ID: 1086344106

View in Genome Browser
Species Human (GRCh38)
Location 11:85878333-85878355
Sequence ATGAGGGGGCAGAACTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 442}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086344106_1086344119 29 Left 1086344106 11:85878333-85878355 CCCTCCCAGTTCTGCCCCCTCAT 0: 1
1: 0
2: 3
3: 42
4: 442
Right 1086344119 11:85878385-85878407 CATTATTATAACGTCACTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086344106 Original CRISPR ATGAGGGGGCAGAACTGGGA GGG (reversed) Intronic
900621051 1:3588038-3588060 AGGAGGGGGCAGGACAGGGCAGG + Intronic
900621239 1:3588488-3588510 AGGAGGGGGCAGGACAGGGCAGG + Intronic
900669208 1:3839858-3839880 ATGATGGGGCAGGATGGGGAGGG - Intronic
901078260 1:6569120-6569142 AGAAGGGGGCAGAACAGGAACGG + Intronic
901188552 1:7390121-7390143 GTGACTGGGCAGAAGTGGGAAGG - Intronic
901494974 1:9615586-9615608 ATGAGGGTGCAGGGCTGGGACGG + Intergenic
901598850 1:10406706-10406728 ATTAGGGAGCAGAACAGTGAGGG + Intronic
902077799 1:13801521-13801543 GGCAGGCGGCAGAACTGGGATGG - Intronic
902165184 1:14564389-14564411 ATAAGTGGGCAGCACTGGGTAGG + Intergenic
902449973 1:16490844-16490866 AGGTGGGGGCACAACAGGGAGGG - Intergenic
902752783 1:18528893-18528915 ATGAGGGGCCAGGAAAGGGATGG - Intergenic
904517556 1:31068029-31068051 ATGAAAGAGCAGAAATGGGAAGG + Intergenic
904699764 1:32351462-32351484 GGGAGGGGGCGGAACTGGGTGGG - Intergenic
905206654 1:36346496-36346518 ATGAAAGGGCAGACCTGGGTCGG + Intronic
905213427 1:36390210-36390232 ATGAGAGTGGAGAAATGGGAGGG - Intergenic
905349689 1:37336874-37336896 TTGAAGAGGCAGAAGTGGGAGGG + Intergenic
905622084 1:39457232-39457254 AAGGGGGGGCAGATCTGGAATGG - Intronic
905746309 1:40421582-40421604 ATGAGGCGGGAGCACTGGGGAGG + Intronic
905954242 1:41978870-41978892 GTGAGGGGCAAGGACTGGGAAGG - Intronic
906054739 1:42906667-42906689 ATGAAGGGGTAGAAATGGGAAGG - Intergenic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906445303 1:45891387-45891409 CTTAGGGGGCTGAAGTGGGAAGG + Intronic
907336066 1:53700343-53700365 AGGAAGGGGCAGGAATGGGAGGG + Intronic
907543688 1:55240403-55240425 AGGAGGGGGAAAAACTGGGCAGG - Intergenic
908000429 1:59673458-59673480 AAGTGGGGCCAGATCTGGGAGGG + Intronic
909027761 1:70502692-70502714 CAGAGGGGGCACAGCTGGGATGG + Intergenic
909333082 1:74438509-74438531 ATGAGGATTTAGAACTGGGAGGG + Intronic
909623377 1:77689419-77689441 ATGAGGGACCAGAACTGTAAAGG + Intergenic
909960443 1:81834170-81834192 AAGTGGGGGAGGAACTGGGAGGG - Intronic
909975923 1:82046144-82046166 AAGAGGAGGCAGGACTGGGCAGG - Intergenic
911017927 1:93354653-93354675 ATGAGAGGCCAGAACTTAGAAGG - Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911440597 1:97921144-97921166 CGGAGCGGGCTGAACTGGGAAGG - Intergenic
911994513 1:104747529-104747551 ATGAGGGGATAGCAGTGGGAGGG + Intergenic
912365951 1:109134033-109134055 ATGGGTGGGCGGAAGTGGGAGGG + Intronic
913199427 1:116484058-116484080 ATGTGGGGGCAGGAGGGGGAGGG + Intergenic
913591957 1:120337797-120337819 ATAAGAAGGCAGTACTGGGAAGG + Intergenic
913651399 1:120917349-120917371 ATAAGAAGGCAGTACTGGGAAGG - Intergenic
914169709 1:145211722-145211744 ATAAGAAGGCAGTACTGGGAAGG + Intergenic
914524824 1:148455684-148455706 ATAAGAAGGCAGTACTGGGAAGG + Intergenic
914598852 1:149180149-149180171 ATAAGAAGGCAGTACTGGGAAGG - Intergenic
914641578 1:149611450-149611472 ATAAGAAGGCAGTACTGGGAAGG - Intergenic
914780370 1:150780320-150780342 TTGAGGGGCCAGAAGTGGGAGGG - Intergenic
915089882 1:153416903-153416925 CTGTGGGGGCAGAGCTGGGGAGG - Intronic
915142079 1:153774179-153774201 AAGTGGGGGCAGAACAGGAAGGG - Intergenic
915708732 1:157872654-157872676 ATAAGGGGGAACAACTCGGATGG + Intronic
915822720 1:159042539-159042561 ATCTGGGGACAGAACTGAGATGG - Intronic
915904094 1:159865505-159865527 ATGAGAGGGAGGAATTGGGACGG - Intronic
916218249 1:162417391-162417413 AAGAGGGAGCAGGACTGAGAAGG + Intergenic
917080544 1:171252807-171252829 GTGAGGGGACAGAAGAGGGAGGG + Intronic
917886887 1:179394965-179394987 ATAAGGTGGAAAAACTGGGAAGG + Intronic
918715654 1:187783443-187783465 AGGAGGGGTCAGAACAGGTAAGG + Intergenic
919547279 1:198939607-198939629 ATGAGAGGGCTGACCTGGAAGGG - Intergenic
919929335 1:202211025-202211047 AGGATGGGGCAGCAGTGGGAAGG + Intronic
920336545 1:205248974-205248996 AGCACGGGGCAGAGCTGGGAGGG + Intronic
920386602 1:205574335-205574357 CTCAGGAGGCAGAAGTGGGAGGG + Intronic
920661253 1:207917362-207917384 CTTAGGAGGCAAAACTGGGATGG - Intergenic
920696283 1:208183487-208183509 ATGAAGGGGCAGAGATGGGAGGG + Intronic
921900921 1:220449747-220449769 TTCAGGAGGCAGAGCTGGGATGG - Intergenic
1063274731 10:4552875-4552897 GTGTGTGGGCAGCACTGGGAGGG + Intergenic
1064071121 10:12229003-12229025 GGGAGGGGGCAGACCTGGCACGG - Intronic
1065548299 10:26844534-26844556 CTGCGTGGGCAGAACAGGGAAGG - Intronic
1067485963 10:46650215-46650237 AAGAAGGGGCAGAGCTGAGAAGG + Intergenic
1067608793 10:47691438-47691460 AAGAAGGGGCAGAGCTGAGAAGG - Intergenic
1069422117 10:68255901-68255923 ATTAGGGATCAGAGCTGGGAGGG + Intergenic
1069607665 10:69749906-69749928 AGGATGAGGCAGAACTGGGTAGG - Intergenic
1069807928 10:71137604-71137626 ATGAGGGGACAGGAGGGGGAAGG - Intergenic
1069968709 10:72145936-72145958 ATGAGGCTGCAGAACAGGCAGGG - Intronic
1072008259 10:91277964-91277986 AGGAGAGGCAAGAACTGGGAAGG - Intronic
1072158693 10:92746835-92746857 AGGAGACAGCAGAACTGGGAAGG - Intergenic
1072704101 10:97667586-97667608 AAGAGGTGGGAGAATTGGGAGGG - Intronic
1072839129 10:98751017-98751039 AGGAGGGGGAAGAGCTGGGATGG - Intronic
1073110820 10:101062158-101062180 ATGGGGGGTGAGAACTGGGGGGG - Intronic
1074140642 10:110669249-110669271 CTGAGAGGGAAGCACTGGGAAGG + Intronic
1074355782 10:112781907-112781929 AGGAGGAGGCAGAATTGGGCAGG - Intronic
1074424942 10:113342465-113342487 ATGAGGTGCCAGAACCAGGATGG + Intergenic
1074966607 10:118496352-118496374 ATGGGGTGGCAGGCCTGGGAAGG - Intergenic
1075097291 10:119480822-119480844 AGGAAGGGGCAGAAGAGGGAAGG - Intergenic
1076104770 10:127812928-127812950 AGGAGTGGGGAGAACTGGGAAGG - Intergenic
1076534704 10:131169192-131169214 ATGAGGAGGCAGAGATGGGGTGG - Intronic
1076790844 10:132775889-132775911 ATGAGGAGGGAGAACTGGTTCGG + Intronic
1077283848 11:1757225-1757247 GGGAGGGGGCAGCACTGAGAGGG + Intronic
1077467925 11:2742464-2742486 ATGAGTGGGCACAGCTGGGCAGG - Intronic
1077782590 11:5347788-5347810 AGGAGGGAGCAGAAGAGGGAGGG + Intronic
1078311304 11:10245972-10245994 TTGAGGGTGGAGAACTGGGGAGG + Intronic
1078525162 11:12095108-12095130 ATAAGGAGACAGAGCTGGGACGG + Intronic
1078736354 11:14024425-14024447 ATGGGGGGCCAGAAGAGGGATGG + Intronic
1079074694 11:17377010-17377032 ATGAGGGTGCATGTCTGGGAAGG - Exonic
1080603342 11:33842479-33842501 AAGAGGGGGAAGGACTGGCACGG + Intergenic
1081201344 11:40219725-40219747 ATGAGGGGGAAGAAATTGGGGGG + Intronic
1081469284 11:43354852-43354874 AAGAGGGGGAAGAGCTGGCATGG - Intergenic
1081488781 11:43550857-43550879 ATGAGTGGGCAGAAATGGTGAGG - Intergenic
1083302957 11:61748340-61748362 TTGAGAGGGCAGTGCTGGGAAGG + Intergenic
1083629391 11:64087965-64087987 TCGAGGGGCCAGAGCTGGGAGGG + Intronic
1084628888 11:70332629-70332651 ATGAATGGGGAGAACTTGGAGGG - Intronic
1085736588 11:79044424-79044446 AGGAGGCGGCAGGACTGGGTAGG + Intronic
1086344106 11:85878333-85878355 ATGAGGGGGCAGAACTGGGAGGG - Intronic
1086357403 11:86017631-86017653 ATGCTGTGGCAAAACTGGGAAGG - Intronic
1087641895 11:100763963-100763985 AAGAGGAAGAAGAACTGGGAAGG - Intronic
1087685483 11:101258284-101258306 ATGGGGGGGCGGAAAAGGGAGGG - Intergenic
1089102506 11:115975476-115975498 GTGAAGGGGCAGTAGTGGGAAGG - Intergenic
1089499171 11:118922675-118922697 GGGAGGGGGCAGAAGGGGGATGG - Intronic
1089755295 11:120681762-120681784 AGGAAGGGGCAGAAATGGGCTGG + Intronic
1090803162 11:130187319-130187341 ATGAGGGGCCAGAATACGGAGGG - Intronic
1091060186 11:132453776-132453798 TTCAGCAGGCAGAACTGGGATGG + Intronic
1092166912 12:6348021-6348043 GGGTGGGGGCAGAAGTGGGAAGG + Exonic
1092237450 12:6819034-6819056 TTGAGGAGGAAGAGCTGGGAGGG + Intronic
1093923590 12:24887253-24887275 AGCACAGGGCAGAACTGGGATGG + Intronic
1094458981 12:30672681-30672703 ATTAGTGGACAGCACTGGGAGGG + Intronic
1096103345 12:48982288-48982310 ATGAGGAGGCAGGACAGGAAGGG - Intergenic
1097219279 12:57437743-57437765 ATGAGGGGCCAGAAATGGGAAGG - Intronic
1098012792 12:66072200-66072222 AAGAGGGTTCAGGACTGGGAGGG + Intergenic
1098174721 12:67778819-67778841 ATGAAAGGGCAGAATTGGCAGGG - Intergenic
1098383702 12:69896646-69896668 AAGAGCAGGCTGAACTGGGAAGG + Intronic
1099890442 12:88583182-88583204 AGGAGGAGACAGAACTGAGAGGG - Intergenic
1100317078 12:93454328-93454350 ATGAGGGGGCTGAAAAGTGATGG - Intergenic
1100406970 12:94280450-94280472 AGCAGGGGGCTGGACTGGGAGGG - Intronic
1100478119 12:94952737-94952759 ATGAGGAGCCAGAAAGGGGATGG - Intronic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1101835210 12:108290242-108290264 ATGAGGCTGCAGAGTTGGGAAGG - Exonic
1102275034 12:111575418-111575440 ATGGGGAGGCTGAAATGGGAAGG - Intronic
1102954105 12:117048385-117048407 ATGAGGAGGCTGACCTGGGGCGG + Intronic
1103145369 12:118590669-118590691 GGGAGGTGGCAGAGCTGGGAGGG + Intergenic
1103317732 12:120070422-120070444 AAGATGGGGCAGCACTGGGCAGG - Intronic
1104489477 12:129181591-129181613 ATGAGGTGGGAGAGGTGGGAAGG - Intronic
1105828309 13:24142444-24142466 CTGAGGGGGGAGAAATGGGCTGG - Intronic
1106170073 13:27281039-27281061 TGGAGGGGGCAGGAGTGGGAGGG - Intergenic
1106224341 13:27773835-27773857 AGGAAGTGGCAAAACTGGGAAGG + Intergenic
1106263661 13:28090955-28090977 TTGAAGGGACAGTACTGGGATGG + Intronic
1106758327 13:32844235-32844257 ATGAGGGAGCAGGAGTGAGAAGG - Intergenic
1107250344 13:38352191-38352213 AGGAAGGAGAAGAACTGGGAAGG - Intronic
1107689163 13:42934743-42934765 ATGAGGGGGCAATGCTGGCATGG - Intronic
1108176512 13:47798213-47798235 ATGGGGAGGGAAAACTGGGAGGG + Intergenic
1108811227 13:54225515-54225537 ATGAGGGGCCAGAGATAGGAGGG + Intergenic
1110475473 13:75908307-75908329 ATGAGTTGGCAGGCCTGGGAGGG + Intergenic
1110574564 13:77040876-77040898 ATGAGGGAGCAGGAGTGGGCAGG + Intergenic
1111106262 13:83649303-83649325 ATGAAGGGGCAAAACTAGTAGGG + Intergenic
1111264931 13:85796562-85796584 TTTAGTGGGCAGAACTGGGGAGG + Intronic
1113966368 13:114155719-114155741 ATGAGGGTGGAGAAGTGGGGAGG + Intergenic
1118359067 14:65040785-65040807 CTTAGGTGTCAGAACTGGGAAGG + Exonic
1118616536 14:67578014-67578036 AAGAGCTGGCAGGACTGGGAGGG - Exonic
1118818001 14:69326179-69326201 TTGATGGGGCTGATCTGGGAAGG - Intronic
1119124775 14:72115548-72115570 GTGAGGGAGGAGATCTGGGAAGG + Intronic
1119134036 14:72200566-72200588 ATGAGGGGGCAGCACAGGACGGG + Intronic
1119378832 14:74215754-74215776 GTGAGGGGACAGATCTGGCATGG - Intergenic
1119715478 14:76856094-76856116 ATGAGGCCACAGAGCTGGGATGG - Intronic
1121248401 14:92481541-92481563 AAGAGGGGGCAGAACAAGGTTGG - Intronic
1121255565 14:92528027-92528049 ATGTGGGGGCAGCTCAGGGAGGG + Intronic
1121662501 14:95645998-95646020 CTGTGGGGCCAGAACTGGGAAGG - Intergenic
1122030525 14:98908352-98908374 GTGAGGGAGGAGGACTGGGAGGG - Intergenic
1122353893 14:101112280-101112302 AAGAGGGGGCAGACCTGGGGAGG - Intergenic
1122353917 14:101112364-101112386 AAAAGGGGGCAGACCTGGGGAGG - Intergenic
1122542098 14:102504429-102504451 ATGAGCTTGCAGGACTGGGAGGG - Exonic
1122603527 14:102932857-102932879 ATGCGGGGGCAGGACTGGTGGGG + Exonic
1122744028 14:103887578-103887600 ATGAGGGGGCAGAGGTGAGAAGG - Intergenic
1122860971 14:104582220-104582242 AGGACGGGGCAGGAGTGGGAGGG + Intronic
1122906803 14:104805390-104805412 ATTTGGGGTCAGGACTGGGAAGG - Intergenic
1122920089 14:104876464-104876486 GGGAGGAGGCAGAACTGAGAGGG - Intronic
1122961760 14:105097145-105097167 AGGAGGGGGTAGAGCTGGGTGGG - Intergenic
1202902902 14_GL000194v1_random:53455-53477 ATGAGGGGTCAGAGCTGAGGGGG - Intergenic
1124430167 15:29600420-29600442 ATGGTGGGAGAGAACTGGGATGG - Intergenic
1126034266 15:44532640-44532662 CTCAGGGGGCTGAAGTGGGAGGG - Intergenic
1127962321 15:63898973-63898995 TTGAGGAGGCAGGGCTGGGAGGG - Intergenic
1128481633 15:68045374-68045396 AGGAGGAGGCAGAGCTGGGCTGG + Intergenic
1128506106 15:68273888-68273910 ATGGGTGGGGAGAACTGAGAGGG + Intergenic
1128600259 15:68989938-68989960 CTGAGGGGCCTGAACTGGGGTGG + Intronic
1128771168 15:70283637-70283659 AGGAGTGGGCAGAAATGGGCAGG - Intergenic
1128799636 15:70489407-70489429 TTTGAGGGGCAGAACTGGGAAGG - Intergenic
1128987307 15:72230856-72230878 ATGAGGGGGTAGGGCTGGGGCGG + Intronic
1129924832 15:79354825-79354847 ATGGGGGGGCAGAGCTTGAAGGG - Intronic
1130150813 15:81310168-81310190 ATGTGGGGGAAGACCTGGCAAGG + Exonic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130576867 15:85100755-85100777 ATGAAGGGGCTGGGCTGGGATGG + Intronic
1131557746 15:93414248-93414270 ATGGGGGGCCAGAAGGGGGACGG + Intergenic
1132028405 15:98421445-98421467 CTGAGGGAGCAGAGCAGGGACGG - Intergenic
1132629738 16:911504-911526 ATGGGGAGGCAGCACTGGGGAGG + Intronic
1132629750 16:911532-911554 CTGGGGGGGCAGCACTGGGGGGG + Intronic
1132629767 16:911576-911598 CTGGGGGGGCAGCACTGGGGGGG + Intronic
1132629773 16:911590-911612 CTGGGGGGGCAGCACTGGGGGGG + Intronic
1132629783 16:911619-911641 TTGGGGGGGCAGCACTGGGGAGG + Intronic
1132629795 16:911647-911669 ATGGGGGGGCAGCACTGGGGGGG + Intronic
1132860819 16:2070933-2070955 CTGAGAGGGCAGAGCTGAGACGG + Intronic
1133414454 16:5595454-5595476 ATGAGGGAGCAGAACTTGCAGGG + Intergenic
1133838262 16:9385706-9385728 ATTAAGTGGCAGAGCTGGGATGG + Intergenic
1135534456 16:23282278-23282300 ATGAGGGGGAAGAACAGATAGGG + Intronic
1135830164 16:25765846-25765868 CTGAGGGGGCTGTGCTGGGAGGG + Intronic
1135939718 16:26810482-26810504 ATGAGGAGGCATAAGGGGGATGG + Intergenic
1136531270 16:30871074-30871096 CAGAGGGGCCAGAACTGGGCAGG + Intronic
1137551200 16:49438720-49438742 GTGGGGGAGCAGAACTGAGAGGG + Intergenic
1137613253 16:49833094-49833116 ATGAGGGGCCAGGCCTGGTAAGG - Intronic
1137891791 16:52170589-52170611 AAGAGGGGAAAGAACTGGGTAGG - Intergenic
1138195899 16:55051903-55051925 ATGAAGGGGCAGTACCGAGAGGG - Intergenic
1138443066 16:57046694-57046716 CAGAGGGGGCAGAGCTGGCAGGG + Intronic
1140092604 16:71850489-71850511 CTGAGGGGTAAGAACTGGGCTGG - Exonic
1140138574 16:72231121-72231143 ATGTGGGGGTAGCACTGGAAGGG + Intergenic
1141224086 16:82098842-82098864 AGGAGGAGGCAGAAATGGCAAGG + Intergenic
1141903322 16:87006869-87006891 AGGAGGTGGCAGCAGTGGGAGGG + Intergenic
1142483169 17:230798-230820 ATGAGGTGGAAGAACAGTGAAGG - Intronic
1142519584 17:495468-495490 CTCAGGAGGCAGAAGTGGGAGGG - Intergenic
1143718728 17:8795404-8795426 ATGAGGGTACAAATCTGGGAGGG + Intergenic
1146142198 17:30378131-30378153 ATGAGGTGGGAGAAGTGGGCCGG + Intergenic
1146297955 17:31665054-31665076 ATGAGGTGGGAGAAGGGGGAAGG - Intergenic
1148555659 17:48577332-48577354 ATGAGGGGGTGGAAGAGGGAGGG + Intronic
1148871296 17:50660174-50660196 AGGAGGAGGCAGAATTGGCAGGG - Intronic
1149003543 17:51781074-51781096 TTGGGGAGGAAGAACTGGGAGGG + Intronic
1150120725 17:62599512-62599534 ATGGGAAGGCAGAAATGGGAGGG + Intronic
1151686861 17:75652589-75652611 ATGAGCGGGCTGAGCTGGGCTGG + Intronic
1151893971 17:76967920-76967942 CTGAGGAGGCTGAAGTGGGAGGG - Intergenic
1152123377 17:78432470-78432492 AGCAGGGAGCAGAACTGGGCCGG - Intronic
1152626964 17:81392298-81392320 AGGAGGAGGCAGAAGTGGGGAGG + Intergenic
1153086718 18:1296755-1296777 AAGAGGGGGATGAAGTGGGAAGG + Intergenic
1153523824 18:5977092-5977114 ATGAGGGAGCAGGACTGAGGTGG - Intronic
1153948865 18:10040397-10040419 TGGAGGGGGCAGAATAGGGATGG + Intergenic
1153989555 18:10384456-10384478 AGGAAGGTGCAGAAATGGGAGGG - Intergenic
1154415631 18:14173983-14174005 AGGAGAGGGCAGAACAGGCAGGG + Intergenic
1155122681 18:22838973-22838995 ATGAAGGGGCAGAAATGAGCAGG - Intronic
1157293310 18:46425103-46425125 GTGTTGGGGCAGAACAGGGAGGG - Intronic
1158548771 18:58417435-58417457 CTGAGGCCCCAGAACTGGGATGG + Intergenic
1160020335 18:75175622-75175644 ATCCAGGGGCAGAACTGGAAGGG + Intergenic
1160848959 19:1180541-1180563 ATGCGGGGGCAGGGATGGGATGG + Intronic
1161562832 19:4983319-4983341 AGGCGGGGGCAGGATTGGGAGGG - Intronic
1162321351 19:9972881-9972903 AAGTGGGGGCAGACATGGGAGGG - Intronic
1162332642 19:10039553-10039575 AGGAAGGAGCAGGACTGGGAGGG + Intergenic
1162373023 19:10290199-10290221 AGGCGAGGGCAGAGCTGGGAGGG - Intronic
1162964748 19:14150581-14150603 GTGAGGAGGGAGAACTTGGAAGG - Exonic
1163383054 19:16981251-16981273 CTCAGGGGGCTGAAGTGGGAGGG + Intronic
1163527589 19:17830880-17830902 GGGAGGGGCCAGAACTGGGCGGG + Intronic
1163560159 19:18014275-18014297 ATGAGGAGGCTGAGCTGGGGTGG + Intergenic
1163815839 19:19463916-19463938 ATGAGGGGGCACATTTGGGCAGG + Intronic
1164520065 19:28972320-28972342 GTGAGGGGGCATGGCTGGGATGG - Intergenic
1165607946 19:37122974-37122996 GTGATGGGGCAGACCTGGGAGGG - Intronic
1165822313 19:38684410-38684432 AGGGTGGGGCAGCACTGGGAAGG - Intronic
1165832615 19:38736927-38736949 AAGAGGGGGCGGCGCTGGGAGGG - Intronic
1165857514 19:38888844-38888866 CTGAGAGGGCAGACCTGAGAGGG + Intronic
1166423191 19:42654000-42654022 AAAAGGGGGCAGGACTGAGAGGG + Intronic
1166557874 19:43713477-43713499 CAGAGGGGGCAGCACTGGGATGG - Intergenic
1166840855 19:45696089-45696111 ATGAGGCGGGAGCCCTGGGAGGG - Intronic
1167381065 19:49138355-49138377 TTGAGTGGCCAGAGCTGGGAGGG - Exonic
1167526357 19:49986654-49986676 ATGTGAGGGAAGGACTGGGAAGG + Intronic
1167604678 19:50475490-50475512 ATGTCGGGGCAGAACTGAGGAGG + Intronic
1167997055 19:53414369-53414391 ATGTGGGGGCATCTCTGGGAAGG - Intronic
1168006837 19:53497050-53497072 ATGTGGGGGCATCTCTGGGAAGG - Intergenic
1168115401 19:54219448-54219470 AGGAAGCGGCAGAGCTGGGAAGG + Intronic
1168124722 19:54277128-54277150 AGGAAGCGGCAGAGCTGGGAAGG + Intronic
1168177264 19:54634420-54634442 AGGAAGCGGCAGAGCTGGGAAGG - Intronic
1168181570 19:54665579-54665601 AGGAAGCGGCAGAGCTGGGAAGG - Intronic
1168326194 19:55539664-55539686 CTGTGGGAGCAGAACTGGGAAGG + Intergenic
1168668500 19:58222928-58222950 ATGAGGGGGAAGAAGTAGGCTGG + Intergenic
925182968 2:1829061-1829083 AGGATGGGGCAGAAGAGGGAGGG - Intronic
925411443 2:3642068-3642090 ATCGGTTGGCAGAACTGGGAGGG + Intronic
925537988 2:4936848-4936870 ATGATGGGGCAGAAGGTGGAGGG + Intergenic
925565808 2:5253035-5253057 CTGTGAGGGCAGAGCTGGGAGGG + Intergenic
925572908 2:5330697-5330719 ATGTGGGGGCAGCACTGTGAAGG - Intergenic
925875598 2:8308866-8308888 ATGAATGAGCAAAACTGGGAAGG + Intergenic
926357736 2:12056802-12056824 ATGTGGGGGCTGAACTAGGGTGG + Intergenic
929416668 2:41748922-41748944 TTAATGGGGCAGACCTGGGAGGG + Intergenic
930980423 2:57519118-57519140 ATTAGGAGGCTGAAGTGGGAGGG + Intergenic
931739190 2:65227325-65227347 TTCAGCGGACAGAACTGGGATGG - Intergenic
931934801 2:67185434-67185456 ATGTGGGTGGGGAACTGGGAAGG - Intergenic
932426104 2:71636361-71636383 ATGATGGGGCTGGACTGGGGCGG + Intronic
932734353 2:74244091-74244113 ATGAGGGGGGAGAACTGTGGAGG - Intronic
932824065 2:74924475-74924497 ATGGGGTGGCAGAACTGGGAAGG + Intergenic
933374343 2:81460396-81460418 ATGAGGGAGGATAACTGGGAAGG - Intergenic
934197539 2:89851823-89851845 ATGAGGGAGGACAACTGGGTGGG + Intergenic
935065296 2:99642135-99642157 ATGAGGGGGCAGGAGAGGGAGGG + Intronic
935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG + Intronic
935837271 2:107068550-107068572 GGGCGGGGGCAGAATTGGGATGG - Intergenic
936582604 2:113716496-113716518 ATGAGGAGGCAGAACTGATATGG + Intronic
937114685 2:119396957-119396979 GTGAGGGGGCAGAGCTGGCAGGG + Intergenic
937357809 2:121209196-121209218 AAGCGGGCGCAGCACTGGGAAGG + Intergenic
938604191 2:132875332-132875354 AGGAGGGGGCAGAATTGGAAAGG - Intronic
939052307 2:137322275-137322297 AGAAGGTGGCAGACCTGGGACGG - Intronic
940986267 2:160055248-160055270 ATGAAGGGGAAGAAATGCGAGGG + Intronic
941656878 2:168153832-168153854 ATGAGGGGCCAGATCTTGTAAGG + Intronic
941864662 2:170322264-170322286 TTGAGGGGACAGAAATAGGAAGG - Intronic
942045475 2:172097070-172097092 ATGAGGGGGCGGAAAGGGGGAGG - Intergenic
942983174 2:182106525-182106547 ATGGGGAGCCAGAAGTGGGATGG - Intronic
943662306 2:190571977-190571999 ATTAGGGAGCATAACTGAGAAGG - Intergenic
943937436 2:193938526-193938548 ATTTAGGGGCAGAACTGAGATGG - Intergenic
944560128 2:200928012-200928034 AGGAAGAGGAAGAACTGGGATGG - Intronic
944775242 2:202957211-202957233 ATTAGGGACCAGAAATGGGAGGG - Intronic
945509612 2:210684760-210684782 ATGACGGGGCAGATCAAGGAAGG + Intergenic
947706856 2:232283237-232283259 TAGAGGTGGCAGAACTAGGATGG + Intronic
948075368 2:235161613-235161635 GTGAGAGGGCAGAAGTGAGAAGG - Intergenic
948080175 2:235199200-235199222 GTGAGGAGGCAGCACTGGGTAGG + Intergenic
948399457 2:237673278-237673300 ATGCGGGGACAGCGCTGGGAGGG + Intronic
948835728 2:240625152-240625174 ATGACAGGGCAGAAGTGGGCTGG + Intronic
1169216462 20:3797141-3797163 TTCTGGGGGCAGAACTGGGGTGG - Intronic
1170730447 20:18970381-18970403 ATGTGGGGGCTTAACTGGGCTGG - Intergenic
1172032370 20:31991085-31991107 AGGAGGGGGCAGGAGTGGGCAGG + Intronic
1173464285 20:43268729-43268751 ATGCTGGGGCAGAATTGGAAGGG + Intergenic
1173617678 20:44413651-44413673 GTGAGGAGGGAGAACAGGGATGG - Intronic
1173954270 20:47018580-47018602 AGGAGGGGCCAGAGCTGGGCCGG + Intronic
1173992999 20:47317398-47317420 ATGTGGGGGCAGGAGTGGGGTGG - Intronic
1174388748 20:50203910-50203932 ATGTGGGGGCAGGAGTGGGAGGG - Intergenic
1175116942 20:56689402-56689424 TGGAGAGGGCAGAAGTGGGAGGG + Intergenic
1175154023 20:56957466-56957488 ATGAGGAGACTGGACTGGGAGGG + Intergenic
1175166344 20:57047283-57047305 ATGAGGAGGCCGAATTGGGAAGG - Intergenic
1176130318 20:63494044-63494066 GTCTGGGGACAGAACTGGGAGGG - Intronic
1176265989 20:64209591-64209613 ATAAGGAGAGAGAACTGGGATGG + Intronic
1176385508 21:6137080-6137102 AGGAGGAGGCAGAAGTGGGCAGG - Intergenic
1176443212 21:6796470-6796492 ATTAGGGGGAAAAACAGGGAAGG + Intergenic
1176622266 21:9068222-9068244 ATGAGGGGTCAGAGCTGAGGGGG - Intergenic
1176821379 21:13661513-13661535 ATTAGGGGGAAAAACAGGGAAGG + Intergenic
1176857697 21:13985293-13985315 AGGAGAGGGCAGAACAGGCAGGG - Intergenic
1176866902 21:14058906-14058928 AGGAGAGGGCAGAACAGGCAGGG + Intergenic
1178351390 21:31874576-31874598 ATGAGGGGGCAGGGGTGGGAGGG - Intronic
1179722164 21:43322023-43322045 AAGAGGGAGCAGACCAGGGAGGG - Intergenic
1179737965 21:43401172-43401194 AGGAGGAGGCAGAAGTGGGCAGG + Intergenic
1181471265 22:23141713-23141735 AAGTGGGGGCCGGACTGGGAGGG + Intronic
1181909662 22:26228575-26228597 AGGAGGAAGCAGAACTGGGAAGG - Intronic
1182471856 22:30553762-30553784 ATAGGGGGGCAGAAGTAGGAGGG + Intergenic
1183184823 22:36285833-36285855 GTGAGGGGGCAGAGTTGGGGGGG - Intronic
1183217364 22:36489697-36489719 GAGACGGGGCAGAACTGGGCTGG + Exonic
1183731946 22:39623051-39623073 AGCAGGGGGCAGCACTGTGATGG + Intronic
1183743881 22:39682455-39682477 AGGATGGGGCAGGACTGGGAAGG - Intronic
1183819253 22:40331758-40331780 AGGAGAGGGCAGAAAGGGGAAGG + Exonic
1184424507 22:44401556-44401578 ATGAGAGGGAAGAGCTAGGAGGG - Intergenic
1184635134 22:45821992-45822014 ATGATGGGGAAGAGCAGGGAAGG - Intronic
1184663318 22:45975552-45975574 ATGGCGGGGCAGACATGGGATGG + Intronic
949414330 3:3799638-3799660 AGGGGGAGGCAGGACTGGGAAGG - Exonic
949825974 3:8166283-8166305 ATGAGTGAGCAGAGCTGAGATGG + Intergenic
950156240 3:10723621-10723643 ATGATGGGAAAGCACTGGGAGGG + Intergenic
950531242 3:13553413-13553435 CTGAGGAGGAAGAGCTGGGACGG + Intronic
951779235 3:26345013-26345035 AGGAGGGGGCGGAGCTGGGAGGG - Intergenic
953345420 3:42171613-42171635 ATGAGCCGGGAGAAGTGGGAAGG - Intronic
953749117 3:45595911-45595933 ATGACGGGGCAGAACTGGAAAGG - Exonic
956472498 3:69582149-69582171 ATGAGGTGGGAGAAAGGGGAGGG + Intergenic
956528032 3:70186516-70186538 TTGAGGGGGCAGAGGCGGGAGGG - Intergenic
956652571 3:71518890-71518912 ATGAGGAGAAAGAACTGGCAAGG + Intronic
957338231 3:78859696-78859718 ATGAGGGAGAGGAACTGGGTGGG + Intronic
958168956 3:89914834-89914856 ATGAGGAGGTAGAAAGGGGATGG + Intergenic
959325931 3:104936737-104936759 ATGAGTGGACAGAATTGGTATGG - Intergenic
960260177 3:115558553-115558575 ATGGGGGTGAAGAACTTGGAAGG + Intergenic
960727115 3:120681740-120681762 ATGAGGCTGCAGCAATGGGAAGG + Intronic
960818336 3:121697943-121697965 TTGAGGGGGCAGAACGTGTAAGG - Exonic
961450154 3:126999050-126999072 AGGAGGGGGCAGTCCTGTGAGGG + Intronic
962455710 3:135563827-135563849 AGGAAGGGGCAAAACAGGGAAGG - Intergenic
963068367 3:141281665-141281687 ATGGGGTGGCAGATCAGGGAAGG + Intronic
963284538 3:143420432-143420454 AAGATGAGGCAGAACTAGGATGG - Intronic
965517843 3:169641026-169641048 AGGAAGAGGCAGCACTGGGAGGG + Intronic
965722153 3:171673844-171673866 ATGTGGGGACAGAAGTAGGATGG - Intronic
968567504 4:1321991-1322013 ATGAGGGGGCTGCCCAGGGAGGG + Intronic
968654777 4:1773737-1773759 ATGAGGGGTCAGAACAGACATGG - Intergenic
969327719 4:6453405-6453427 CTGAGGAGGCAGAGCTGGGGTGG - Intronic
969400441 4:6951971-6951993 ATGAGGCGGCAGGGCTGGGAAGG + Intronic
971681745 4:29708953-29708975 ATGTAGGGGCAGAGCTGGAAGGG + Intergenic
973754039 4:54054937-54054959 ATGATGGGCCAGATCAGGGAGGG + Intronic
976405790 4:84659459-84659481 ATGATGGGGCAGGGATGGGATGG + Intergenic
976476524 4:85490102-85490124 TGGAGGGGGCAGAAATGGGAGGG + Intronic
976671074 4:87654330-87654352 ATGAGGGGCCAGAGATAGGAGGG + Intronic
978753708 4:112281600-112281622 TTAAAGGGGCAGAACTGGTAGGG - Intronic
979537180 4:121836349-121836371 ATGAGGAGGCATAAGTGGGATGG - Intronic
981432830 4:144681801-144681823 TTTTGGGGGCAGAATTGGGAAGG + Intronic
981740105 4:147992340-147992362 TAGAGGGAGCAGATCTGGGAGGG - Intronic
983283299 4:165708251-165708273 AGGAGGGGGAAGAAGTGGGTTGG - Intergenic
983533265 4:168832543-168832565 CTGAGGGGTCAGACCTGGGGTGG + Intronic
983574239 4:169242822-169242844 TTGAGGGGCCAGATCTGGCAAGG - Intronic
984614280 4:181878320-181878342 ATGAGGGGGCAGGAAAAGGAAGG + Intergenic
984865054 4:184274089-184274111 GTGAGGGGCCCGAACTGTGAAGG - Intergenic
985728135 5:1526327-1526349 ACAAGGGGGCACAGCTGGGAGGG + Intergenic
985805419 5:2039380-2039402 AGGAGGGGCCCGAGCTGGGAAGG + Intergenic
987098869 5:14574895-14574917 AATAGTGGGCAGAGCTGGGAGGG + Intergenic
988615706 5:32772864-32772886 AGGAAGTGGCAGAACTGGAAAGG + Intronic
989983656 5:50671047-50671069 ATAAGAAGGCAGTACTGGGAAGG - Intronic
996347393 5:122501782-122501804 AGGAGGGGGCAGAAGTGAGGAGG + Intergenic
996701627 5:126456183-126456205 CTGAGGGGGCAGATAGGGGATGG - Intronic
998162904 5:139823403-139823425 ATGATGGGGCAGAGATGGGGTGG - Intronic
998797055 5:145831795-145831817 ATGAAAAGGCAGAACTGGGAAGG - Intronic
999134024 5:149305788-149305810 ATGAGAAGGCAGAGCAGGGAGGG + Intronic
999248834 5:150169548-150169570 AAGTGGGGGCAGAATTGGGTTGG + Intronic
999968464 5:156835005-156835027 AGGTGGGGGCAAGACTGGGAAGG - Intergenic
1000470202 5:161631079-161631101 ATGGGGGGCCAGAAGGGGGATGG + Intronic
1001242333 5:170080275-170080297 AGCAGGGGGCATACCTGGGATGG - Exonic
1001555837 5:172636697-172636719 AGAAGGGGGCAGAACTCAGAGGG - Intergenic
1002318288 5:178359826-178359848 AAGATGGAGCAGGACTGGGATGG + Intronic
1002330177 5:178435525-178435547 GTCAGGTGGCAGAGCTGGGATGG - Intronic
1002642485 5:180636828-180636850 AGGACGGGGCAGCACCGGGAGGG - Intronic
1002701751 5:181129772-181129794 AGGAGGGGGCTGATGTGGGACGG - Intergenic
1002704048 5:181148367-181148389 AGGAGGGGGCTGATGTGGGACGG + Intergenic
1003388688 6:5693313-5693335 GTGAGGGGGCAGATCTGGTGAGG - Intronic
1005098352 6:22143108-22143130 ATTAGGGGGCAGATCTGGACAGG + Intergenic
1006814395 6:36840333-36840355 GAGAGGGGGCATAAGTGGGAGGG + Intergenic
1007350383 6:41269182-41269204 ATGGGGAGGTGGAACTGGGATGG - Intronic
1007485599 6:42178770-42178792 AAGAAGGGGCAGAAGTGAGAGGG - Intronic
1007907412 6:45476197-45476219 ATGAGAATGCAGAAATGGGATGG + Intronic
1010533284 6:76992488-76992510 AGAAGGGGGAAGAAGTGGGAAGG - Intergenic
1012216855 6:96597751-96597773 ATGCAGCAGCAGAACTGGGAAGG - Intronic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1012820197 6:104077037-104077059 AAAAGGGGGCAGAAATGGGGAGG - Intergenic
1012961929 6:105631193-105631215 ATGAGGGGTCAAAACTTGGAGGG + Intergenic
1013263547 6:108471080-108471102 ATGAGGAGGGAGAAATGTGAGGG + Intronic
1014697793 6:124645493-124645515 ATTTTGGGGCTGAACTGGGAAGG - Intronic
1014929962 6:127324126-127324148 ATTAGGGTGCAGTAGTGGGAAGG - Intronic
1016001287 6:139043987-139044009 TGGAGGGGGCAGAACTTGCATGG + Intergenic
1017193971 6:151681014-151681036 CTGAGTGGGCAGAACAGGTAAGG - Intronic
1017220703 6:151962338-151962360 AACAGGGGGCAGAACTATGATGG - Intronic
1017253801 6:152310751-152310773 AGCAAGTGGCAGAACTGGGACGG - Exonic
1017357256 6:153524218-153524240 GTGAAGGTGCAGAATTGGGAAGG + Intergenic
1017774816 6:157672664-157672686 AGGAGGGGGCAGAGGTGGGGAGG - Intronic
1018409566 6:163529989-163530011 ATCAGGGGGCAGTACTGTGCTGG + Intronic
1018630166 6:165815562-165815584 ATGAAGGGGCAGAACTGCATGGG + Intronic
1019280476 7:197324-197346 AGGAGGGGGCTCCACTGGGAGGG + Intronic
1019511027 7:1417352-1417374 AGGAAGGGGCAGAAAGGGGATGG - Intergenic
1021100475 7:16583457-16583479 ATGGGAGGGCAGTACTGGGTGGG + Intergenic
1021806456 7:24361736-24361758 AAGAGGCTGCAGAACTGGGTAGG - Intergenic
1021956470 7:25830109-25830131 ATGGGGGGGCAGTCCTGGGGTGG - Intergenic
1022586485 7:31618234-31618256 GTGAGGGGGCAGAAATTGGGTGG - Intronic
1022821120 7:33961857-33961879 ATGAAGGGAAAGAACTGGAAAGG + Intronic
1023454934 7:40328457-40328479 GTGTGGGGACAGAGCTGGGATGG + Intronic
1023690742 7:42783825-42783847 AGGATGGAGCAGCACTGGGAAGG - Intergenic
1026068080 7:67093057-67093079 CTGAGGAGGCAGAGGTGGGAGGG + Intronic
1028427536 7:90706968-90706990 ATGGGGAGGCAGGACAGGGAGGG - Intronic
1028854899 7:95579520-95579542 ATGAAGTGGCAGAGCTGGGATGG + Intergenic
1029087968 7:98026063-98026085 CTCAGGGGGCTGAAGTGGGAGGG + Intergenic
1029305823 7:99619505-99619527 ATGTAGAGACAGAACTGGGATGG + Intronic
1032085434 7:128881086-128881108 CTGAGGGGGGAGACATGGGATGG + Intronic
1032578874 7:133084986-133085008 CTGGGGAGGCTGAACTGGGAGGG - Intergenic
1033587803 7:142787270-142787292 GTGATGGGGCAGAAGAGGGAAGG + Intergenic
1034088743 7:148344691-148344713 GTGAGGAGGCAGAGCTGGCATGG + Intronic
1034260644 7:149753231-149753253 TTGGGGGGACAGTACTGGGAGGG + Intergenic
1034380556 7:150688640-150688662 TTGAGGGGGCAGAGCTGGAAGGG - Intronic
1034457502 7:151179001-151179023 TGGAGGAGGCAGGACTGGGATGG - Intronic
1035300065 7:157891354-157891376 AGCAGTGGGCAGAACTGAGATGG - Intronic
1035567970 8:654387-654409 CTGGAGGGGCAGAGCTGGGACGG + Intronic
1035822202 8:2605552-2605574 ATGTGGGGTCAGCAGTGGGAGGG - Intergenic
1037329078 8:17725971-17725993 CTGAGGGGGAAGAAGTGGGTAGG - Intronic
1038749892 8:30285364-30285386 AGGAGAGGGCAGAAATGGGCTGG - Intergenic
1038948669 8:32390089-32390111 AAGAGGGTGCAGAAAGGGGAGGG - Intronic
1039241483 8:35561368-35561390 TTCAGGAGGCAGAACTGGTAGGG - Intronic
1039342438 8:36665633-36665655 AAGAGTGGTCAGAACTGGGAAGG + Intergenic
1039611872 8:38926015-38926037 CTGAGAGGACAGAAGTGGGAGGG - Intronic
1039787109 8:40843430-40843452 AAGATGGGTCAGAACTGGAATGG + Intronic
1039984280 8:42435084-42435106 ATGAGGAGGAGGAAGTGGGACGG + Intronic
1041921451 8:63186883-63186905 TTGAGGAGGCAGAACTGGTTGGG - Exonic
1042593035 8:70416690-70416712 CTGAGGGGCCAGATCTGGCAAGG + Intergenic
1043739850 8:83797338-83797360 AAGAGTGGGAAGGACTGGGAAGG - Intergenic
1045078288 8:98594827-98594849 TGGATGGGGCAGGACTGGGATGG - Intronic
1045758010 8:105568841-105568863 AAAAGGGGTCAGAACTGGGGAGG - Intronic
1046097660 8:109579857-109579879 AAGAAGGTGCATAACTGGGATGG + Exonic
1047037230 8:120953297-120953319 ATGAGGGGGGAGGAGAGGGAGGG + Intergenic
1047286712 8:123493473-123493495 GGGTGGGGGCAGAACTGGCAGGG + Intergenic
1047449045 8:124946236-124946258 AGGTGGGGTCAGGACTGGGATGG + Intergenic
1047526406 8:125638055-125638077 ATGAGGGGGCAGAAGAAGAAAGG + Intergenic
1048826234 8:138430127-138430149 AGGAGAAGACAGAACTGGGAAGG - Intronic
1048896650 8:138998239-138998261 AAGAGGGGGCTGGAGTGGGATGG - Intergenic
1049206416 8:141365687-141365709 ATGAAGGGCCAGAGGTGGGAAGG + Intronic
1049256946 8:141619230-141619252 AAGAGGGGACAGAGCCGGGATGG + Intergenic
1049767639 8:144362392-144362414 AGGAGGGAGCAGAAGTGGGGAGG - Intergenic
1050472671 9:6008360-6008382 GTGAGGGGGGAGAAAGGGGAGGG + Intergenic
1056097211 9:83267287-83267309 ATGAGGGATCAGCATTGGGAGGG + Intronic
1056419150 9:86407016-86407038 AAAAGGGGGCAGAAATGAGAGGG - Intergenic
1057333992 9:94141956-94141978 ATGAGGGGGCAGAGAGGGGGAGG - Intergenic
1058064587 9:100534896-100534918 AAAAGTGGGCAAAACTGGGATGG - Intronic
1059375418 9:113876750-113876772 GGGAGGGGGCAGAGCTGGAAGGG - Intronic
1060043892 9:120325174-120325196 CTGAGGGGGCTGACCTGGGAGGG - Intergenic
1060222891 9:121773801-121773823 GTGTGGGGGCAGAGCTGGGTAGG - Intronic
1060241865 9:121911079-121911101 ACCAGGGGGCATAACAGGGATGG - Intronic
1060620131 9:125057694-125057716 ATGAGGGTGGAGGACTGGCAGGG + Intronic
1060949098 9:127589436-127589458 GTGAGATGGCAGTACTGGGATGG + Intergenic
1061217454 9:129230026-129230048 ATGAAGAGGAGGAACTGGGAAGG + Intergenic
1061231915 9:129320317-129320339 ATGAGGCAGCAGACCTGGGAGGG + Intergenic
1061347755 9:130041174-130041196 TTGAGGGTGCAGAAGTGGGAAGG - Intronic
1061417612 9:130455705-130455727 ATGAAGGGGCACAAGTGGCAAGG - Intronic
1061751408 9:132780060-132780082 AGGAGGGGGCAGAAGAGAGAAGG + Intronic
1062361052 9:136188305-136188327 AAGGAGGGGCTGAACTGGGAGGG + Intergenic
1062439269 9:136562403-136562425 CTGAGGCGGCAGGTCTGGGATGG + Intergenic
1203525990 Un_GL000213v1:88061-88083 ATTAGGGGGAAAAACAGGGAAGG - Intergenic
1186862305 X:13685267-13685289 ATGAGCAGGCAGCAATGGGAAGG - Intergenic
1187277159 X:17826294-17826316 ATGAGAGAGGAAAACTGGGATGG - Intronic
1187684535 X:21803235-21803257 ATGAGTAGGCGGAACTGGGTAGG + Intergenic
1190255825 X:48761708-48761730 ATCAAGGGGCAGGAATGGGAGGG - Intergenic
1191849570 X:65576068-65576090 ATCAGGTGGCAGAATTGGGAAGG - Intergenic
1192154300 X:68732394-68732416 ATGACAGGGCAGCACTGGGGTGG - Intergenic
1192190021 X:68985410-68985432 ATGAGGGGGAAGAAAAGAGAAGG + Intergenic
1192998709 X:76540267-76540289 ATGAGGGGGCATATTTCGGAAGG + Intergenic
1193150998 X:78124580-78124602 ATGAAGGGGCAGAACTGACCTGG + Intronic
1193656256 X:84201637-84201659 ATGGGAAGGCAGAAGTGGGAGGG - Intergenic
1195166607 X:102226458-102226480 AGGAGTTGGCAGAACTGGGCTGG + Exonic
1195192253 X:102460630-102460652 AGGAGTTGGCAGAACTGGGCTGG - Exonic
1195443374 X:104922102-104922124 TGGAGGGGGCAAAACTGGGCAGG - Intronic
1195758355 X:108221152-108221174 ATAAATGAGCAGAACTGGGATGG + Intronic
1197169347 X:123413866-123413888 TTGAGAGAGCAGAACTAGGAAGG + Intronic
1197524416 X:127544879-127544901 AAGAGGAGGGATAACTGGGAAGG - Intergenic
1199180614 X:144849283-144849305 CAGTGGGGGCAGAATTGGGATGG - Intergenic
1199570249 X:149260439-149260461 ATGAGGGAGCTGACCTGGGTTGG - Intergenic
1200068281 X:153515389-153515411 ATGTGTGGGCAGCTCTGGGAGGG - Intergenic