ID: 1086347805

View in Genome Browser
Species Human (GRCh38)
Location 11:85915151-85915173
Sequence CTGAGTCAGCTTTAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086347805_1086347811 17 Left 1086347805 11:85915151-85915173 CCTTCCCCCTAAAGCTGACTCAG 0: 1
1: 0
2: 2
3: 19
4: 226
Right 1086347811 11:85915191-85915213 ATCCCATTATTCTCACACTATGG 0: 1
1: 0
2: 1
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086347805 Original CRISPR CTGAGTCAGCTTTAGGGGGA AGG (reversed) Intronic
901745591 1:11371192-11371214 CCGAGTCAGCCTGAGGGGGTGGG + Intergenic
903691547 1:25177540-25177562 CTGAGACAGCAACAGGGGGATGG + Intergenic
904643000 1:31944646-31944668 CTGCGTCCGCCTTTGGGGGAGGG + Intronic
904939754 1:34157446-34157468 GTGAGTCAGATTTATTGGGATGG - Intronic
905897360 1:41557573-41557595 TGGAGTCACCTTTGGGGGGATGG + Intronic
906125944 1:43426972-43426994 ATGAGTCAGCTCTAGGGTGGAGG + Intronic
906742819 1:48198988-48199010 CTGAGTCTGCTTCTGGGTGAGGG + Intergenic
906745518 1:48219530-48219552 CTGAGAAAGCTTTATGGGAAGGG - Intergenic
906872074 1:49494037-49494059 CAGAGTAAGCTCTAGAGGGAAGG - Intronic
908820681 1:68083144-68083166 ATAAGACAGCATTAGGGGGATGG + Intergenic
909974939 1:82035010-82035032 CTGAGTCAGCTTGTGGGAGAAGG - Intergenic
911011032 1:93281157-93281179 ATGAGGCAGCACTAGGGGGATGG + Intergenic
911882077 1:103252265-103252287 ATGAGACAGCATTAGGGGGATGG - Intergenic
912232238 1:107807661-107807683 CTGAGTCAGACTTAGGAGGTAGG - Intronic
912711327 1:111952149-111952171 GGGAGTCAGCCTTAGGGGGTCGG + Intronic
913142250 1:115953225-115953247 CTGAGACAGCACTAGGGGTATGG - Intergenic
913242550 1:116841813-116841835 CTGAGTTAGCTATATGGGAAAGG - Intergenic
915007744 1:152655712-152655734 CTGAGTCAGCTGGCTGGGGAGGG + Intergenic
915595987 1:156896770-156896792 CTGAGTCACCTGGAGGTGGAGGG - Intronic
916569165 1:166009747-166009769 AAGAATCAGCTTTAGGGGGAAGG - Intergenic
916940401 1:169670838-169670860 CTTAGTGAGCAATAGGGGGAGGG + Intronic
919081479 1:192871666-192871688 CTGAGACAGCACTAGAGGGATGG - Intergenic
921271813 1:213476529-213476551 CTGACTCAGGTTTATGGGGAGGG + Intergenic
921771242 1:219042316-219042338 CTGAGTCAGCCTCTGGGTGAGGG - Intergenic
923817531 1:237397651-237397673 CTGAGTGACCTGTAGGGGTAGGG + Intronic
924027895 1:239856354-239856376 ATGAGACAGCACTAGGGGGACGG - Intronic
1064523792 10:16231696-16231718 CTGAGGGAGCTGTAGGGAGAAGG - Intergenic
1064842696 10:19612812-19612834 ATGAGACAGCACTAGGGGGATGG + Intronic
1067099296 10:43322992-43323014 CTGAGTCAGTTGGAGGGGGCGGG + Intergenic
1069755613 10:70772871-70772893 GTGAGTCAGGGCTAGGGGGAGGG - Intronic
1071164816 10:82793372-82793394 CTGAGACAGTATTAGGGAGAGGG + Intronic
1071717134 10:88108304-88108326 CTGAATTAGCTGTTGGGGGAGGG + Intergenic
1072065826 10:91870504-91870526 ATGAGTGAGCTTTCGGGTGATGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1077442170 11:2573958-2573980 CTGAGGCATTTTTAGGGGGCAGG + Intronic
1077612874 11:3655230-3655252 GTGGGTCTGCTTTTGGGGGAAGG - Intronic
1078601475 11:12735315-12735337 CTGAATAAGCATTAGGGGAAGGG + Intronic
1080197302 11:29627397-29627419 CAGACTCAGGTTGAGGGGGATGG - Intergenic
1080484424 11:32690556-32690578 ATGAGGCAGCACTAGGGGGACGG - Intronic
1080519734 11:33057542-33057564 CAGAGAAAGCTTTAGGTGGAGGG + Intronic
1080768667 11:35320507-35320529 CTGAGTCAGCTCTTGAAGGATGG + Intronic
1083936615 11:65872869-65872891 CTGAGCCAGCGCCAGGGGGAGGG + Exonic
1084183525 11:67458324-67458346 CTGAGGCAGCTTTGGGTGGGAGG + Intronic
1085169877 11:74440634-74440656 ATGAGACAGCACTAGGGGGATGG - Intergenic
1085435494 11:76496256-76496278 CTCACTAAGCTTTTGGGGGAAGG - Exonic
1086347805 11:85915151-85915173 CTGAGTCAGCTTTAGGGGGAAGG - Intronic
1087574929 11:99977661-99977683 ATGAGACAGCACTAGGGGGATGG + Intronic
1096256007 12:50062885-50062907 CTGAGTCAGCTTGGGAGGGTGGG + Intronic
1096411095 12:51377590-51377612 CTGAGCCAGCTCTGTGGGGATGG - Intronic
1097013821 12:55971382-55971404 CTGATTCAGCTATGGGAGGATGG + Intronic
1097136114 12:56857170-56857192 CTGAGTCAGCCTCTGGGGGTGGG + Intergenic
1098109683 12:67108990-67109012 ATGAGTCAGATATAGGGAGATGG - Intergenic
1099907678 12:88791384-88791406 ATGAGACAGCACTAGGGGGATGG + Intergenic
1100082179 12:90866002-90866024 GTGAGACAGCACTAGGGGGATGG - Intergenic
1100207245 12:92363937-92363959 CTGATTCAGCTGTCGGGGGGAGG + Intergenic
1100983844 12:100186430-100186452 CTGAGTCAACTTTATTGGGATGG - Intergenic
1101706981 12:107229935-107229957 CTGAATCAGCTTCCTGGGGAGGG + Intergenic
1104110162 12:125697260-125697282 ATGAGACAGCTGTAGGGGGATGG - Intergenic
1104197395 12:126554130-126554152 CTGAGTCAGTTTCCGGGTGAGGG + Intergenic
1104237477 12:126953029-126953051 CTGAGTCTGCTTCTGGGTGAAGG + Intergenic
1106493934 13:30257269-30257291 CTGAGTCAGATTTATGGGTATGG + Intronic
1107166923 13:37293176-37293198 CTCATTCAGATTTAGTGGGACGG + Intergenic
1107194855 13:37638097-37638119 CTGACCCAGATGTAGGGGGAAGG - Intronic
1109713184 13:66185056-66185078 CTGAGTCAGTTTTTGGGTGGGGG + Intergenic
1112156621 13:96824213-96824235 CTAAGTCAGCATGAGGGAGAAGG + Intronic
1113320865 13:109230711-109230733 ATGAGTCAGCTTCATGGGGATGG - Intergenic
1113548742 13:111175552-111175574 GTGAGTGAGCTTTTGGGGGAAGG + Intronic
1114334312 14:21672106-21672128 CTGAGTCAGATTGTGGGGCAGGG + Intergenic
1114365986 14:22027439-22027461 CTGAGTCCTCTTCAAGGGGAAGG - Intergenic
1114569253 14:23654441-23654463 CTGAGACAGCACTAGGTGGATGG - Intergenic
1114758843 14:25289184-25289206 CTAAGTCAGCTTTAGGCAGGAGG - Intergenic
1117594728 14:57314702-57314724 ATGAGACAGCATGAGGGGGATGG + Intergenic
1117859956 14:60079512-60079534 CTGTGAGAGCTTTAGTGGGAAGG - Intergenic
1118019369 14:61695484-61695506 CTGAGGCAGCGTCAGGGGGCGGG - Intergenic
1119369714 14:74129087-74129109 GTGAGTTAGTTTTAGTGGGATGG + Intronic
1119617466 14:76108141-76108163 CTGAGCCAGCTGCAGGGGCAGGG + Intergenic
1120915461 14:89706362-89706384 ATGAGGCAGCACTAGGGGGATGG + Intergenic
1121957694 14:98229053-98229075 TTGAATCAGCTTTGGGGGGTGGG - Intergenic
1122439707 14:101722320-101722342 ATGAGTCAGCTTGATGGGGTGGG - Intergenic
1125477345 15:40055972-40055994 CTGAGTCAGGTGTGGGAGGAGGG + Intergenic
1126087154 15:45021489-45021511 CTGAGTCAGTTTCTGGGCGAGGG - Intergenic
1126811123 15:52405257-52405279 CAGAATAAGCTTTAGTGGGATGG - Intronic
1127110723 15:55666360-55666382 CAGAGTCACATTTAGGGTGAAGG + Intronic
1127899836 15:63333052-63333074 TTAAGTCACCTTTAGAGGGATGG + Intronic
1128136077 15:65264589-65264611 CTGTGTCAGCTTTTGAGAGATGG - Intronic
1128350525 15:66885431-66885453 CTGAGTGGGCTTTAGGGAGATGG + Intergenic
1128674179 15:69596645-69596667 CAGAATCAGCTTTGGAGGGAGGG - Intergenic
1128727098 15:69996278-69996300 CTGTGTCAGCATTTGGGGGAAGG + Intergenic
1129644347 15:77417097-77417119 CTGACTCAGACTTCGGGGGATGG - Intronic
1129747628 15:78035640-78035662 CTGAGTCAGCTTTATTGAGATGG - Intronic
1130018171 15:80203150-80203172 CAGGGACAGCTTTAGGAGGAGGG + Intergenic
1130263824 15:82380676-82380698 CTGCCTCTGCTTGAGGGGGAGGG + Intergenic
1130469792 15:84216160-84216182 CTGCCTCTGCTTGAGGGGGAGGG - Intergenic
1130477280 15:84330723-84330745 CTGCCTCTGCTTGAGGGGGAGGG - Intergenic
1130494485 15:84457407-84457429 CTGCCTCTGCTTGAGGGGGAGGG + Intergenic
1130592081 15:85220784-85220806 CTGCCTCTGCTTGAGGGGGAGGG - Intergenic
1131025340 15:89136800-89136822 CTGTGCCAGCGTTATGGGGAGGG - Intronic
1133402372 16:5498055-5498077 GTGAGTGAGCTTGAGGGAGAGGG + Intergenic
1133580705 16:7141923-7141945 CTGAAACATCTTAAGGGGGAAGG - Intronic
1135205430 16:20480001-20480023 CTGACTCAGGTATAGGGGCATGG - Intronic
1135213478 16:20543811-20543833 CTGACTCAGGTATAGGGGCATGG + Intronic
1135280261 16:21148165-21148187 TTGAGTCATCTTTAAGGGGTTGG - Intronic
1138144385 16:54595645-54595667 CTGACTAAGCATTAAGGGGAGGG - Intergenic
1138809039 16:60127442-60127464 CAGAGTCAGCCCTAGGGGGAAGG - Intergenic
1139106350 16:63831285-63831307 CTCAGTCAGCCTCAGGGTGAAGG - Intergenic
1140792839 16:78408774-78408796 CTGAGTCACCTTTGGGAGGTAGG + Intronic
1142199427 16:88754039-88754061 CTGAGTCAGCTGCAATGGGATGG + Intronic
1142610781 17:1108460-1108482 CTGGGTCAGCTGAAGGGGGGAGG - Intronic
1143352670 17:6300000-6300022 GTGAGACAGCACTAGGGGGATGG - Intergenic
1143967719 17:10768685-10768707 CTGAGGCAGTCTTAAGGGGAAGG - Intergenic
1144118506 17:12126060-12126082 ATGAGACAGCACTAGGGGGATGG + Intronic
1144859550 17:18292296-18292318 CTGAGCCAGCCTTGGGAGGATGG + Intronic
1147161937 17:38573406-38573428 CAGACTCAGCCTTAGGGGCAGGG + Intronic
1147210865 17:38871661-38871683 CTGAGTCAGCGTGAGGAGGTGGG + Intronic
1147914573 17:43878840-43878862 CTGAGTCAGCGTCAGGGAGCAGG - Intronic
1149333132 17:55606977-55606999 GTGAGACAGCTGTAGTGGGAGGG - Intergenic
1149479634 17:56992319-56992341 CTGAGTCAGCATGAAGAGGAGGG + Intronic
1151028306 17:70705369-70705391 ATGAGACAGCATTAGGGCGATGG + Intergenic
1151724460 17:75876276-75876298 CTGAGTCAGCTTCAGGGACCTGG + Exonic
1155921081 18:31603545-31603567 CTGAGTCAGCCTCTGGGTGAGGG - Intergenic
1158962777 18:62600506-62600528 CTGAGGCAGAGGTAGGGGGAGGG + Intergenic
1159536304 18:69719294-69719316 CTGAGTCAGTTTCTGGGTGAGGG + Intronic
1159698430 18:71591238-71591260 CAGAGTTAGTTTTAGGGAGATGG + Intergenic
1161843515 19:6696570-6696592 GTGAGTCGGCTGCAGGGGGAGGG - Intronic
1162395021 19:10412909-10412931 CTGAGTCAGAGTCAGGGGGATGG - Intronic
1164468992 19:28512705-28512727 CTGAATCAGCCTTGGGGAGAGGG - Intergenic
1164490402 19:28707208-28707230 ATGAGACAGCACTAGGGGGATGG - Intergenic
1166270450 19:41710315-41710337 CAGGGTCAGGTTTACGGGGAGGG - Intronic
1166326075 19:42051927-42051949 CTGAGTCAGCTTTAGGAGGCTGG - Intronic
1166510061 19:43400843-43400865 CTGATTCACCTATAGGAGGAGGG - Intergenic
1167153375 19:47722957-47722979 CTGAGTGAGCTCTAGCTGGAGGG + Intronic
1167952589 19:53039077-53039099 CTGAGTCAGTTTCTGGGTGACGG + Intergenic
925072876 2:984783-984805 CTGCGTCAGCTCCACGGGGAGGG + Intronic
925552124 2:5087679-5087701 ATGAGGCAGCACTAGGGGGATGG + Intergenic
925640488 2:5981849-5981871 CTGACTCAGCTGAAGGGGGCTGG + Intergenic
927906659 2:26863288-26863310 CTGAGCCAGCTTAAAGGGGGAGG - Intronic
927918327 2:26950886-26950908 CTGACTGAGCTCTAGAGGGAAGG - Intergenic
929171925 2:38940898-38940920 CTGAGTCAGCCTCTGGGTGAGGG + Intronic
930606189 2:53495927-53495949 CTGGGTCAGATTTTAGGGGAAGG - Intergenic
931606007 2:64052680-64052702 CAGACTCTGCTTTAGAGGGAAGG - Intergenic
931640189 2:64374957-64374979 CTGAGTCAGCATTTGAAGGAGGG + Intergenic
932081190 2:68716476-68716498 GTGAGTCAACTTGATGGGGAGGG + Intronic
934871575 2:97871607-97871629 CTGAGTCAGCCTTTGGGTGGGGG - Intronic
935128985 2:100247375-100247397 CTCAGGCAGCTTGAGGAGGATGG - Intergenic
935422451 2:102883885-102883907 CTGAGTCAGTTTTGGGGAGTTGG + Intergenic
935598382 2:104897489-104897511 CTGAGTGGGCTGTAGGGGGAGGG - Intergenic
943650706 2:190454775-190454797 CTGAGGCAGGTATAGAGGGATGG + Intronic
945396275 2:209323045-209323067 ATGAGACAGCGGTAGGGGGATGG + Intergenic
1173262196 20:41446560-41446582 CAGAGGCAGCTGGAGGGGGAGGG - Intronic
1173678360 20:44857913-44857935 CTGAGTAATCTTTGGGGAGAAGG + Intergenic
1175924475 20:62465174-62465196 CAGAGCCAGCTCTAGGGGAAGGG + Intronic
1182433726 22:30316733-30316755 CTAAGGCAGCTTTAGTGGGATGG - Intronic
1183900582 22:41002997-41003019 CTGAGCCAGGGTTAGGAGGAAGG - Intergenic
1184635896 22:45831020-45831042 ATGAGTCAGCTTTAAAAGGAAGG + Intronic
1184782366 22:46655731-46655753 CTGGGTCAGAATTAGGGGCAGGG - Intronic
1185300430 22:50077147-50077169 CTGAGTCAGGCTTAGGGGGAGGG + Intronic
951081418 3:18454501-18454523 TTGAGACAGCACTAGGGGGATGG + Intergenic
951928448 3:27936373-27936395 ATGAGACAGCACTAGGGGGATGG - Intergenic
952058970 3:29483507-29483529 CTGAGTCAGATTTCTGGGGGTGG + Intronic
955792352 3:62601747-62601769 ATGATTCATATTTAGGGGGATGG + Intronic
955984307 3:64557075-64557097 CTGACTCAGATTTAGTGGGGTGG + Intronic
957174351 3:76786536-76786558 ATGAGACAGCATTAGGGGGATGG + Intronic
957271840 3:78040565-78040587 CTCAGGCAGATTTAGGGGTAGGG - Intergenic
958668237 3:97168410-97168432 ATGAGACAGCACTAGGGGGATGG - Intronic
960011694 3:112841172-112841194 ATGAGACAGCACTAGGGGGAGGG - Intronic
962971854 3:140408676-140408698 CTAAGGCAGCTTTGGGGAGAGGG - Intronic
963889062 3:150613214-150613236 CTGAGTCAGCTCATGGTGGAAGG + Intronic
965361520 3:167746169-167746191 CTGAGACAGTTTAATGGGGAAGG + Intronic
966902649 3:184498059-184498081 ATGAGTCAGCTTAAGTGAGATGG - Intronic
967297544 3:187979853-187979875 CTGTGTCAGCCTCAGGGGCAAGG - Intergenic
969085946 4:4656477-4656499 ATGAGACAGCTCTACGGGGATGG + Intergenic
969592010 4:8127468-8127490 ATGAGTCAGCTTCAGGGGACTGG - Intronic
970665742 4:18334105-18334127 ATGAGACAGCACTAGGGGGATGG - Intergenic
971353561 4:25873930-25873952 CTGGGTCAGGTTTAGCAGGATGG + Intronic
971445341 4:26740634-26740656 CTTAGTCAGGTTTATGGGAAGGG - Intronic
971753923 4:30683643-30683665 ATGAGACAGCACTAGGGGGATGG - Intergenic
971941236 4:33218359-33218381 CTGAGTCAGTTCTTGGGTGAGGG - Intergenic
972367567 4:38390729-38390751 ATGAGACAGCACTAGGGGGATGG - Intergenic
973811483 4:54574665-54574687 ATGAGACAGCACTAGGGGGATGG - Intergenic
975752281 4:77536132-77536154 ATAAGTCAGCTTTTGGGGGCAGG + Intronic
976195905 4:82530944-82530966 CTGAGACAGCACTAGGGAGATGG + Intronic
977672708 4:99714785-99714807 CTGAGTCAGTTCTAGGGTGGGGG - Intergenic
980449442 4:132950728-132950750 ATGAGACAGCACTAGGGGGATGG + Intergenic
981645355 4:146992078-146992100 CTGAGCCATCTTCAGAGGGAAGG - Intergenic
982320549 4:154072688-154072710 CTGGGTGAGCTTTTGGGGCAGGG + Intergenic
982395340 4:154909859-154909881 CTGAGTCATCTTTAGGAGTGAGG - Intergenic
983037462 4:162885423-162885445 CTGAATTAGCTCTTGGGGGAAGG - Intergenic
983147900 4:164241156-164241178 CTGAGTCAGTTTCTGGGTGAGGG - Intronic
989608862 5:43272566-43272588 CTGAGTCAGCCTTACCGTGAGGG - Intronic
990597733 5:57328220-57328242 CTGAGTCAGCTTCTGGGTGGAGG + Intergenic
991163296 5:63531160-63531182 ATGAGGCAGCACTAGGGGGATGG - Intergenic
995865558 5:116686561-116686583 CTGAAACAGATTTAGGAGGAGGG + Intergenic
997500895 5:134372169-134372191 CAGAGTCGGGTTTCGGGGGATGG - Intronic
999174904 5:149625309-149625331 CTGAAGCAGCTGTAGGGAGAAGG + Intronic
1000304467 5:159983114-159983136 CTGGGTCAGGTTGAAGGGGAAGG - Intergenic
1002279240 5:178121043-178121065 CTGAGTCGCCTCTAGGGGGCAGG + Intronic
1006907196 6:37540639-37540661 ATGAGCCAGCACTAGGGGGATGG + Intergenic
1007739877 6:44003779-44003801 CTGAGCCTGGTTTTGGGGGAAGG - Exonic
1008849401 6:56006244-56006266 CTGAGACAGCACTAGGGGGATGG - Intergenic
1010989083 6:82459028-82459050 CTAAGTTAGCTTTAGGGGTTGGG + Intergenic
1011396202 6:86911451-86911473 CAGAGTCTGCCTTAGGGTGAAGG + Intergenic
1012534401 6:100278268-100278290 CAGCTTCAGCTATAGGGGGAAGG + Intergenic
1013825258 6:114203655-114203677 CTGAGTCAGTTTCAGGGGAGGGG - Intronic
1015173132 6:130276904-130276926 CTGAGTCAGCCTCAGGGTGGGGG + Intronic
1016146956 6:140689580-140689602 TGGTGTCAGCTTAAGGGGGAGGG - Intergenic
1016560711 6:145392665-145392687 CTGAGTCTGTTTTAGGGTTAGGG - Intergenic
1021738804 7:23664654-23664676 CTGAGTCTGCTTCTGGGTGAGGG + Intergenic
1021880920 7:25094463-25094485 CTGAGTCAGCTGCAGGCTGAGGG - Intergenic
1022507154 7:30914410-30914432 CTTAGCCAGCTTTCGTGGGATGG - Intronic
1023996510 7:45162023-45162045 CAGGGGCAGCTTTAGGGTGAAGG + Intronic
1024119322 7:46221092-46221114 CTGAGTCAGCGTTAGAGGTTTGG - Intergenic
1024232464 7:47373060-47373082 GAGAGTCAGCCTCAGGGGGAGGG + Intronic
1024257972 7:47552804-47552826 ATGAGTCAGCTTAGTGGGGAAGG + Intronic
1026494541 7:70891105-70891127 CTGTTTCAGCTTTAGGGGGTTGG - Intergenic
1026580794 7:71615090-71615112 CTGTGGCAGCTTTTGGTGGAAGG + Intronic
1026847453 7:73705935-73705957 CTCTGCCAGCTTTAGGGAGATGG - Intronic
1029223259 7:99006964-99006986 CTGAGTCAGCTGGAGGCGGCAGG - Intronic
1029548488 7:101223766-101223788 CTGACACAGGTGTAGGGGGATGG - Exonic
1031293314 7:119967308-119967330 ATGAGACAGCACTAGGGGGATGG - Intergenic
1032264741 7:130363023-130363045 GGGGGTCAGCTCTAGGGGGATGG + Intronic
1036026733 8:4917237-4917259 ATGAGACAGCAGTAGGGGGATGG + Intronic
1038044037 8:23750892-23750914 CTGAGTCAGCTCTATAGGAATGG + Intergenic
1039465328 8:37781362-37781384 CTGGTCCAGCTTCAGGGGGAAGG - Intergenic
1042388965 8:68210842-68210864 TTGAGTCATCTTAAAGGGGAGGG + Intronic
1042585457 8:70333330-70333352 CTGATGCAGCTTCAGGGTGATGG - Intronic
1042751690 8:72164268-72164290 ATGAGACAGCACTAGGGGGATGG - Intergenic
1042764260 8:72303031-72303053 ATGAGACAGCACTAGGGGGATGG - Intergenic
1042964655 8:74337561-74337583 TTGAGTCAGCCTTAGGGAGGAGG + Intronic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1047843880 8:128785078-128785100 ATGAGACAGCACTAGGGGGATGG + Intergenic
1048006797 8:130426127-130426149 ATGAGACAGCACTAGGGGGATGG - Intronic
1048016674 8:130503309-130503331 CTGAGTCAGCTTCTGGGTGGGGG + Intergenic
1048651735 8:136485626-136485648 CTGAGACAGCACTAAGGGGATGG + Intergenic
1049485657 8:142858699-142858721 CTGACACAGGTGTAGGGGGAGGG - Intronic
1055729153 9:79262882-79262904 ATGAGACAGCATTTGGGGGATGG - Intergenic
1059604827 9:115823473-115823495 ATGAGACAGCACTAGGGGGATGG - Intergenic
1060378563 9:123142225-123142247 ATGAGACAGCATTAAGGGGATGG - Intronic
1060781611 9:126417138-126417160 CAGAGAAAGCTTTAGGGAGAAGG - Intronic
1061238308 9:129354550-129354572 CTCAGGCAGCTCTAGGGGAAGGG + Intergenic
1185756253 X:2655400-2655422 GAGACTCAGCTTTAGGGGGCTGG - Intergenic
1185999721 X:4995203-4995225 ATGAGACAGCACTAGGGGGATGG - Intergenic
1186194530 X:7097883-7097905 CTAAGTCAGCCTGAGGAGGAAGG + Intronic
1186226709 X:7406838-7406860 ACGAGACAGCATTAGGGGGATGG + Intergenic
1188022839 X:25177065-25177087 CTGAATCAGATTCTGGGGGACGG + Intergenic
1189160248 X:38803618-38803640 CTTGGTCAGCTATGGGGGGAGGG - Exonic
1190457857 X:50643144-50643166 CTGAGCCAGCCTTAGGAGAAAGG - Intronic
1196988246 X:121298672-121298694 CTGAGTCAGAGTAAGGGTGATGG - Intergenic
1198564603 X:137891417-137891439 ATGAGACAGCACTAGGGGGATGG + Intergenic