGTTGGGGGG - Intronic
993309166 5:86307324-86307346 TAGAGTAAATTCAAGTAGAGAGG - Intergenic
993461093 5:88183023-88183045 TAGAATAAACTAATGTACGGTGG - Intergenic
994141422 5:96345949-96345971 TATTGGAAGCAAAAGTAGGGAGG + Intergenic
994177195 5:96723838-96723860 GACAGAAAACAAAAGTAGGTTGG - Intronic
994723342 5:103405926-103405948 TAGAGGAAATAAAGGTGGGGGGG + Intergenic
995182565 5:109242286-109242308 TAGCTTAAAAAAAAGTATGGAGG + Intergenic
995341829 5:111069695-111069717 AAGAGGAAACAAAAAAAGGGAGG + Intergenic
995749801 5:115442054-115442076 GAGCGTAAGCCAAAGTAGGGTGG + Intergenic
996542201 5:124642202-124642224 GAGACTAAACAAAAATAGGATGG - Intronic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
1001354889 5:171009845-171009867 GAGAGTGATCAAAAGTAGGTAGG + Intronic
1001820759 5:174708417-174708439 TAGAAAAAACAAAAGCAGGTTGG - Intergenic
1003234374 6:4282528-4282550 TAGAGGAAACCAGAGTCGGGGGG + Intergenic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1004673221 6:17816838-17816860 TATAGTAAACATACTTAGGGTGG + Intronic
1005068595 6:21843280-21843302 TAAAGTAAACTTAATTAGGGAGG + Intergenic
1006972869 6:38065016-38065038 GAGAGCAAAGAAAAGCAGGGAGG + Intronic
1007385004 6:41514529-41514551 TGAAGTAAAACAAAGTAGGGGGG - Intergenic
1007478925 6:42137389-42137411 AGGAGTAAACAAAAGTTGGTAGG + Intronic
1008033694 6:46724186-46724208 TGGAGAAAAATAAAGTAGGGAGG - Intronic
1008298318 6:49804989-49805011 GAGAGTGAGGAAAAGTAGGGTGG + Intergenic
1008882915 6:56399752-56399774 TAGAGTAAACAAAATTAACTGGG - Intergenic
1010705451 6:79103352-79103374 TAGTGTAAAAAAAAGCAGCGTGG - Intergenic
1010947178 6:81989062-81989084 TCGAGTAAACAAAAGTATTAAGG + Intergenic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1011199052 6:84814643-84814665 AAGTGTAAAAAAAAGGAGGGGGG - Intergenic
1013720755 6:113025500-113025522 TATAGTAACAAAAAGTATGGTGG + Intergenic
1013762006 6:113529793-113529815 CAGAGTAAGAAAAAGTATGGGGG - Intergenic
1014020719 6:116585557-116585579 TAGAGTAAACAAATAAAGGTAGG - Intronic
1015678057 6:135772474-135772496 AAGAGTAAACATAAGGAAGGTGG - Intergenic
1016423928 6:143913830-143913852 GAGAATGAAGAAAAGTAGGGTGG - Intronic
1018003857 6:159602571-159602593 GAGACTAAACAAGAGCAGGGAGG + Intergenic
1020646117 7:10816254-10816276 TAGAGTAACTAAAAGGAGGATGG + Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1030770364 7:113467562-113467584 TACAGGAAACAAAAGGAGTGTGG - Intergenic
1031469150 7:122148182-122148204 GAGAGAAAACCAAAGTAGGTGGG - Intergenic
1031756517 7:125650363-125650385 TATAGTAAACCAAAATAGTGTGG + Intergenic
1033479595 7:141726527-141726549 TAGACTGAACAAAAGGAAGGAGG - Intronic
1038590403 8:28832200-28832222 GAGAGAAAAGAAAAGAAGGGAGG + Intronic
1039051742 8:33501424-33501446 GAGAGTGAATAAATGTAGGGAGG - Intronic
1039235407 8:35497395-35497417 TTGAGAAAACAGCAGTAGGGAGG - Intronic
1039593079 8:38767180-38767202 TTGAGAAAACAAAACTAGGAAGG + Intronic
1040690969 8:49937956-49937978 TAGGATAAAGAAAAGAAGGGAGG - Intronic
1041131424 8:54706261-54706283 AAAAGTAAACAAAAGGAGGTTGG - Intergenic
1041386569 8:57310345-57310367 TAGAAAATATAAAAGTAGGGTGG + Intergenic
1041744038 8:61186647-61186669 AAGAGAAGACAAAAGAAGGGAGG + Intronic
1042151182 8:65786428-65786450 TAGAATAATCTAAAGTAGGAAGG + Intronic
1042759581 8:72256761-72256783 GAGAGCAAGGAAAAGTAGGGTGG + Intergenic
1042936503 8:74064550-74064572 GAGAGGGAGCAAAAGTAGGGAGG - Intergenic
1043369123 8:79570869-79570891 TAGGGTAAAGAAATGTATGGAGG - Intergenic
1044998113 8:97856244-97856266 TAGAGTAAAAAATAGGAAGGGGG - Intergenic
1046306768 8:112378231-112378253 TATTATAAACAATAGTAGGGAGG + Intronic
1047147917 8:122226421-122226443 AAGAGGAAAAAAAAGTAGAGGGG - Intergenic
1047360157 8:124161813-124161835 TGCAATAACCAAAAGTAGGGTGG + Intergenic
1050235450 9:3574457-3574479 TAATGTTAACAAAAGGAGGGGGG - Intergenic
1052144166 9:25026733-25026755 TAGAATCAACAAAAGAGGGGAGG - Intergenic
1052415006 9:28167145-28167167 TGGAGAAAAGAAAAGTGGGGGGG - Intronic
1052797784 9:32939688-32939710 TAGGAAAGACAAAAGTAGGGAGG + Intergenic
1053100243 9:35365667-35365689 TAGAAGAAACAACAGTAGGTGGG - Intronic
1053608291 9:39682056-39682078 TAGAGTAAACAAAAATGGGTAGG - Intergenic
1053701795 9:40701085-40701107 TATAATAAACAAAAGTAATGTGG - Intergenic
1053866131 9:42438416-42438438 TAGAGTAAACAAAAATGGGTGGG - Intergenic
1054245240 9:62660353-62660375 TAGAGTAAACAAAAATGGGTGGG + Intergenic
1054559368 9:66694884-66694906 TAGAGTAAACAAAAATGGGTGGG + Intergenic
1055235576 9:74118786-74118808 TAGAGGAAAGGAAAGTAGGAAGG + Intergenic
1055508152 9:76969020-76969042 CAGAGTAAACAAAGGTATTGAGG - Intergenic
1056110080 9:83386402-83386424 TAGAGTAAAGGAAAGGATGGGGG - Intronic
1056895338 9:90542016-90542038 AATAGTAAGCAAATGTAGGGTGG + Intergenic
1057619263 9:96620019-96620041 CAGAAGAAACAAAAGTTGGGGGG - Intergenic
1059107491 9:111524367-111524389 AAGAGGAAACAAGAGTAAGGTGG + Intergenic
1185611188 X:1394556-1394578 AAGAGGAAAGAAAAGAAGGGAGG - Intergenic
1185812028 X:3119368-3119390 TAGAAGAAACAAAAATAGGCTGG - Intergenic
1187467603 X:19540912-19540934 TAAAAAAAAAAAAAGTAGGGAGG - Intronic
1189028560 X:37426430-37426452 TAGAGTAAAGAGAAGTAAAGAGG - Intronic
1189253307 X:39618256-39618278 TAAAGAAAACAAAAGTAGGGAGG + Intergenic
1192836010 X:74800407-74800429 TAAAGTAAATAAAAATAGGATGG - Intronic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193087313 X:77458357-77458379 TCCAGAAAACAAAAGTAGAGTGG + Intergenic
1194183027 X:90737185-90737207 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
1194445071 X:93976526-93976548 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1196229380 X:113203229-113203251 TAGAGTGAGGAAAAGTAGGGTGG - Intergenic
1196994597 X:121368015-121368037 TAGAGTAATCAAAAATGAGGGGG + Intergenic
1197032155 X:121829438-121829460 AACAATAAATAAAAGTAGGGTGG - Intergenic
1199035914 X:143050792-143050814 GAGAGTGAACATAAGCAGGGTGG - Intergenic
1199925844 X:152462902-152462924 GAGAATAAACATAACTAGGGAGG + Intergenic
1200529645 Y:4319139-4319161 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
1201269277 Y:12238919-12238941 TAGAAGAAACAAAAATAGGCTGG + Intergenic
1201342728 Y:12951832-12951854 TATAGAAAAAAAAAGTTGGGTGG - Intergenic
1201347796 Y:13004227-13004249 TAAAGTAACAAAAAGTGGGGCGG + Intergenic
1202086043 Y:21137976-21137998 TAAAGAAAAAAAAAGTTGGGGGG - Intergenic
1202303759 Y:23445859-23445881 GAGAATAAAAAAAAGTATGGAGG + Intergenic
1202567051 Y:26224734-26224756 GAGAATAAAAAAAAGTATGGAGG - Intergenic