ID: 1086344512

View in Genome Browser
Species Human (GRCh38)
Location 11:85882567-85882589
Sequence CTGAGTGAAGAGAAGGCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 1, 2: 6, 3: 65, 4: 580}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086344506_1086344512 26 Left 1086344506 11:85882518-85882540 CCGCTTAAAAGAAGAACAGATTT 0: 1
1: 0
2: 2
3: 44
4: 492
Right 1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG 0: 1
1: 1
2: 6
3: 65
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086344512 Original CRISPR CTGAGTGAAGAGAAGGCAGA GGG Exonic
901134482 1:6984118-6984140 ATGAGTGGATAGAAGGTAGATGG + Intronic
901134487 1:6984149-6984171 ATGAGTGGATAGAAGGTAGATGG + Intronic
902107056 1:14046707-14046729 CTGAGTGCAGGTAAGGAAGAGGG - Intergenic
902360560 1:15940580-15940602 CTGACTGACTAGGAGGCAGAAGG - Intergenic
903293755 1:22330754-22330776 ATGAATGAAGAGAAGAGAGAAGG + Intergenic
903433955 1:23332123-23332145 CTGAATGGAGAGAGGGGAGAGGG + Intronic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905461805 1:38127087-38127109 CTGAGTGATGACAGGGCAGCTGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906135822 1:43500155-43500177 GAAAGTGAAGAGAAGGCAGGAGG - Intergenic
906815769 1:48876680-48876702 ATGTTGGAAGAGAAGGCAGAGGG - Intronic
908020649 1:59894511-59894533 GTGGGTGAACTGAAGGCAGAAGG + Intronic
908420711 1:63955956-63955978 ATATGGGAAGAGAAGGCAGAAGG + Intronic
908833602 1:68206469-68206491 GTGAGTGCAAAGAATGCAGAGGG + Intronic
909428599 1:75558123-75558145 CAGAGGGAAGAGAAATCAGAAGG - Intronic
910291542 1:85604629-85604651 CTGAGTGATGAAAAGCCACAAGG - Intergenic
910524880 1:88166156-88166178 CAGAGAGAAGAGAAGCCTGAAGG + Intergenic
910663258 1:89696446-89696468 CTGAGTAAAGAACAGACAGAGGG + Intronic
910898534 1:92094358-92094380 CTGTATGAAAAGAAGGCAAAAGG + Intronic
911445161 1:97983578-97983600 CTGAGTGTACAGTAGGTAGATGG + Intergenic
912518132 1:110228510-110228532 CTTGGTGAAGAAAAGGCACATGG - Intronic
912871526 1:113311237-113311259 CTGCTTGAAAAAAAGGCAGAGGG + Intergenic
912908935 1:113736843-113736865 CTGAGAGAAGAGCAGGCACCAGG + Intronic
913046070 1:115074402-115074424 CTCAGTGAGGAGGAGTCAGAGGG + Intronic
913468078 1:119163628-119163650 CCAAGTGAAGAGAAGACACAGGG + Intergenic
913478240 1:119259702-119259724 CTGAGTAGAGAGAAAGCACATGG - Intergenic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
913697017 1:121336462-121336484 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
914084541 1:144440962-144440984 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914140542 1:144943582-144943604 GAGAGGGAAGAGAAGGCAGAGGG + Intronic
914190554 1:145406228-145406250 CTGAGTAAAGAGAAGTCGGCCGG - Intergenic
914588360 1:149083102-149083124 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914760525 1:150594842-150594864 TAGAGTGAAGAGAAAGCAGAAGG + Intergenic
914889685 1:151612033-151612055 CGGGGTGAAGAGGAGGCAGGGGG - Intergenic
915841047 1:159213246-159213268 AAAAGTGAAGACAAGGCAGAGGG + Intergenic
915982360 1:160428279-160428301 CAGAGGAAAGAGAAGACAGACGG - Exonic
916091640 1:161312117-161312139 CTTAGGGAAGCCAAGGCAGAAGG - Intergenic
916633180 1:166638522-166638544 CTTAGTGAAGAGAAGAAAGATGG - Intergenic
917786089 1:178458768-178458790 CTGCTTGAAGAGAAGGAAGGGGG - Intronic
918234781 1:182570188-182570210 CTCTGTGAACAGAAAGCAGAGGG - Intergenic
919118968 1:193315306-193315328 GTCAGGGAAGAGAAGGAAGAAGG - Intergenic
919153154 1:193725571-193725593 ATGAGAGAAGAGAAGGAGGAAGG - Intergenic
919509646 1:198446193-198446215 CTGAGCAAAAAAAAGGCAGATGG - Intergenic
919748945 1:201024719-201024741 CTGGGTGAAGTGAGGGCAGCTGG - Intergenic
919757862 1:201077128-201077150 CTGAAGGAAGAGGAGGCACAAGG + Intronic
919959782 1:202455019-202455041 CTAAGTGAAGAGAAGGGAGTGGG + Intronic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
920201629 1:204263178-204263200 CTGTGACAGGAGAAGGCAGAGGG + Intronic
920484348 1:206354799-206354821 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
920524897 1:206659315-206659337 CTGCGTGAAGAGAACCCAGTAGG + Intronic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
920884250 1:209911161-209911183 ATGGGTGAATAGAAGGCTGAGGG + Intergenic
921354656 1:214274800-214274822 GCGAGTGAAGAGAAAGGAGAGGG - Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922606040 1:226890544-226890566 CTAACTGAAGGGAAGGCACACGG + Intronic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923811189 1:237318634-237318656 CTGACAAAAGAGAAGACAGAAGG - Intronic
924689067 1:246327304-246327326 CTGACTGAAGATAAGAAAGAGGG - Exonic
1064405998 10:15063876-15063898 CTGACATAATAGAAGGCAGATGG + Intronic
1065831495 10:29618564-29618586 ATGAGTGAAAAGAAGGCATTTGG - Intronic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1067349550 10:45463493-45463515 CTGCTGGAAGAGAAGGCGGATGG - Exonic
1067558071 10:47286025-47286047 CCGTGTGCAGAGCAGGCAGAGGG + Intergenic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068264591 10:54630215-54630237 CTAAGTGAAGAGAAGAAAGCTGG + Intronic
1069774251 10:70917668-70917690 CTCAGTGGACAGCAGGCAGAGGG + Intergenic
1069781612 10:70959708-70959730 GGGAGTGATGAGAAGGTAGAGGG - Intergenic
1069862555 10:71480714-71480736 CTGAGTGCAGAGAAGGCTGGAGG + Intronic
1069936945 10:71924108-71924130 GTGAGTGCACAGAAGTCAGAGGG + Intergenic
1071374699 10:84990680-84990702 TTGAGGGGAGAGAAAGCAGAGGG + Intergenic
1071568037 10:86681559-86681581 GCGAGTGAGGAGAAGGCGGAGGG - Exonic
1072753789 10:98003552-98003574 GTGGGAGAAGAGGAGGCAGAAGG - Intronic
1073301629 10:102474502-102474524 CTCAGTGAATCGCAGGCAGAGGG + Intronic
1073580679 10:104663079-104663101 CAGAGTGAAAGGAAGGCAGCCGG - Intronic
1073759831 10:106617291-106617313 CAGAGAGAGGAGGAGGCAGAAGG - Intronic
1074250949 10:111746918-111746940 ATGAGTTATGAGAATGCAGAGGG + Intergenic
1074676799 10:115860346-115860368 GTGAGCAAAGGGAAGGCAGATGG - Intronic
1075030560 10:119021915-119021937 CTTAGTGACCAGAAGGCAGGTGG - Intergenic
1075049821 10:119175308-119175330 CGGAGTGAAGAGCAGGCAGCAGG + Intronic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1075944392 10:126419637-126419659 ATGATTCAAGAGAAGGCTGAGGG + Intergenic
1075985033 10:126777894-126777916 ATGAGAGAAGACAAAGCAGAGGG - Intergenic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076346992 10:129785872-129785894 TTCAGAGAAGAGAAGGCGGAGGG - Intergenic
1078323369 11:10357345-10357367 CAGAGGAAAGAGAAGACAGAAGG + Intronic
1078723726 11:13908775-13908797 CTGTGAGATTAGAAGGCAGAAGG - Intergenic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1079455074 11:20629316-20629338 GTGAGGGAAGAGAAGGCAGTGGG - Intronic
1079721662 11:23822509-23822531 CTGAAGGAACAGAAGGCAAAAGG - Intergenic
1079870276 11:25789981-25790003 TTCATTGAAGACAAGGCAGATGG - Intergenic
1080305241 11:30828118-30828140 GTGAGTGAGGAGAAGACAGCAGG - Intergenic
1080384448 11:31802881-31802903 CAGAGTGAAGAGGAAGAAGAGGG + Intronic
1080987293 11:37483936-37483958 CTAACTGAAGAGAAAGCATATGG - Intergenic
1081346852 11:41998221-41998243 CTGCTGGAAGAGAAGGCAAAGGG + Intergenic
1081731034 11:45371857-45371879 ATGAATGGAGAGAAGGCAGCAGG - Intergenic
1081751420 11:45513860-45513882 CAGAAGGAAGTGAAGGCAGAGGG + Intergenic
1082270022 11:50160290-50160312 CTGAGTGATGGGAAGGCATTGGG + Intergenic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083366175 11:62142682-62142704 CAGAGTCCACAGAAGGCAGATGG - Intronic
1083725024 11:64623416-64623438 CTGAGGGAAGAGGATGAAGAGGG - Intronic
1083857435 11:65400095-65400117 CTGAGTGGAGGGAGGGCAGCAGG + Intronic
1083958076 11:65997772-65997794 AAGAGGGAAGTGAAGGCAGAAGG + Exonic
1084872117 11:72105380-72105402 CTCAGGGAAGAGCAGGCAGAGGG + Intronic
1085124736 11:73992144-73992166 CTGAGTATGGAGAAGGCAAAAGG - Intergenic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1086193462 11:84108631-84108653 CTGAGGCAAGAGAAGGTAGCAGG + Intronic
1086236219 11:84634168-84634190 CTGATTGAAGACAATACAGATGG - Intronic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1087586934 11:100133637-100133659 ATGAGTGAAGAAGAGGCATATGG - Intronic
1087612182 11:100447991-100448013 ATAACTGAAGAGAATGCAGATGG + Intergenic
1087900973 11:103640526-103640548 CTGACAGTAGAGAAGCCAGAGGG + Intergenic
1087917050 11:103823171-103823193 CTGGGAGTAGAGAAGGTAGAAGG + Intergenic
1088044297 11:105428840-105428862 CTGAGTGAAGAAGGGGCAGATGG - Intergenic
1088463718 11:110111071-110111093 CTGAGTGAAGATGTGGCAGGTGG + Intronic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1089972038 11:122701781-122701803 CAGAGTTCAGAAAAGGCAGATGG - Intronic
1090085375 11:123645747-123645769 CTGACTGCAGAGAGGACAGATGG + Exonic
1090439113 11:126711831-126711853 CTCAGTGGAGAGAGGGCAGCTGG - Intronic
1090844475 11:130519351-130519373 AAGAGTGCAGAGAAGGCTGAAGG + Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1090995661 11:131863731-131863753 TTTAGGGAAGAGAAGGCAGATGG - Intronic
1091050007 11:132358841-132358863 ATGGGTGAAGAGAAGAGAGAGGG - Intergenic
1091215725 11:133900255-133900277 CTGAGTGATGAGCAGGAATAAGG + Intergenic
1091296408 11:134476972-134476994 CTTTGTGAAGAGAAGGGGGAGGG + Intergenic
1092284305 12:7120082-7120104 CAGAGTAAAGTGAGGGCAGAGGG + Intergenic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1094058060 12:26286309-26286331 CTGAGAGCAGGGATGGCAGATGG + Intronic
1094568498 12:31621302-31621324 CTAAGTGCAGGGAAGGCAAAGGG - Intergenic
1096584727 12:52612499-52612521 CAGAAAGCAGAGAAGGCAGAAGG + Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1098594334 12:72254575-72254597 CTGAGTGAAGATGAGGAAGAAGG - Intronic
1099267862 12:80470422-80470444 GGGAGTGAAGATAGGGCAGAAGG + Intronic
1099327001 12:81229576-81229598 CTCAGTTAAGAGAACCCAGAGGG + Intronic
1099992218 12:89735962-89735984 GTGAGTGTTGAGAAAGCAGAAGG - Intergenic
1100079177 12:90826882-90826904 CTGACTGCAGAGAAGGCAACTGG + Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101242910 12:102856171-102856193 CTCAGTGAAGAGAAGGTATGAGG - Intronic
1102026820 12:109718400-109718422 GTGAGGGATGGGAAGGCAGAGGG - Intronic
1102347624 12:112169783-112169805 CTGAGGGCAGAGAAGGCACAGGG - Intronic
1102732923 12:115129906-115129928 TTGAGAGAAGAGAACACAGAAGG - Intergenic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1102793713 12:115670567-115670589 CTGAGGGAGGAAGAGGCAGAGGG - Intergenic
1102905196 12:116669237-116669259 CTGAGTACAGAGAAAGCAAAGGG + Intergenic
1103242483 12:119425928-119425950 CTGAGTGAAGGAAAGGCAAAGGG + Intronic
1103401127 12:120643430-120643452 CAGAACCAAGAGAAGGCAGATGG + Intronic
1104761045 12:131297715-131297737 CTGAGAAAAGAGAAGACACAGGG + Intergenic
1104818733 12:131663077-131663099 CTGAGAAAAGAGAAGACACAGGG - Intergenic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1104933929 12:132354614-132354636 CTGAGTGACGAGGATTCAGAGGG + Intergenic
1105203559 13:18200271-18200293 CTCAGTGAAGAAAGGGCAAAGGG - Intergenic
1105948804 13:25211809-25211831 CTCAGAGAAGAGCAGGAAGAGGG - Intergenic
1106763779 13:32893658-32893680 GTGAGAGAAGGGAAGGCTGAAGG - Intergenic
1107474051 13:40717776-40717798 CTCATGGAACAGAAGGCAGAAGG - Intergenic
1107879166 13:44817917-44817939 CTGAGTGAAGTGAGTGGAGAGGG + Intergenic
1107930489 13:45303032-45303054 CTGTGTAAAGAGAAGTCAGGGGG + Intergenic
1108851395 13:54736095-54736117 GTGAGGGAAGGGAAGGGAGAGGG - Intergenic
1108863718 13:54896016-54896038 CTGAGTGAAGAGGAGAGTGACGG - Intergenic
1110871821 13:80461397-80461419 CTGAGAGACAGGAAGGCAGAAGG - Intergenic
1111194699 13:84858604-84858626 CTTTGTGAAGCCAAGGCAGATGG - Intergenic
1112157453 13:96833199-96833221 CTGAGAGAGGAGAGGGCAGGAGG - Exonic
1112375254 13:98833810-98833832 CTATGTGATGAGAAGGCAGCAGG - Intronic
1112877341 13:104059976-104059998 CAGAGTGAAGAGATGGGAAAAGG + Intergenic
1114989488 14:28269720-28269742 CTAAGTGAAGAGAAGAAAGCAGG + Intergenic
1115929384 14:38473748-38473770 CTGTGGGAAGCCAAGGCAGAAGG + Intergenic
1116060035 14:39911875-39911897 CTGAGAGGAGAGAAGAGAGAGGG - Intergenic
1116070918 14:40044528-40044550 TTTTGTGAACAGAAGGCAGATGG - Intergenic
1117460354 14:55939102-55939124 CAGAGTGGGGAGAAGGCAGTAGG + Intergenic
1117810122 14:59536673-59536695 CTTAGGGAAGAGATGTCAGAAGG - Intronic
1118401250 14:65381574-65381596 CTGAGAGCAAAGAAGGTAGAAGG - Intergenic
1118451001 14:65902044-65902066 CTTGGTGAGGAGGAGGCAGAGGG + Intergenic
1118925026 14:70184383-70184405 TTGAGTGTGGAGAAGGCATAGGG - Intronic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119754470 14:77105299-77105321 GGGAGTGAAGAGAAGGGAAAAGG - Intronic
1121903830 14:97721672-97721694 GTGAGTGAAGATTAAGCAGAAGG + Intergenic
1122441788 14:101737033-101737055 CAGAGAAAATAGAAGGCAGAAGG - Intergenic
1122674088 14:103396007-103396029 CTGAGTCGGGAGAGGGCAGAAGG + Intronic
1122958785 14:105085088-105085110 CTGTGGGAAGTGAAGGCAGAGGG - Intergenic
1124247015 15:28079704-28079726 CTGAGTGTGGAGATGCCAGAAGG - Intronic
1124435607 15:29646533-29646555 CAGGTAGAAGAGAAGGCAGAAGG - Intergenic
1125451714 15:39815180-39815202 CTGTGTGTAGAGGAGACAGAAGG + Intronic
1125786263 15:42320994-42321016 CTGAGTAAAGAGAAGAAAAAAGG - Intronic
1125972842 15:43926099-43926121 CTGAATGAATAGAAGGGAAAAGG + Intronic
1127300760 15:57651376-57651398 ATGATTCAAGAGGAGGCAGATGG - Intronic
1127309972 15:57743896-57743918 CTCAGGGAAGAGCAGGGAGAAGG - Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128154285 15:65383073-65383095 CTGAGTGAAGAGGAGGCAGGAGG + Exonic
1128182201 15:65613829-65613851 GTAAGTGAAGAAAAGGCTGAGGG + Intronic
1128819561 15:70639609-70639631 CTGATTGAAGACAAGGCTGTAGG + Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1130278488 15:82497704-82497726 CTTTGTGAAGTGGAGGCAGAAGG + Intergenic
1130717676 15:86351788-86351810 CAGCTTGTAGAGAAGGCAGAAGG - Intronic
1131348989 15:91679359-91679381 CTGGATGAAGATAAGGCAAATGG - Intergenic
1132037188 15:98494189-98494211 CAGAGTGGTGAGAAGGCAGGAGG + Intronic
1132117972 15:99151387-99151409 CTGAGAAAAGAAAAGGCACAGGG + Intronic
1132497232 16:269614-269636 CTGAGAGGTGAGGAGGCAGAAGG - Intronic
1132549737 16:549449-549471 CTGTGAGAAGAGGAGGCAGCCGG - Exonic
1133226873 16:4344957-4344979 CTGGCAGGAGAGAAGGCAGAAGG + Intronic
1133489396 16:6252217-6252239 TTGAGAGAAGAAATGGCAGAAGG - Intronic
1133921417 16:10156631-10156653 CTGAGTGCATAGGAGGCAGAAGG + Intronic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1134540557 16:15061195-15061217 GGGAGTGTAGAGAAGACAGAAGG - Exonic
1135245482 16:20853183-20853205 CTGAGTCAAGAGACGGGACAAGG + Intronic
1136687107 16:32002095-32002117 CTGACTGCAGAGAAGACAAAAGG - Intergenic
1136787719 16:32945646-32945668 CTGACTGCAGAGAAGACAAAAGG - Intergenic
1136882062 16:33908143-33908165 CTGACTGCAGAGAAGACAAAAGG + Intergenic
1137587741 16:49674089-49674111 CTGAGTGAAAAATAGGCAGGTGG + Intronic
1139198264 16:64946535-64946557 GTGTGTGAAGAGAAGCCAGGAGG + Exonic
1139239567 16:65377258-65377280 TTGAGTGAATAGAAGGGTGATGG + Intergenic
1139821475 16:69724758-69724780 AAGTGAGAAGAGAAGGCAGAAGG - Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1141746236 16:85928458-85928480 CGGAGAGCAGAGAAGCCAGAAGG - Intergenic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1203089948 16_KI270728v1_random:1207303-1207325 CTGACTGCAGAGAAGACAAAAGG - Intergenic
1142908484 17:3066089-3066111 CTTTGGGAAGACAAGGCAGAAGG - Intergenic
1142926081 17:3238155-3238177 CTTTGGGAAGACAAGGCAGAAGG + Intergenic
1143281332 17:5756764-5756786 CTGACACTAGAGAAGGCAGAGGG + Intergenic
1143322882 17:6079509-6079531 CCCAGAGAAGAGAAGGCAGAAGG - Intronic
1144051398 17:11500106-11500128 TGGAGTGAAGAGAATTCAGACGG + Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1144135246 17:12289132-12289154 CCGAGAGAAGGGAAGTCAGAAGG + Intergenic
1144166842 17:12620461-12620483 CTGAGAGGAGAGAAGGCAGGGGG - Intergenic
1144288178 17:13799796-13799818 CTGAGGCAAGAGATGGCAAAGGG - Intergenic
1144785932 17:17831577-17831599 ATGAGTGCAGAAGAGGCAGACGG - Intronic
1146443381 17:32916562-32916584 CTCAGGGAAAAGAAGGCTGAGGG - Intergenic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1147148074 17:38497766-38497788 CTGACTGCAGAGAAGACAAAAGG - Exonic
1147390614 17:40106980-40107002 CTGAGTGGAAAGAAGGAACAAGG + Intergenic
1147573706 17:41586871-41586893 CTGAGTGAAGAGAAGGTGCTCGG + Exonic
1147886511 17:43687936-43687958 ATGAGGGAAGAGCAGGCAGGGGG + Intergenic
1148334934 17:46834726-46834748 CTGAGTTGTGAGAGGGCAGAGGG - Intronic
1148633258 17:49128404-49128426 CAGAGGGATGAGAATGCAGAGGG + Intergenic
1148653732 17:49268009-49268031 GGGAATGCAGAGAAGGCAGAAGG + Intergenic
1148895569 17:50837278-50837300 CTGAGAGAAGACCAGGCTGACGG + Intronic
1150354678 17:64473011-64473033 CTGAGAGTAGAAGAGGCAGAAGG - Intergenic
1151549330 17:74812903-74812925 TGGAGTGAAGAGAAGGCTGCTGG + Intronic
1152044719 17:77928421-77928443 CTGAATGAAGAAAAGGAAGCAGG + Intergenic
1152421353 17:80195071-80195093 CTGACTGGAGAGGAGGCAGGAGG - Intronic
1152468896 17:80480130-80480152 GGGAGTGTAGAGAAGGCAAAGGG + Intergenic
1153450251 18:5219189-5219211 CTGTGTGCACAGAAGTCAGAAGG - Intergenic
1153894746 18:9548501-9548523 CCTAATGAAGAGAAAGCAGAAGG + Intronic
1155077213 18:22369450-22369472 CTGTGGGAAGCTAAGGCAGAAGG + Intergenic
1155872720 18:31047186-31047208 CTGAGTAAAAAGAAGACTGATGG - Intergenic
1156668722 18:39440668-39440690 GTAAGTGGAGAGAAGGCAAAAGG - Intergenic
1156845131 18:41657125-41657147 CAAAGTGAAGAGATGGCAAAGGG - Intergenic
1157074472 18:44449996-44450018 CTGTGGGAACAGAAAGCAGAAGG - Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157565689 18:48677653-48677675 TTGAGTGATGAGGAGGCATATGG - Intronic
1157729055 18:49988158-49988180 TTGGGTGAAGAGGAGGAAGAAGG + Intronic
1157948076 18:52003633-52003655 CTGAGGGAGGAGAAGCCAGAAGG - Intergenic
1158227106 18:55212901-55212923 CTGAGTGAAGAGAAGGCCAGAGG - Intergenic
1158391051 18:57045162-57045184 ATGGGTGGAGGGAAGGCAGATGG + Intergenic
1158413662 18:57230862-57230884 CAGTATGAAGTGAAGGCAGAGGG - Intergenic
1158543460 18:58376893-58376915 CAGATGGAAGAGAAAGCAGAGGG - Intronic
1159137492 18:64353074-64353096 TTGAGTGAAGTGGAGGTAGAGGG + Intergenic
1159548570 18:69871195-69871217 CTGGGGGCAGAGATGGCAGAGGG - Intronic
1159591472 18:70339616-70339638 CTGATGGAAGAGAAGCCAGAAGG + Intronic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1159925589 18:74266256-74266278 CTGAGTAGAGAGAAGCCACATGG + Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1160899904 19:1422424-1422446 CTGAGGGAGGAGCAGGGAGAAGG - Intronic
1161093659 19:2376320-2376342 CTGAGTGAAGGGCATGGAGATGG - Intergenic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1162924993 19:13926431-13926453 CTGGGGGAAGAGAAGGCAGGCGG + Intronic
1163730461 19:18946441-18946463 GGGAATGAAGAGAAGGAAGAGGG - Intergenic
1164465397 19:28483339-28483361 CAGAGGGAAGAGAAAGGAGAAGG - Intergenic
1164484949 19:28647344-28647366 CTTTGTGAGGAGAAGGCAGGAGG - Intergenic
1164512005 19:28905078-28905100 CTGAGTGAGGAGCAGGGAGCTGG - Intergenic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1165101586 19:33441580-33441602 CTGAGTGAAGGGAAGGAACAGGG - Intronic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165356113 19:35305158-35305180 CTGGGTGAAGAGTAGGGAGCTGG - Intronic
1165792018 19:38498337-38498359 CAGATTGAGGGGAAGGCAGAAGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165920400 19:39294154-39294176 CTGCCTGGAGAGAAGGCAGGCGG - Intergenic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166385446 19:42378093-42378115 CTGAGTGAAGAGATGTCTGAAGG - Intronic
1166866869 19:45843985-45844007 GCCAGTGAAGAGAAGGCAGGGGG + Intronic
1166887118 19:45968491-45968513 CTAAGTGAAAGAAAGGCAGATGG + Intronic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1167953432 19:53045813-53045835 CTGAGTGAAGCAAACGCAGCAGG - Intronic
925210190 2:2038846-2038868 CTGAGTTCAGAGAAGGGTGAGGG - Intronic
925425271 2:3744192-3744214 ATGAGAGAGGAGAAGGCAGATGG + Intronic
925660531 2:6197611-6197633 ATGAATGAAGTGAAGGCAAAGGG - Intergenic
926610235 2:14939525-14939547 CAGAATGCAGAGAAGTCAGAAGG - Intergenic
926610244 2:14939596-14939618 CAGAATGCAGAGAAGTCAGAAGG - Intergenic
926961117 2:18359493-18359515 CTCAGAGAAGACAAGGGAGATGG - Intronic
927010002 2:18893560-18893582 CAGAGTGAAGACAAGGCATGAGG + Intergenic
927375271 2:22405939-22405961 CTGAGGGAAGAGAAGCAATAGGG - Intergenic
927709158 2:25314434-25314456 GTGAATGAAGAGAAGGGAGGAGG - Intronic
927894010 2:26769794-26769816 CTCAGTGAAGGGAAAGGAGAAGG + Intronic
927990057 2:27441655-27441677 CTGAGAGAAGAGAAGGCATGGGG - Intronic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928019970 2:27696632-27696654 CTGGCTGAAGTGAAGGCAAAGGG + Intergenic
928101390 2:28439567-28439589 CGGACTGAGGAGGAGGCAGAGGG + Intergenic
928423833 2:31161572-31161594 CTTAGTGCAGAGAAGCCTGAGGG + Intergenic
928460240 2:31465735-31465757 ATCAGTGGAGAGTAGGCAGAGGG + Intergenic
929026930 2:37614029-37614051 CTGAATGAAGCTGAGGCAGAGGG + Intergenic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929440868 2:41965099-41965121 AGGAGTGAAGGGAAGGCAAATGG - Intergenic
929607115 2:43242019-43242041 CTAAGTGAAAAGGAGGAAGAAGG - Intronic
929848240 2:45555445-45555467 CTGAGTGAAGAGATGGGAGGAGG - Intronic
930262955 2:49168950-49168972 CTGAGTGAAGACAAGTTGGAGGG - Intergenic
930406930 2:50970276-50970298 CTGAGAGAAAAGAGGGCAGGAGG + Intronic
931151822 2:59582908-59582930 CTTAGTTAAGAGAAAGCATATGG - Intergenic
932050753 2:68395657-68395679 CTGGGGAAAGAGAAGGCAAATGG - Intronic
932056270 2:68447368-68447390 CTGGTTGAAGGGAAGCCAGACGG - Intergenic
932140519 2:69273382-69273404 CTGAGAGAAGAGAGGCCAGTTGG + Intergenic
932219223 2:69987147-69987169 CTGAGTGAGGGGAAGGCATTGGG + Intergenic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
934114652 2:88775739-88775761 GTGAATGAAGAGATGGCAGGAGG + Intergenic
934496035 2:94800239-94800261 CTGAGTGAAGAGAAAACCGGTGG + Intergenic
934631981 2:95936116-95936138 GTGAATGAAGAGATGGCAGGAGG - Intronic
934685312 2:96316888-96316910 CTGAAGGAAGACAAGTCAGAAGG - Intergenic
934761607 2:96859883-96859905 GTGAGGGGAGAGAAGGGAGAGGG - Exonic
934801521 2:97167083-97167105 GTGAATGAAGAGATGGCAGGAGG + Intronic
935729272 2:106051661-106051683 CAGAGAGAAGAGAAAGCAGGTGG + Intergenic
935801737 2:106704004-106704026 CTCACTGAAGAGAAGACAGTTGG + Intergenic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936073949 2:109389909-109389931 CAGATTCAGGAGAAGGCAGATGG - Intronic
937069705 2:119053809-119053831 CTGAGTCAAGCGAATGCAGGCGG - Intergenic
937890659 2:126936158-126936180 ATGAGAGAAGGGAAGACAGACGG + Intergenic
937899802 2:127011247-127011269 CCTAGTGCAGAGAAGGCAGGGGG - Intergenic
938247998 2:129793843-129793865 CTGAGTGTAAAGAAGGCTGGGGG - Intergenic
938563329 2:132494404-132494426 CTGAATGATGAGAAAACAGAAGG - Intronic
939125856 2:138176812-138176834 CTGAGTGAAGGGGAGAGAGAAGG + Intergenic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
939257517 2:139763807-139763829 TGGAATGAAGAGCAGGCAGAAGG + Intergenic
939394612 2:141612735-141612757 CTGAGTGATGCGAAGGCGAAAGG - Intronic
940051394 2:149468812-149468834 ATGTCTGAAGAGAAGGCAGCTGG - Intronic
940865634 2:158815158-158815180 CCCAGTGAAGAGAAGGCTGAGGG - Intronic
941712654 2:168730430-168730452 CTGAGTGAAGCAAAGAGAGAGGG + Intronic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
943423122 2:187695056-187695078 CAGAGTGAAGAGAAAACATATGG - Intergenic
943522876 2:188975854-188975876 ATGAGTGAAGAGAAGTCTAAAGG - Intronic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944572432 2:201058205-201058227 CTGTGTGAAGAGGAAGGAGAGGG - Intronic
945312799 2:208334434-208334456 ATGAGTGAAGAGAGAGCAGTAGG - Intronic
946001791 2:216488565-216488587 CTGAGTGAATAGCAGACAGGTGG - Intergenic
946026566 2:216675247-216675269 CTGAAGTAAGAGATGGCAGAGGG - Exonic
946153150 2:217789673-217789695 CAGAGAGGAGGGAAGGCAGAGGG + Intergenic
946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG + Intronic
946717097 2:222564068-222564090 GTGCGTGCAGAGATGGCAGACGG - Intergenic
947175557 2:227363484-227363506 CTGTGTGTAGAGAAAGGAGAAGG - Exonic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948687438 2:239677847-239677869 CTGAGAGCACAGAAGGCAGTGGG - Intergenic
1169232590 20:3901573-3901595 AAGAGGGAAGAGAAGGGAGAAGG - Intronic
1169477156 20:5941951-5941973 CTGAGTGAAAGAAACGCAGATGG - Exonic
1169742972 20:8915330-8915352 ATGAGAGACGAGAAAGCAGAGGG - Intronic
1170084268 20:12511723-12511745 CTGAGTGAAGAGAAGTAATGAGG - Intergenic
1170377808 20:15720449-15720471 ATTAGTGCAGAGAAGGCAGAAGG - Intronic
1170397691 20:15945910-15945932 GTGTGTCTAGAGAAGGCAGAGGG + Intronic
1170686736 20:18576155-18576177 CTGAGTGAAGTGCAGGAAGTTGG + Intronic
1170917167 20:20638451-20638473 TCGACAGAAGAGAAGGCAGAAGG + Intronic
1172241005 20:33412457-33412479 GTGGGGGAAGAGAGGGCAGAGGG + Intronic
1172876292 20:38166311-38166333 GGGAGGGAAGAGAAGGCCGAGGG - Intronic
1172962488 20:38808283-38808305 CTGGTTTAGGAGAAGGCAGAAGG + Intronic
1173283116 20:41646956-41646978 ATTACAGAAGAGAAGGCAGAAGG + Intergenic
1173546555 20:43902497-43902519 AAGAGTGAAGGGAAGGCAGAAGG - Intergenic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173607400 20:44341323-44341345 CTGAGTGAAGGAAGGGCAGAGGG - Intronic
1173613429 20:44387590-44387612 CTGAGTGAAGAGTAGGGGGTAGG + Intronic
1174684981 20:52446037-52446059 ATGAGGGAAAAGAAGGCAGGAGG + Intergenic
1175533808 20:59693286-59693308 CAAAGAGAAGAGAAGGGAGATGG - Intronic
1175605922 20:60312147-60312169 CTGAAAGAAGACAGGGCAGAGGG - Intergenic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1176714411 21:10337806-10337828 CTCAGTGAAGAAAGGGCAAAGGG + Intergenic
1179003636 21:37487985-37488007 AAGAGTGAGGAGAAGGCAGGAGG - Intronic
1180222575 21:46368610-46368632 CTGAGGGCAGAGAAAGCACAAGG - Intronic
1180226805 21:46398369-46398391 CTCAGACAAGAGAAAGCAGATGG - Intronic
1181588276 22:23866493-23866515 GTGAGTGAAGGGAAGCCACATGG - Intronic
1181744326 22:24945301-24945323 CTGGGTGGAGAACAGGCAGAAGG + Intronic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182452212 22:30428395-30428417 ATGAGGGAACAGAAGGCAGAAGG - Intronic
1182574935 22:31266648-31266670 CTGAGTGAACAGAAGTCTGGGGG - Intronic
1183023058 22:35042948-35042970 CAGACTGAAGAGAAAGAAGAAGG + Intergenic
1183218468 22:36496526-36496548 GGGAGTGAACAGCAGGCAGAGGG + Intronic
1183283525 22:36947621-36947643 CTGAGTGACGAGATGGGAGGAGG - Intergenic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183749640 22:39712545-39712567 CTGGGTGCAGAGGATGCAGAAGG + Intergenic
1184056182 22:42051593-42051615 GTGAGTGAAGAGAGGGTATATGG + Intronic
1184097556 22:42324871-42324893 CTGAGGGAATACAAGGCACATGG + Intronic
1184212519 22:43044188-43044210 CTAGGTACAGAGAAGGCAGAGGG - Intronic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1184520365 22:44990238-44990260 CTCAGTGGAGAGAAGCCTGAAGG - Intronic
1185094055 22:48796405-48796427 AGGCATGAAGAGAAGGCAGATGG - Intronic
1185294310 22:50045833-50045855 GTAAGTGAGGAGACGGCAGAGGG - Intronic
949181363 3:1135360-1135382 TTGATGGAAGAGAAGGCAAAAGG + Intronic
949981109 3:9502140-9502162 TGGAGTGACGAGAGGGCAGAAGG + Exonic
950104516 3:10379674-10379696 CTGGGTTGAGAGAAGGCAAAGGG + Intronic
950125705 3:10508647-10508669 CTGCAGGAAGAGAAGGCAAAGGG - Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
951575814 3:24112709-24112731 CTGAGTTCAGAGAAGGCAAGAGG - Intergenic
951746434 3:25982801-25982823 CTGTGTTCAGAAAAGGCAGATGG - Intergenic
952162527 3:30708433-30708455 CTGAGAGATAGGAAGGCAGAAGG - Intergenic
952253845 3:31678906-31678928 CTGAGTGAAGAATAGACTGAAGG - Intronic
952405532 3:33001453-33001475 CTGAGTGATGAGAAGGCTTCAGG - Intronic
952887818 3:38022302-38022324 CTGAGACAAGAGGAGGCAGAAGG + Intronic
953178471 3:40574145-40574167 CTGAGTCAGGAATAGGCAGAGGG + Intronic
953919308 3:46941010-46941032 CTCAGAGAAGAGGAGGAAGAAGG - Exonic
954477073 3:50757094-50757116 CTTTGTGAAGCCAAGGCAGATGG - Intronic
954747408 3:52794975-52794997 TGGAGTGAAGAGGAGGCAGAGGG + Intronic
955407035 3:58632083-58632105 CTCATTGAAGAGAAGACACATGG - Intergenic
956013741 3:64859130-64859152 CTGAGGGATGAGAGGGCAAAGGG + Intergenic
956637467 3:71380507-71380529 CAGAGTGAAAAGAAAGCAAAGGG - Intronic
956763632 3:72465371-72465393 GTGAGAGAAGAGAAGGCAAAGGG + Intergenic
958678119 3:97292968-97292990 CTCAGTGAAGAGAAGACCCATGG + Intronic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
961281331 3:125767318-125767340 GAGAGTTGAGAGAAGGCAGATGG + Intergenic
961478146 3:127161382-127161404 CTGAGTGGAGAGCAGACAGAAGG - Intergenic
961523784 3:127483817-127483839 CTGAGTCAAGAGGAGGGAGGAGG + Intergenic
961822287 3:129581168-129581190 CTGTGTGAACAGCAGGCAGCAGG - Intronic
962202863 3:133415035-133415057 AGGAGTGAATAGAAGGGAGAGGG - Intronic
962203108 3:133415990-133416012 CGGGGTGAATAGAAGGGAGAGGG - Intronic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962859295 3:139383929-139383951 CTGACTTAACAGAAGACAGATGG + Intronic
963052900 3:141157789-141157811 CTGAGCCAACAGAGGGCAGAAGG + Intergenic
963285614 3:143431787-143431809 CTGAGTTTAGAGAAGTAAGAGGG - Intronic
963972545 3:151445532-151445554 CTGAGTAAAGGGAGGGGAGATGG + Exonic
963979806 3:151524882-151524904 ATGATGGAAGAGAAGGAAGAAGG - Intergenic
964547159 3:157847091-157847113 CAGAATGGAGGGAAGGCAGAAGG - Intergenic
965885690 3:173444442-173444464 CTGGGAGAAAAGATGGCAGAAGG - Intronic
966406035 3:179599347-179599369 TGGAGAGTAGAGAAGGCAGATGG + Intronic
967419839 3:189260782-189260804 CTAAGTCAACAGGAGGCAGATGG - Intronic
967868110 3:194206812-194206834 CTGACTGGAAAGAAGGCACAAGG - Intergenic
967953951 3:194862871-194862893 CTGGGAGAGGAGGAGGCAGAGGG - Intergenic
968121333 3:196128084-196128106 CTAAGTGATGAGAAAGCAGCAGG + Intergenic
969510551 4:7615130-7615152 ATGAGTGAATGGATGGCAGATGG - Intronic
970955393 4:21805063-21805085 CAGAGGGCTGAGAAGGCAGAAGG + Intronic
971633867 4:29031562-29031584 CTGGGTGAAGAGACTGCAAAGGG + Intergenic
971730484 4:30372675-30372697 CTACCTGAAGAAAAGGCAGAAGG + Intergenic
972144533 4:36006105-36006127 CTGACAGATGAGAAGGGAGAAGG + Intronic
972296233 4:37741742-37741764 CTGAGTGAAGGAAAGGCTGAAGG + Intergenic
973157750 4:46978240-46978262 ATGAGTGAGAAGGAGGCAGAAGG + Intronic
973213516 4:47642755-47642777 AAGAGTGTAGGGAAGGCAGAGGG + Intronic
973247589 4:48025926-48025948 CTGAATGAAGGGCAGGGAGAAGG - Intronic
974044913 4:56890570-56890592 CTGAGGCAAGAGAACCCAGAAGG + Intergenic
974243149 4:59278668-59278690 CTGAGTAAAAAGAAGACAGCTGG + Intergenic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
978820068 4:112956837-112956859 CTGAATGAAGAGAATGAAGTGGG + Intronic
979778906 4:124624807-124624829 ATGAGAGAAGAGAAGGGAGGAGG - Intergenic
980424508 4:132608800-132608822 CTGAGTGAAGAAAAGTGGGAGGG + Intergenic
981265367 4:142777029-142777051 ATGAGTGTAAAGAAGGCAGCAGG - Intronic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982100439 4:151962031-151962053 AAGAAGGAAGAGAAGGCAGAAGG - Intergenic
982165896 4:152613495-152613517 ATGAGTGAAAAGAAGGCTGTTGG + Intergenic
983656326 4:170089142-170089164 GTGACCAAAGAGAAGGCAGAGGG + Intronic
984719793 4:182958982-182959004 CTTAGGGAAGAGAAGGGAAAGGG + Intergenic
985325667 4:188766174-188766196 CTTAGTGAGGAGAAGTCATAGGG + Intergenic
986171803 5:5320451-5320473 CTGAGTGAAGAGGAGGCTGCAGG + Intergenic
986265347 5:6185675-6185697 CTACCTGAAGAGAAGGCATAAGG + Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986974061 5:13374992-13375014 CCCAGAGAAGAGGAGGCAGAAGG + Intergenic
987072358 5:14350551-14350573 CTGAGTACAGATAAGGCACAGGG - Intronic
987869676 5:23599359-23599381 CTGAGAGAAGAGAACTTAGAGGG - Intergenic
988553587 5:32217912-32217934 CTGAGTGAAAAGTAGACAGCAGG + Intergenic
989256859 5:39375639-39375661 CTGAGGGAGGCCAAGGCAGATGG + Intronic
990498962 5:56376089-56376111 GTGAGTGAAGAGAAGTGAGAGGG + Intergenic
992341071 5:75823945-75823967 CTGTGGGAGGAGGAGGCAGAAGG + Intergenic
992445927 5:76833438-76833460 CTCAGAGAAGAAAAGGAAGAGGG + Exonic
992877870 5:81075668-81075690 TTGAGTGAAGAACAGGCTGAGGG + Intronic
992998266 5:82354021-82354043 CAGAGTAAAGAAAATGCAGAAGG - Intronic
993107465 5:83615397-83615419 ATGAGAGAAGAGAAGGGAAAGGG + Intergenic
993227034 5:85180790-85180812 CTGAGGAATGAAAAGGCAGAAGG + Intergenic
993677959 5:90840156-90840178 GAGAGTAGAGAGAAGGCAGAGGG - Intronic
994453964 5:99981688-99981710 CTTTGTGAAGACAAGGCAGGTGG + Intergenic
995565599 5:113430787-113430809 CAGCGTGAAGAGACTGCAGATGG + Intronic
995629588 5:114118834-114118856 CTGAGTGAGGAAAAGTGAGAAGG - Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
995908927 5:117162001-117162023 CTGAGGTAAGAAAAGGCATACGG - Intergenic
995937892 5:117539712-117539734 ATCAGTGGAGAGAAAGCAGAAGG + Intergenic
996001476 5:118369239-118369261 AGGAGAGAGGAGAAGGCAGAAGG - Intergenic
996309164 5:122083505-122083527 CTGAGTTAAGTTAAAGCAGAGGG - Intergenic
996343454 5:122464256-122464278 CTGAGATTTGAGAAGGCAGAAGG - Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996836702 5:127801600-127801622 TTGAATGAAGAGAAGAGAGAAGG - Intergenic
997177610 5:131796328-131796350 CTGAGTTGAGAGAAGGCTGGAGG - Intronic
997417531 5:133740549-133740571 CTGTCAGAAGAGAATGCAGATGG - Intergenic
998186154 5:139981496-139981518 CTGTGTTAAGAGAAGGGAAACGG - Intronic
998268470 5:140684930-140684952 CTGACTGAATAGAAGACAGCAGG + Intronic
998406797 5:141878620-141878642 GGCAGTGAAGAGATGGCAGAGGG - Intronic
999326509 5:150647575-150647597 GTGAGAGAGGAGAAGGCAGTGGG + Intronic
999442699 5:151614976-151614998 AGGAGTCAAGAGAAGGCAGGTGG - Intergenic
999620423 5:153467207-153467229 GTGAGTGAAGATGAGGGAGAAGG - Intergenic
999925024 5:156366178-156366200 CTGTGTGAAGAGAGGGCATGTGG + Intronic
1000154848 5:158540261-158540283 GTGAGTGAAGAGAAGGGAATGGG - Intergenic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001085025 5:168694215-168694237 CTGAATTTAGAGCAGGCAGATGG - Intronic
1001806504 5:174591313-174591335 CGGAGAGGAGAGAAGGCAGGTGG - Intergenic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1002456141 5:179346104-179346126 CGGAGGGATGGGAAGGCAGATGG - Intergenic
1002581221 5:180210419-180210441 CAGAGTGAGGTGAAGGCAGCTGG - Intergenic
1002606381 5:180385296-180385318 CGGAGTGGAGAGAAGGCGGTGGG + Intergenic
1002650730 5:180691250-180691272 CTGAGATAAGACAAGGTAGAAGG + Intergenic
1002951174 6:1812751-1812773 CTCATTGAAGAGGAGGTAGATGG + Intronic
1004271419 6:14199501-14199523 CTGGGTGAAGAGGAGAGAGAAGG + Intergenic
1004311421 6:14549283-14549305 CTGAATGAAGACAAGGAACAGGG + Intergenic
1005375200 6:25174841-25174863 CTGCGTGAAGAGAAGCCTGTGGG + Intergenic
1006654892 6:35582471-35582493 GTGAGTGGAGAGAGGGCAGAGGG - Intronic
1007761264 6:44134994-44135016 CTGAGGGAAGAGGGGGCAGTTGG - Intronic
1009483115 6:64185471-64185493 CTGATTACAGAAAAGGCAGATGG - Intronic
1009957018 6:70467971-70467993 ATGAGTGAAAGGAAGGCTGATGG + Intronic
1010914021 6:81593604-81593626 GTGAGTGAAGAATAGCCAGAAGG + Intronic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011339274 6:86294755-86294777 CTGTGTGTAGAGAAGTCAGAAGG - Intergenic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1012447984 6:99326288-99326310 CTGGGTGAGGCAAAGGCAGAAGG + Intronic
1013465662 6:110415122-110415144 CTGAGGGAAGAGAAGGGAACGGG + Intronic
1013844296 6:114430868-114430890 CTGTGTCAAGACATGGCAGAAGG - Intergenic
1013952518 6:115801547-115801569 CTAAGTAAATAGAAGGCAAATGG + Intergenic
1013990829 6:116252659-116252681 CAGTATGAAGAGAAAGCAGATGG + Exonic
1014192512 6:118514180-118514202 CTAATTCAAGAGAAGGCAAAGGG + Intronic
1014978620 6:127920247-127920269 TTGAGTGCACAGAAGACAGAGGG + Intergenic
1015026522 6:128539605-128539627 CTGATGGAACAGAAGGCAGTTGG + Intergenic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1015671330 6:135693257-135693279 CCTGGAGAAGAGAAGGCAGAAGG + Intergenic
1015847167 6:137532653-137532675 CTTTGTGGAGGGAAGGCAGAGGG - Intergenic
1016001297 6:139044065-139044087 ATGACTGAAGGAAAGGCAGAAGG + Intergenic
1016279494 6:142399150-142399172 CTGAGTGTAGAGAAGGCGAAGGG - Intronic
1016784306 6:147993271-147993293 GGGAGTAAAGAGAAGGGAGAGGG + Intergenic
1016892041 6:149016475-149016497 GTGAGTGAATAAATGGCAGAAGG - Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1019477462 7:1250951-1250973 CAGAGTGAAGTGAAGTCAGGGGG - Intergenic
1020133785 7:5574683-5574705 CTAAGGGAAGAGAAGGAAGGAGG + Intergenic
1020861408 7:13496524-13496546 GTGAGTGATGGAAAGGCAGATGG - Intergenic
1021131386 7:16916585-16916607 CTGAGCCAAGAAAAGGGAGAAGG + Intergenic
1021853653 7:24832759-24832781 CAGAGCGAAGGGGAGGCAGAAGG + Intronic
1022749105 7:33204596-33204618 CTGAATGAAGAGTAGGAGGAAGG - Intronic
1022953753 7:35362992-35363014 CTTAGTGAACAGAAGACAAAAGG - Intergenic
1023639431 7:42242581-42242603 CTAAGGGAAGAGAAGTCAGTGGG - Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024210902 7:47202710-47202732 CTGAGTGAAAAGCAGGGAAATGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024587441 7:50854224-50854246 TTGAGAGAAGAAAAGGAAGATGG + Intergenic
1024799504 7:53059715-53059737 CTCAGTAAGGAAAAGGCAGAGGG - Intergenic
1024810665 7:53207631-53207653 CTGGGATAAGAGATGGCAGATGG + Intergenic
1025010638 7:55394820-55394842 CTGAGTGCAGAGCGGGCAGGCGG + Intronic
1025607233 7:63048033-63048055 CTGAGTTGAGAGGAGGCACAGGG - Intergenic
1026600925 7:71776658-71776680 CTGAGAGCAGAGAAGAAAGATGG + Intergenic
1026907813 7:74072793-74072815 CTGAGTGGAGAGAAGGCCGAAGG - Intergenic
1027219511 7:76204956-76204978 CTGAGTGAGGAGAAAGGAGCTGG - Intronic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028118475 7:87028984-87029006 CTGAGTGAAGAGGAGACATCTGG - Intronic
1028471616 7:91212458-91212480 CCGAGTAAAGAGAAACCAGAGGG + Intergenic
1028882526 7:95896001-95896023 CTGAGAGAAGAGCCGGCAGAAGG + Intronic
1029475096 7:100778614-100778636 CTGAGAGAAGACGAGGCCGATGG + Intronic
1029536365 7:101160115-101160137 CAGAGTGGGGAAAAGGCAGAGGG - Intronic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1031027560 7:116696660-116696682 ATGAAAGAAGAGAAGGCAAATGG - Intronic
1031490144 7:122377375-122377397 AAGAGTACAGAGAAGGCAGATGG - Intronic
1031881704 7:127205800-127205822 CTGGGTGAAGAGAAAGGTGAAGG - Intronic
1032015664 7:128379037-128379059 CAGAGCGAAGGGAAGGCAGAGGG + Intergenic
1032465938 7:132145096-132145118 GTGAGTGAAGGGAGGGCAGGGGG - Intronic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033207694 7:139436916-139436938 CCGAGTGAAGTGAGGGCAGCAGG - Intergenic
1033237880 7:139652772-139652794 CAGAGTTGAGAGAAGGGAGAGGG + Intronic
1033347964 7:140540214-140540236 GTGGGAGAAGAGAAGGCAGCAGG - Intronic
1033568441 7:142602398-142602420 CTGGGAGAAGAGCAGCCAGAGGG - Intergenic
1034090173 7:148356748-148356770 CTGACTGAGGTGATGGCAGAAGG - Intronic
1034754315 7:153600715-153600737 CACAGGGAAGAGAAGGCTGAAGG + Intergenic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1036174825 8:6527406-6527428 ATGAGGGAGGAGAAGGGAGAGGG - Intronic
1036242704 8:7092844-7092866 CAGAGTTGAGAGGAGGCAGATGG + Intergenic
1036706471 8:11050749-11050771 ATGAGGGAAGAACAGGCAGAGGG - Intronic
1036777698 8:11624993-11625015 CTGAGTTGAGAGGAGGCACAAGG + Intergenic
1036899111 8:12658594-12658616 CAGAGTTGAGAGGAGGCAGATGG - Intergenic
1036921181 8:12856805-12856827 CATATTGAAGAGAAGGCACAGGG - Intergenic
1037036217 8:14170576-14170598 CTAAGAGAAGTGAATGCAGATGG + Intronic
1037422451 8:18717750-18717772 CTGTATGGAGAGAAGGCAAAGGG - Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1038428569 8:27481508-27481530 CTGAGTCAAGATTAGGCAGAGGG + Intergenic
1039390847 8:37179830-37179852 AGGAGGGAAGAGAAGCCAGAGGG - Intergenic
1039574530 8:38612727-38612749 TTCAGTGAAAAGAAGGCAGAAGG + Intergenic
1039577175 8:38632910-38632932 CTGAGTGAACAGAATGGAGAAGG - Intergenic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1040345013 8:46483944-46483966 TTGAGAGAAGAAAAGGCTGAAGG - Intergenic
1040537582 8:48323329-48323351 CTGAGTGGAGACAGGGCAGAGGG + Intergenic
1040759717 8:50824732-50824754 CTCAGTGGAGAGGAGGCTGAGGG + Intergenic
1041042469 8:53861326-53861348 CTGACTCAAGAGAGGACAGAGGG - Intronic
1041726336 8:61021189-61021211 CTGAGGAAAGAGAAGGCCAAGGG + Intergenic
1041790595 8:61692608-61692630 CTGACTCATGAGAAGGCTGATGG - Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044654210 8:94530671-94530693 CTTTGTGAAGCTAAGGCAGATGG + Intronic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045659842 8:104426079-104426101 CTAAGTGAAGAGAAGTCATCTGG + Intronic
1045944340 8:107778756-107778778 CTGAGTGAAGTGTACGCAGAAGG - Intergenic
1046124862 8:109893099-109893121 TGGAGTGAGGATAAGGCAGAAGG - Intergenic
1046185023 8:110702299-110702321 GTGAGAGAACAGAAGGCATATGG - Intergenic
1046408367 8:113805060-113805082 CAGAGTGAAGAGAAGACCTAAGG - Intergenic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1046994083 8:120496254-120496276 GTGAGTGATGGGAAGGAAGAGGG + Intronic
1047693699 8:127382546-127382568 CAGAGGGAAGAAAAGGCAGTAGG + Intergenic
1047732186 8:127736816-127736838 ATGGGAGAGGAGAAGGCAGAGGG + Intronic
1048489790 8:134882016-134882038 CTGAACGAAGAGGAGGCAGCTGG + Intergenic
1049154915 8:141060496-141060518 CTGTGTGCAGAGACGACAGAGGG + Intergenic
1049703263 8:144024444-144024466 CTGAGGGAAGAGGATCCAGAGGG - Intronic
1051074227 9:13210953-13210975 TTGAGAGAAGAGAAGGAAGAAGG - Intronic
1051231746 9:14962469-14962491 CTCAGTGAAGAGAGGACAGGTGG + Intergenic
1051705068 9:19869475-19869497 GTTAGTGAAGGGAAAGCAGAAGG - Intergenic
1052856269 9:33408452-33408474 CTGAGAGAGGTGGAGGCAGAGGG - Intergenic
1053216437 9:36274480-36274502 TTAAGAGAAGAGAAGCCAGAGGG - Intronic
1053387584 9:37706910-37706932 CTGACAGAAGAACAGGCAGATGG - Intronic
1054766178 9:69044463-69044485 CTCAGAAAAGAGAAGGCAGAAGG - Intronic
1055358449 9:75462330-75462352 CTGAATTCAGAGAAGGCACAGGG + Intergenic
1055513790 9:77018366-77018388 CAGAGAGAAGAGAAGCAAGAAGG + Intergenic
1055834700 9:80425055-80425077 ATGAGTGAAGAGAACCTAGATGG - Intergenic
1055953942 9:81756592-81756614 AGGAGTGAAGGGAAAGCAGAGGG + Intergenic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1057099390 9:92343700-92343722 CTGAGGGAAGCCAAGGCAGGAGG + Intronic
1057755600 9:97832398-97832420 CTCAGAAAAGAGAAGGCATATGG - Intergenic
1058445791 9:105053776-105053798 CTGAGTGAGGAGATGGGAGGAGG - Intergenic
1058459713 9:105171798-105171820 CAGAGTGTAGAGAAAGCACAAGG + Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059452210 9:114377427-114377449 ATGACTGAAGAGGAGCCAGATGG - Exonic
1059945123 9:119401826-119401848 CTCAGTCATGAGAAGGCAGGGGG - Intergenic
1060040366 9:120295285-120295307 GAGAGTGAAGAGAAGACATAAGG + Intergenic
1060198016 9:121635725-121635747 CTGGGTGAAGACAAGACAGTGGG + Intronic
1060217489 9:121747010-121747032 CTGAGTGGAGAGATGGGGGAGGG + Intronic
1060244114 9:121929658-121929680 CTGAGTGCAGAGATGACACAAGG + Intronic
1060496536 9:124123384-124123406 CAGAGGCCAGAGAAGGCAGATGG + Intergenic
1060672705 9:125484096-125484118 CTGAGTTAAGAACAGGCAGGTGG + Intronic
1060763556 9:126276097-126276119 ATGGGAGAAGAGAAGGCAGGTGG - Intergenic
1061216430 9:129224532-129224554 CTGAGTGAGGAGAAGGTACTAGG + Intergenic
1061845183 9:133383982-133384004 CTGGATGAAGAGAAGGCTGGAGG + Intronic
1185655867 X:1685111-1685133 AAGAAAGAAGAGAAGGCAGACGG - Intergenic
1185655956 X:1685818-1685840 AAGAAAGAAGAGAAGGCAGACGG + Intergenic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186416485 X:9387423-9387445 CTGAGAGAAGAGAAGGGAACGGG + Intergenic
1187832541 X:23397577-23397599 CTGAGGGAGTAAAAGGCAGAAGG - Exonic
1189988217 X:46572486-46572508 ATGAGTAATGAAAAGGCAGAGGG + Intergenic
1190915994 X:54811525-54811547 CTGACTGAAGAGATGCCAGGTGG - Intronic
1192026981 X:67464003-67464025 CTGAATGAAAATATGGCAGAAGG + Intergenic
1192051843 X:67731642-67731664 GTGAGTGAAGCCAAGTCAGATGG - Intergenic
1192053275 X:67746576-67746598 ATGATTGAGGTGAAGGCAGAAGG - Intergenic
1192150279 X:68707831-68707853 CTGAGTGACCAGAAGGTACAAGG + Intronic
1194856475 X:98935488-98935510 CTAAGTGAAGAGAAAGGAAAAGG + Intergenic
1195402062 X:104471677-104471699 TTGAGTGAAGGCAATGCAGAAGG - Intergenic
1197713470 X:129688862-129688884 CTGAGGGAAGAGCAGGAAGTAGG - Intergenic
1197917203 X:131548920-131548942 TTGAGTGAAGAAGTGGCAGAAGG - Intergenic
1198217623 X:134570271-134570293 CAGAGGGAAAAGAAGGCTGAGGG + Intronic
1198556695 X:137801205-137801227 CTGGGTAATGAGAAGGCATAGGG - Intergenic
1198621624 X:138518244-138518266 CTTAGTGAAGAGACACCAGAAGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199880491 X:151970771-151970793 AGGAGTGAGGAGCAGGCAGAGGG + Intronic
1199985618 X:152947980-152948002 ATGAGAGAAGCAAAGGCAGATGG + Intronic
1202575903 Y:26324621-26324643 CTAAGTGAAGAGAAGGGAGTGGG - Intergenic