ID: 1086345639

View in Genome Browser
Species Human (GRCh38)
Location 11:85893090-85893112
Sequence CCCTTCTCTGGCAGCTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086345639_1086345645 1 Left 1086345639 11:85893090-85893112 CCACCCAAGCTGCCAGAGAAGGG 0: 1
1: 0
2: 0
3: 25
4: 258
Right 1086345645 11:85893114-85893136 AAGAGCCAATATTTGCTTTCTGG 0: 1
1: 1
2: 2
3: 19
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086345639 Original CRISPR CCCTTCTCTGGCAGCTTGGG TGG (reversed) Intronic
900291886 1:1927178-1927200 CCCTTCTCTGGCTCCTGTGGGGG + Intronic
900308831 1:2023849-2023871 CTATTCTCTCGCAGCTCGGGAGG + Intronic
900477644 1:2883446-2883468 CCCTGCCCTGGCTGCTTGGGCGG + Intergenic
900910384 1:5593300-5593322 CTCTGCTCTGGCAGCTGGAGAGG - Intergenic
901350478 1:8591199-8591221 TCCTTATCTGGCAGCTCAGGTGG - Intronic
901661326 1:10799647-10799669 CCCTGCACTGGGAGTTTGGGTGG - Intergenic
902986270 1:20156247-20156269 CCCTTCTCTCGCCCCTTTGGGGG - Intergenic
903213790 1:21832342-21832364 TCCTACTCTAGCAGATTGGGTGG + Intronic
903365689 1:22804364-22804386 GCCTTCGCTGGCAGGATGGGGGG - Intronic
904916089 1:33971656-33971678 GCCTTCTCTGCAAGCTTGGGAGG + Intronic
905036766 1:34923740-34923762 GCCTTCTCTAGCTGCTTGGGAGG - Intronic
906379963 1:45326629-45326651 CCCTTCGCTGTGAGGTTGGGGGG + Intergenic
909587072 1:77301981-77302003 TCCTTCTCTGTCAGCCAGGGTGG + Intronic
909788479 1:79643545-79643567 CCCTTCTCTGCCATTCTGGGGGG - Intergenic
910757177 1:90706421-90706443 CCCTTCTCTCACATCTCGGGGGG - Intergenic
911044406 1:93616868-93616890 CCCTTCTCTGGCTGCCTGGAAGG + Intronic
911658712 1:100475784-100475806 CCCTCCTCTGTCAGCTGGAGTGG - Intronic
913356494 1:117928950-117928972 CCGCTCTCTGGCCGCTTGAGGGG - Intronic
915324172 1:155072040-155072062 AGCTGCTGTGGCAGCTTGGGTGG + Intergenic
915565918 1:156712613-156712635 CCCTGCCCTGGGAGCTGGGGAGG - Intergenic
916626802 1:166567091-166567113 CCCTTCTGTGGCACCCTTGGAGG - Intergenic
917014854 1:170518438-170518460 CCCTGCACAGGCTGCTTGGGTGG + Intergenic
918302770 1:183219061-183219083 TCCTGCACCGGCAGCTTGGGGGG - Intronic
920298969 1:204976837-204976859 TGCTTCTCTGGCTGCTGGGGAGG - Intronic
922482807 1:225950859-225950881 CCCTTCACTGTCAGCCTTGGAGG - Intergenic
922746178 1:228045448-228045470 CCCTTCTAGGGCAGCTTGAGAGG - Intronic
922962256 1:229658297-229658319 CTCTTCTCTGGAAGTTTGGGTGG + Intronic
1062997810 10:1883335-1883357 CACTGCTCTGACAGCTTGAGGGG - Intergenic
1064100082 10:12456039-12456061 GCCTTCTCCAGAAGCTTGGGTGG + Intronic
1067274540 10:44822036-44822058 CCCTTCTTCTGGAGCTTGGGTGG - Intergenic
1067716399 10:48694192-48694214 TCCTTCTCTGGGAGTTTGGAGGG + Intronic
1071907842 10:90194411-90194433 CCCTTCTCTGCCAACTTGAAAGG - Intergenic
1072226082 10:93370422-93370444 AGCTACTCTGGCAGCTGGGGAGG - Intronic
1073239037 10:102042610-102042632 CACATTTCAGGCAGCTTGGGTGG - Intronic
1076642471 10:131928139-131928161 CCCTTCCCTGACAGCTAGGGAGG + Intronic
1077319002 11:1932597-1932619 CCCGGCTCTGGCTACTTGGGAGG - Intronic
1077515256 11:2997690-2997712 CCCTTAGCTGGCATCTTTGGGGG + Intergenic
1081056066 11:38412495-38412517 CCCTTATCTGCAAGCTTTGGTGG + Intergenic
1081205836 11:40274589-40274611 CCCTTCTCTGACATTTTGGATGG - Intronic
1082883181 11:58058334-58058356 CCCTTCTCTGGCACTTTGGATGG + Intronic
1083775544 11:64892913-64892935 CCCTGCTCTGTGACCTTGGGCGG - Intergenic
1083983388 11:66192701-66192723 CCTTTCTATGGCTGCCTGGGTGG - Intronic
1084161629 11:67353405-67353427 TCCTTCTCTGCCTGCCTGGGTGG - Exonic
1084465649 11:69321448-69321470 CCATTCTGTGGCAGCCTAGGAGG + Intronic
1084743607 11:71154722-71154744 CCCTCCTCTGGGAGCGTGGGTGG - Intronic
1084743631 11:71154789-71154811 CCCTCTTCTGGGAGCATGGGCGG - Intronic
1084743656 11:71154859-71154881 CCCTCCTCTGGGAGCGTGGGCGG - Intronic
1084743681 11:71154926-71154948 CCCTCCTCTGGGAGCGTGGGCGG - Intronic
1084743693 11:71154961-71154983 CCCTCTTCTGGGAGCGTGGGCGG - Intronic
1084743849 11:71155395-71155417 CCCTCTTCTGGGAGCGTGGGCGG - Intronic
1084743862 11:71155430-71155452 CCCTCCTCTGGGAGCGTGGGCGG - Intronic
1084945305 11:72634976-72634998 CCCTTCCCTGACAGCCTGAGGGG - Intronic
1085017887 11:73187193-73187215 CATTTCCCGGGCAGCTTGGGTGG - Intergenic
1085663216 11:78389096-78389118 CTCTCCTCTGCCAGCTTAGGAGG - Intronic
1086345639 11:85893090-85893112 CCCTTCTCTGGCAGCTTGGGTGG - Intronic
1086921963 11:92597534-92597556 CTCTTCTTTGGCTGCTTGTGTGG + Intronic
1088528204 11:110779214-110779236 CACTTGTCTGGCACCTTGGCAGG - Intergenic
1088722599 11:112607659-112607681 ACCTTCTCTGCCAGCCTTGGAGG + Intergenic
1089295387 11:117464270-117464292 CCCTTCTCTGGGAGCATCAGGGG + Intronic
1090495533 11:127207781-127207803 CCATTCTCTTCCAGCTTGTGTGG - Intergenic
1090968960 11:131623264-131623286 CCCTTCCTTGGCAGCATGGATGG + Intronic
1091605943 12:1951547-1951569 TCCCTCTCTGGCAGTTTGTGTGG + Intronic
1094334686 12:29335692-29335714 CCTTTTTCTGGGGGCTTGGGGGG - Intronic
1094451282 12:30585402-30585424 CCCCTCTCTTACAGGTTGGGGGG - Intergenic
1095976622 12:47944342-47944364 CCCTACTCTCGCAGCTTCTGGGG + Intergenic
1096084609 12:48857342-48857364 CCCTTCTCTTGCAGAGTGTGGGG - Exonic
1096627375 12:52903970-52903992 CCCTGCGCCGGCAGCGTGGGCGG - Intronic
1101685651 12:107017456-107017478 CAATTCGCTGGCAGCTTGGCTGG + Intronic
1102823605 12:115927818-115927840 CCCTTCTCTGCCCCCTTGGATGG - Intergenic
1103122957 12:118396069-118396091 CCCTTCTCTAGCAGGATGGAGGG - Intronic
1103891647 12:124243360-124243382 CCCTTCCCTGGCACCCTGTGAGG + Intronic
1104189718 12:126468284-126468306 CCTTTCTCTGGCATCTTTGTGGG - Intergenic
1104553104 12:129775438-129775460 CTTTTCTCTGGCAGCTTGAGAGG - Intronic
1105281065 13:18962860-18962882 CCCTTCCATGGAAGCTGGGGTGG - Intergenic
1106702361 13:32244033-32244055 CCCTTCTCCAGCAGCTGTGGGGG - Exonic
1113328698 13:109308386-109308408 CCCTTCACCAGCAGCTTGGGAGG + Intergenic
1113601575 13:111573106-111573128 GCCTCCTCTGGGAGCTGGGGAGG - Intergenic
1113760935 13:112846094-112846116 CCCTTTTCTGGCTGCTTTTGAGG + Intronic
1114549935 14:23526804-23526826 CCCTTTCCTGGTACCTTGGGAGG + Intronic
1118713776 14:68544860-68544882 GCCTTCTTTGGCAGGATGGGAGG - Intronic
1118763009 14:68892144-68892166 CACTTCTCCTGCACCTTGGGCGG + Exonic
1120248988 14:82038998-82039020 CCCTTCCCTCGGGGCTTGGGAGG - Intergenic
1122284204 14:100641147-100641169 TCCTGCTCTGGAAGCCTGGGCGG + Intergenic
1122284212 14:100641187-100641209 TCCTGCTCTGGAAGCCTGGGCGG + Intergenic
1122284220 14:100641227-100641249 TCCTGCTCTGGAAGCCTGGGCGG + Intergenic
1122284228 14:100641267-100641289 TCCTGCTCTGGAAGCCTGGGCGG + Intergenic
1122461272 14:101897620-101897642 GGCCTCTCTGGCAGCTTAGGTGG + Intronic
1125832776 15:42728400-42728422 CTTTTCTCTGGCACCTGGGGTGG - Intronic
1128454770 15:67826342-67826364 AAGTTCTCGGGCAGCTTGGGTGG - Exonic
1128666373 15:69540965-69540987 CCCTTAACAGGCAGCTTTGGGGG + Intergenic
1128793978 15:70451512-70451534 CCTGTTTCTGTCAGCTTGGGTGG - Intergenic
1129245238 15:74275139-74275161 GCCCTCTCTGACATCTTGGGGGG + Intronic
1129669008 15:77596776-77596798 CCCTTCTCTGGTTCCTGGGGAGG - Intergenic
1131248956 15:90818639-90818661 GTCTTCTGTGGCAGCTGGGGAGG + Intergenic
1132352520 15:101148821-101148843 CCTTTCTCTGGGTGCTTGGCCGG - Intergenic
1132888051 16:2191054-2191076 CCCTCCTCTGGCAGCTGGCTGGG - Intronic
1133172283 16:3988583-3988605 CCCTTCCATGGCAGGTGGGGGGG + Intronic
1133238804 16:4402861-4402883 CCCTTCTCTCCCAGCTCGGGAGG + Intronic
1133331858 16:4979828-4979850 CCCTTCTCTGCCATCCAGGGAGG + Intronic
1135522161 16:23186018-23186040 AGCTTCTCTGGCAGCTGTGGTGG + Intronic
1136641387 16:31568620-31568642 CCCTGCTATGGTACCTTGGGCGG + Intergenic
1138143172 16:54586011-54586033 GCCTTCTCTGTCACCTTGGTGGG + Intergenic
1141352662 16:83312563-83312585 CCCTTCTTGGGCAGGTTTGGAGG + Intronic
1142143734 16:88483940-88483962 TCCTTCTCTCGCATCTTCGGGGG + Intronic
1142186506 16:88697376-88697398 CCCTGCTCTGGCGGCCTCGGCGG + Exonic
1142961482 17:3554762-3554784 CTCTTCTCTGGCAGGATGGCAGG + Exonic
1146841047 17:36154518-36154540 CCCATCTCTGGTTGCTTGGCTGG + Intergenic
1146853293 17:36242164-36242186 CCCATCTCTGGTTGCTTGGCTGG + Intronic
1146869201 17:36366054-36366076 CCCATCTCTGGTTGCTTGGCTGG + Intronic
1146942335 17:36851927-36851949 TCCTTCTCAGTCATCTTGGGAGG - Intergenic
1147072075 17:37966685-37966707 CCCATCTCTGGTTGCTTGGCTGG + Intergenic
1147083601 17:38046217-38046239 CCCATCTCTGGTTGCTTGGCTGG + Intronic
1147099547 17:38170184-38170206 CCCATCTCTGGTTGCTTGGCTGG + Intergenic
1147422148 17:40327200-40327222 CTCTTCTCTGGGAGCAAGGGTGG + Intronic
1147561427 17:41511688-41511710 CCCTTTGCTGGCTGTTTGGGAGG + Intergenic
1148131733 17:45266430-45266452 CCCTCCTCTGGCACAGTGGGAGG - Intronic
1148782167 17:50128621-50128643 CCCTTCTCTGGGAGAAAGGGAGG + Intronic
1150082558 17:62253478-62253500 CCCATCTCTGGTTGCTTGGCTGG + Intergenic
1151714695 17:75825326-75825348 CCCCTCTCTGGCAGCTAGCAGGG + Exonic
1151750421 17:76034071-76034093 CTCTTCTTAGGCAGCATGGGAGG + Intergenic
1151892265 17:76957754-76957776 CCCTTCTCTGGCGCCTTCAGAGG + Intergenic
1153363868 18:4231340-4231362 CCCTGCTCTGGAAGCCTGGGTGG + Intronic
1153922867 18:9806599-9806621 CCATTCTGTGGCATCTTGGGTGG - Intronic
1156487367 18:37475009-37475031 CAGTTCTCTGGCCCCTTGGGTGG + Intronic
1157138924 18:45086151-45086173 CCATTCTCTGCCAGGTTGGAGGG - Intergenic
1157218158 18:45802581-45802603 CCCTTCTCTGGGCACTGGGGTGG - Intergenic
1157384381 18:47248756-47248778 AAATTGTCTGGCAGCTTGGGCGG + Exonic
1158244189 18:55412292-55412314 CCTTTCTCTGGCAGCGTGCTAGG + Intronic
1158745693 18:60197184-60197206 CCCTTCTCTGTCATGTTGTGGGG - Intergenic
1160037383 18:75314429-75314451 CGCCCCTCTGGCAGCTGGGGGGG - Intergenic
1160883601 19:1334267-1334289 CCCTGCTATGGAACCTTGGGTGG + Intergenic
1161059218 19:2206649-2206671 TCCTTCTCTGTCACCTTGAGTGG + Intronic
1161441548 19:4294585-4294607 CCCTTTGCTGGCAGCTGCGGCGG + Exonic
1164480658 19:28608914-28608936 CCCTTCTCTCGCCCCTTTGGGGG - Intergenic
1164670419 19:30069197-30069219 CCCTTGCCTGGCAGCTGGTGAGG - Intergenic
1165828130 19:38717203-38717225 CACTTCTCCTGCACCTTGGGCGG - Exonic
1166013096 19:39958407-39958429 CCCTACTCTGGGAGATAGGGTGG - Intergenic
1166299697 19:41906734-41906756 CCCTCCTGTCTCAGCTTGGGGGG + Exonic
1168316084 19:55485346-55485368 CCGTTCTCTGGCATGTGGGGAGG + Intronic
1168423187 19:56218319-56218341 TCCTTTTCTGCCAGCTTGGAAGG - Intergenic
1168425111 19:56233888-56233910 TCCTTTTCTGCCAGCTTGGAAGG - Intronic
1168650737 19:58090437-58090459 TTGTTCTCTGGCAGCTGGGGTGG - Intronic
924985047 2:263526-263548 CCCTTCTCTTCCAGGTTGGGGGG + Intronic
925741272 2:7007859-7007881 CGCTTCTCTTGCAGCTTGTTTGG + Intronic
928381856 2:30824827-30824849 TCCTTCCCTGGCACCTTTGGAGG + Intergenic
929420405 2:41784453-41784475 GGCTTCCCTGGCAGCCTGGGTGG - Intergenic
930172120 2:48262661-48262683 CCCTTCTCTGCCAGGTTTAGCGG - Intergenic
930680942 2:54255979-54256001 CCCTCCTCTGGAAGCCGGGGCGG + Exonic
935023876 2:99257725-99257747 CAATTCTCTGGCAGCTTCTGGGG + Intronic
936519467 2:113202483-113202505 CCCATCTCTGGCAGCTCAGAGGG + Exonic
936757417 2:115731412-115731434 CCCTACTCTGGAAGCTGAGGTGG + Intronic
937273657 2:120670957-120670979 CCCCTCGCTGGCTGCTGGGGTGG - Intergenic
937735629 2:125284603-125284625 CACCTCACTGGCAGCTTGAGGGG - Intergenic
937914607 2:127092744-127092766 CCCTTCCCCGGGAGCTTTGGAGG - Intronic
937969444 2:127537980-127538002 TCCTTCACTGCCAGCTGGGGAGG + Intronic
938171132 2:129077963-129077985 CCATTCTCTGGGAGCCTAGGAGG - Intergenic
942146233 2:173029754-173029776 TCCTCCTCTGGCAGCTTGAGAGG - Intronic
944209316 2:197189982-197190004 CCCTTCTCTGGAAGCTTTTTTGG - Intronic
946225856 2:218263675-218263697 CACTGCTTTGGCTGCTTGGGTGG - Exonic
947527364 2:230886788-230886810 CCGTGCTCTGGCAGCTGGAGTGG - Intergenic
948992878 2:241563631-241563653 CCCTTGTCTGGGAGCTGGTGTGG + Intronic
1170714269 20:18818276-18818298 CTCTTCTCTGGGGGCTTGAGGGG + Intronic
1172132373 20:32664359-32664381 CCCTTCTCTGGAAACCTGTGTGG - Intergenic
1172437843 20:34942518-34942540 ACCATCTCTGCCAGCTTTGGGGG - Exonic
1174052660 20:47778157-47778179 CTCTTCTCTGGCTACTGGGGTGG + Intronic
1175217826 20:57400747-57400769 CCCTTCTCTGGGGTCTTGGTGGG + Intronic
1175967085 20:62665203-62665225 ACCTGCTCTGGCAGCGGGGGTGG - Intronic
1179033131 21:37737362-37737384 CCTTTTTCTCTCAGCTTGGGTGG + Intronic
1179060266 21:37973078-37973100 GCCTTCTCTTCCAGTTTGGGAGG - Intronic
1180694819 22:17744909-17744931 CCCTTCTCTGGCAGCCCAGGAGG - Intronic
1180708836 22:17826057-17826079 TCCTTCTCTGATAGCTTGGTAGG + Intronic
1181433396 22:22896222-22896244 CGGTTCCCTGGCAGGTTGGGTGG - Intergenic
1182214428 22:28703953-28703975 CCCTTGTTTGGCAGCATGGCTGG - Intronic
1182528230 22:30934993-30935015 CCCTGCTTTGGCAGCCCGGGAGG - Exonic
1183105750 22:35613911-35613933 GCCTTCTGTGGCTGCCTGGGGGG - Intronic
1184094253 22:42308151-42308173 CCCTGGTCTGGTAGCTGGGGTGG + Intronic
1184661137 22:45966078-45966100 CCCTTCTCTGGCAGCCCGAGGGG + Intronic
1184767623 22:46579820-46579842 CCCATCTCGGGGAGCTGGGGAGG + Intronic
1184789209 22:46689075-46689097 CCCTCCTCTGGCTGGCTGGGCGG - Intronic
1184864704 22:47195680-47195702 CCCTGCACTGGGAGCTTGGTGGG + Intergenic
1185119694 22:48958581-48958603 CCCTCCTCTGGCTGCTGGGCAGG + Intergenic
949157713 3:848749-848771 CCCTTCTCTGGTCTCTTTGGGGG - Intergenic
949852781 3:8435748-8435770 CCCTTCTCTAGCACCTTCAGAGG + Intergenic
950095928 3:10330414-10330436 CCCTTCTCTGGACTCCTGGGAGG + Intronic
950444889 3:13031312-13031334 CCCTTGTCTACCAGCTGGGGTGG - Intronic
951889761 3:27557498-27557520 CCATTCTCTAGTAGCTTTGGAGG - Intergenic
953149447 3:40310339-40310361 CCGTTCTCTGGCAGCTCCTGGGG + Intronic
953222283 3:40983453-40983475 TCCTTCTCTGGTTGCTAGGGTGG - Intergenic
955056906 3:55462926-55462948 CCCCTCTCTGGCAGGTTTTGTGG - Intergenic
955224263 3:57048335-57048357 ACCTTCACTGACTGCTTGGGTGG + Intronic
955358338 3:58250501-58250523 GATTTCTCTGGCAGCTGGGGTGG + Intronic
957022113 3:75138598-75138620 CCCTTCTCTTGCTCCTTCGGGGG - Intergenic
960938556 3:122918709-122918731 CCCTTCCCTGGCAGCCTGAGGGG + Intronic
961148237 3:124613364-124613386 CCTTTCTCTAGCAGCTTAGTGGG + Intronic
961243262 3:125430503-125430525 GCCTGCTCTGGCAGGATGGGAGG + Intergenic
962705175 3:138036652-138036674 ACCATCTCAGGCAGCTTGGAAGG + Intergenic
963877009 3:150487261-150487283 CCCTTCACTTTCAGCTTTGGGGG - Intergenic
964119170 3:153163822-153163844 TCCTTTTCTGCCAGCTTGGAAGG + Exonic
964554163 3:157917477-157917499 CCATTTTCTGGCAGTCTGGGAGG + Intergenic
965876901 3:173335068-173335090 CTCTTCTCTGGCATCTTGTTAGG - Intergenic
969150177 4:5162663-5162685 CCTTTCAGTAGCAGCTTGGGTGG + Intronic
969641764 4:8402935-8402957 GCCTGCTCTGGCGGCTTGGCTGG - Intronic
969651420 4:8470357-8470379 CCGCTCTCCTGCAGCTTGGGAGG + Intronic
969802992 4:9584102-9584124 CCCATCACTGGCATCATGGGAGG + Intergenic
969867155 4:10083539-10083561 CCCTCCTCTCCCAGCCTGGGGGG + Intronic
969976903 4:11112510-11112532 CTCTTCTCTGACAACTTAGGGGG + Intergenic
970281888 4:14465687-14465709 TCCTTCCCTGGCAGGTTGGCAGG + Intergenic
972571809 4:40318049-40318071 TCCTTCTCTGGCAGCTCTTGAGG + Intergenic
972769731 4:42186085-42186107 CCCTTCCCTGGCACCTTCAGAGG + Intergenic
973717759 4:53694002-53694024 CCCTACTGTGGCAGCGTCGGGGG - Intronic
974059438 4:57017778-57017800 CACTTTTCTGGGTGCTTGGGAGG + Intronic
976835600 4:89369541-89369563 ACCTTCTGTAGCAGCTAGGGTGG - Intergenic
977048921 4:92102464-92102486 CTCCTCTCTAGCAGCTTTGGAGG - Intergenic
980246468 4:130251073-130251095 TCCTTACCTGGCAGCTTGAGAGG + Intergenic
984616836 4:181907694-181907716 CCCTCCTCTGAGAGCTTGTGGGG - Intergenic
985472205 5:53392-53414 CCCTTCTCAGGCAGGCTGTGGGG + Intergenic
986268088 5:6207756-6207778 CCCTTCACTGGCAGCAGAGGTGG - Intergenic
987302645 5:16610117-16610139 CCCTTCTCTGCCAGCCTGAATGG - Intronic
987402393 5:17491682-17491704 CCTTTTTCTGGCGGCTTTGGTGG + Intergenic
989745992 5:44830351-44830373 CCCTTCTCTTGGATCTTGGTGGG - Intergenic
995490868 5:112690466-112690488 CTCTTCTCTGGAACCCTGGGAGG - Intergenic
996915439 5:128706909-128706931 TTCTTCTCTGGCAGTTTTGGAGG + Intronic
998406149 5:141875949-141875971 CCCTTCCCTGGCAGCTCCCGAGG + Intronic
998798845 5:145847611-145847633 TCCATCTCTGGCTGCTAGGGTGG + Intergenic
999743663 5:154575666-154575688 CCCTCCCCAGGCAGCCTGGGAGG - Intergenic
1002170039 5:177369794-177369816 CTCTTCTCAGGCCGCTAGGGCGG + Intronic
1002783391 6:383748-383770 TCGTCCTCTGGCTGCTTGGGAGG - Intergenic
1003080180 6:3015409-3015431 CTCTTCCCTGGCAGCTGGGCAGG - Intronic
1003495903 6:6663003-6663025 CCCTTCCCTCGCAGCTTCAGAGG - Intergenic
1003735780 6:8876363-8876385 TCCTCTTCTGGCACCTTGGGTGG - Intergenic
1006107838 6:31727439-31727461 ACCTTCTCTAGAAGCCTGGGTGG - Intronic
1006434929 6:34021103-34021125 GGCTTCCCTGGCAGGTTGGGAGG - Intronic
1006702353 6:35985775-35985797 CCCATCTCTGGCACCTTAGGAGG - Intronic
1006741195 6:36310267-36310289 CTCTTCTCCTGGAGCTTGGGTGG + Intergenic
1006783783 6:36651044-36651066 CCTTTATCTGGCAGCTGGGTGGG - Intergenic
1007716235 6:43857760-43857782 CCCTTACCTGGGAGCTTGGAAGG - Intergenic
1013591169 6:111620553-111620575 CCTTTCTAAGGCATCTTGGGAGG + Intergenic
1016682985 6:146852001-146852023 CCCATCTTAGTCAGCTTGGGCGG + Intergenic
1019399010 7:840483-840505 CCCTTCGAAGGAAGCTTGGGAGG - Intronic
1019721554 7:2575411-2575433 CCCTTCCCTCCCAGCTAGGGCGG - Intronic
1019997608 7:4734690-4734712 CTCAGCTCTGGAAGCTTGGGGGG + Intronic
1022485652 7:30775600-30775622 TCCCTCTCTGGGAGATTGGGAGG + Intronic
1023516686 7:41008642-41008664 GCCAGCTCTGGAAGCTTGGGAGG + Intergenic
1026302525 7:69110227-69110249 CCCTTCCCTGGCATTTTTGGGGG + Intergenic
1026805886 7:73429489-73429511 CCTTCCTCTGGCAGCTTCGGTGG - Intergenic
1027133617 7:75609156-75609178 CCCTTCTCCTGCAGCTCTGGGGG + Intronic
1027552126 7:79612245-79612267 CTCATCTGTGGCAGCTTGGCAGG - Intergenic
1033157152 7:138966834-138966856 TCCTTCTCTAGCACCTTTGGAGG + Intronic
1034630569 7:152527317-152527339 CCCTTGTCAGGCTGCCTGGGCGG + Intergenic
1035041491 7:155931465-155931487 CCCTTCTCTCGCACATTGGCTGG + Intergenic
1036142816 8:6224025-6224047 CCCCTTTCTGACAGCTTGTGCGG + Intergenic
1036387329 8:8293948-8293970 CCCTTCTCTGGGAAAATGGGAGG + Intergenic
1036885453 8:12549209-12549231 CCCATCTTTGGCATCATGGGCGG - Intergenic
1037905412 8:22713418-22713440 CCTTTCTCTGGGAGCCTGGAGGG + Exonic
1038492874 8:27982673-27982695 CCCTTCTCTGCATGCCTGGGCGG - Intronic
1038598745 8:28915682-28915704 CCCTCCTTGGGCAACTTGGGTGG + Intronic
1039109732 8:34028649-34028671 CCCCACTCTGGCAGCCTGGGCGG + Intergenic
1039758218 8:40545688-40545710 CCCTTCTCTTGCACCTTCAGAGG + Intronic
1040518403 8:48153487-48153509 CCCTTCCCTGGTACCTTGGTTGG - Intergenic
1046133703 8:109998780-109998802 CCTCTCTCTGGCACCCTGGGTGG + Intergenic
1047042237 8:121008810-121008832 CCCTTGCCTGGAAGCTTGGAGGG - Intergenic
1047167445 8:122455044-122455066 CACTTCCCTGGCTGCTTGTGAGG + Intergenic
1048987819 8:139744720-139744742 CTCTTCCCTGGCATCCTGGGAGG + Intronic
1049403268 8:142440345-142440367 CCCCTCTGTGGCAGGTGGGGAGG + Intergenic
1049738437 8:144222338-144222360 CTCTCCTCTGGCAGCAGGGGAGG + Intronic
1049942489 9:560962-560984 GCCTTCTCTGGCAGCTTTAATGG + Intronic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1050794478 9:9521133-9521155 CTGTTCTCTGGCTGCTTGAGAGG + Intronic
1052570128 9:30210131-30210153 ACCTTCTCTGGAAGCTTCGAAGG + Intergenic
1057490337 9:95515808-95515830 CCCTTTTCCCGCAGCATGGGAGG + Intronic
1057502013 9:95603501-95603523 CCCTTCTCTGGCCTCCTAGGTGG - Intergenic
1058522736 9:105828335-105828357 ACTTTGTCTTGCAGCTTGGGTGG - Intergenic
1060296024 9:122343322-122343344 CCCCACACGGGCAGCTTGGGAGG - Intergenic
1061404606 9:130386343-130386365 CCCTGCTCTGGAAGTTTTGGGGG + Intronic
1061481405 9:130899143-130899165 CACTGCTCTGACAGCTTGAGGGG - Intergenic
1061519256 9:131107988-131108010 TCCTTCTTCGGCAGCCTGGGAGG - Intronic
1061961375 9:133990936-133990958 CCTTTCTCTGCCGGGTTGGGGGG - Intronic
1062014477 9:134284261-134284283 CCATGCTCTGGCAGGTTGGAGGG + Intergenic
1062224555 9:135442181-135442203 CCCTTCCCTGGCCTCTTTGGGGG + Intergenic
1186398419 X:9233985-9234007 CCATTCTGTGGCACTTTGGGTGG + Intergenic
1187294751 X:17987920-17987942 TTCTTCTCTGGCAGCCTAGGGGG - Intergenic
1195145253 X:102007889-102007911 CCCTTCACTCGCTGCTTGTGTGG - Intergenic
1195890840 X:109693080-109693102 TCCTCCTCTGGCAGATGGGGAGG - Intronic
1201147460 Y:11072889-11072911 CCCTCCTCCGGGAGCATGGGTGG - Intergenic