ID: 1086354469

View in Genome Browser
Species Human (GRCh38)
Location 11:85980234-85980256
Sequence CAGAGGATAGAGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1522
Summary {0: 1, 1: 0, 2: 5, 3: 149, 4: 1367}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086354463_1086354469 2 Left 1086354463 11:85980209-85980231 CCTTGGTTCAGCTCTCATACCAG 0: 1
1: 0
2: 1
3: 15
4: 118
Right 1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG 0: 1
1: 0
2: 5
3: 149
4: 1367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086354469 Original CRISPR CAGAGGATAGAGAAGGAGGA TGG Intronic
900285100 1:1895274-1895296 CAAAGGACAGAGAATAAGGAGGG + Intergenic
900394094 1:2446099-2446121 CAGTGGACAGGGAAGCAGGACGG - Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900496737 1:2979113-2979135 GAAAGGACAGTGAAGGAGGAGGG + Intergenic
901260009 1:7864371-7864393 CAGAGGATTGAGAGACAGGAGGG - Intergenic
901472920 1:9470224-9470246 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
901631392 1:10649857-10649879 CAAAGGAGAGAGAGGGAGGGAGG + Intronic
901644011 1:10706958-10706980 GAGAGGATGGAGGAGGAGGCCGG + Intronic
901661812 1:10803228-10803250 CCGAGGGGAGAGAAGGAGTAGGG + Intergenic
901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG + Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902362798 1:15951290-15951312 GAAAGGAGAGAGAAGAAGGAAGG + Intronic
902793265 1:18783624-18783646 CAAAGGGTGGAGAGGGAGGAGGG + Intergenic
903282407 1:22257460-22257482 CTCTGGATCGAGAAGGAGGAAGG - Intergenic
903383730 1:22913632-22913654 CAGTGGATAGAGCACCAGGAGGG - Exonic
903753244 1:25643171-25643193 AAGAGGATAGAGGGAGAGGATGG - Intronic
903818712 1:26084417-26084439 CAGAAGTGAGAGAATGAGGAAGG + Intergenic
904087077 1:27916760-27916782 AGGAGGAAAGAGGAGGAGGAAGG - Intergenic
904087084 1:27916786-27916808 AGGAGGAGAGAGGAGGAGGAGGG - Intergenic
904087096 1:27916828-27916850 AGGAGGAGAGAGGAGGAGGAGGG - Intergenic
904273627 1:29366471-29366493 CAGAGGCTGAAGAATGAGGAGGG + Intergenic
904308906 1:29612559-29612581 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904491317 1:30861308-30861330 GAGAGAATAGAGAAGGATGCAGG - Intergenic
904522819 1:31109151-31109173 AGGAGGGAAGAGAAGGAGGAAGG - Intergenic
904625752 1:31800998-31801020 CAGAGCTTTGAGCAGGAGGAGGG - Intronic
904677672 1:32208244-32208266 ATGAGTATAGGGAAGGAGGAAGG + Exonic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904807737 1:33143572-33143594 AAGAGGAATGAGAACGAGGATGG - Intergenic
904999188 1:34654951-34654973 CACAAGGTAGAGAAGCAGGATGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905863772 1:41366172-41366194 CGGAGGACAAAGGAGGAGGAGGG - Intronic
905871061 1:41404848-41404870 CAGAGCCTAGTGAGGGAGGAGGG + Intergenic
906008339 1:42499578-42499600 GAGAGGCTGGAGCAGGAGGATGG - Intronic
906472097 1:46139671-46139693 AAGAGGAAAGACGAGGAGGATGG - Intronic
906592171 1:47035597-47035619 CAGCGGAGTGAGAAGGAGCATGG - Intronic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
906724668 1:48035578-48035600 CAAAGGAAAGAGCAGGGGGAGGG + Intergenic
906977188 1:50588524-50588546 GAGAGGGTAGAGAAGGAGAGAGG + Intronic
907063405 1:51454370-51454392 CAGAGAATAGAGTAGGAAAAGGG + Intronic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907974997 1:59423069-59423091 CAGAGGATTGTGTAGCAGGAGGG + Intronic
907998664 1:59658545-59658567 CATAGGATACAGAGTGAGGAGGG + Intronic
908028775 1:59977865-59977887 CTGAGGCTAAAGAAGGGGGAAGG - Intergenic
908056830 1:60296976-60296998 CAGCCCTTAGAGAAGGAGGAGGG + Intergenic
908080128 1:60568309-60568331 GAGAGGGGAGAGAGGGAGGAGGG - Intergenic
908207969 1:61870416-61870438 CACAGGATAGAGCAGGGCGAGGG + Intronic
908295972 1:62713443-62713465 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908574504 1:65444666-65444688 CAAAGGAGAGGAAAGGAGGAAGG + Intronic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
908668101 1:66514786-66514808 CAGAGGAAAGGGTGGGAGGAGGG + Intergenic
908678676 1:66634381-66634403 CAGAGAATAGTGAAGCAGCAAGG - Intronic
908849738 1:68363747-68363769 TAGAGGATAGAAAGGCAGGATGG + Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909461222 1:75916684-75916706 CAGAGGGTGGAGATGGAAGAGGG + Intergenic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
909524384 1:76606561-76606583 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909564504 1:77039569-77039591 CAGAGGATAGATAAGGCAGGGGG + Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909736692 1:78970744-78970766 GAGAGGACAGAGGAGGAGAAAGG - Intronic
909793275 1:79701558-79701580 CGGAGCAGAGAGCAGGAGGACGG + Intergenic
909993143 1:82247944-82247966 AAGATGATAGAGAAGGTGGGGGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910220051 1:84880822-84880844 CAGAGGGTACAGAAGAAGGAAGG + Intronic
910262720 1:85307651-85307673 CAGAGGACAGAGGAGGAGAGAGG - Intergenic
910529789 1:88222811-88222833 CAGAGGCTAGAAAAGTAGGCAGG + Intergenic
910668994 1:89754132-89754154 TAGAGGACAGAGAAGGAGAATGG - Intronic
911406665 1:97449346-97449368 CAGAGAATTGAGGAGGAGGGAGG + Intronic
911824148 1:102460209-102460231 CAGAGGAAAGAGATAGAGAAAGG - Intergenic
912111199 1:106345298-106345320 GAGAGAATAGAGAAGGAGAAAGG + Intergenic
912311483 1:108625655-108625677 CAGTAGATAGAGAAGGATGTAGG - Intronic
912368726 1:109156489-109156511 CAGGGGCTAGAGGAGCAGGATGG - Intronic
912499682 1:110113605-110113627 CAGAGGTGAGAGTGGGAGGAGGG + Exonic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912661907 1:111539242-111539264 GAGAGGGGAGAGAAGGAGGCAGG - Intronic
913085168 1:115430113-115430135 CAGAGAATGGAGAAAGAGAATGG - Intergenic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913373794 1:118129647-118129669 AAGAAGGAAGAGAAGGAGGATGG - Intronic
913404810 1:118477840-118477862 CAGAGGAAAGAGAAGATAGATGG - Intergenic
913482087 1:119298518-119298540 CAGAGTATAGGCAAGGATGAGGG - Intergenic
913971417 1:143420824-143420846 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914017675 1:143835522-143835544 AAGAGGAGAGAGAAGGGAGAAGG - Intergenic
914065794 1:144246437-144246459 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914113357 1:144719917-144719939 CAGAGTATTGAGGAGGTGGAGGG - Intergenic
914656285 1:149744057-149744079 AAGAGGAGAGAGAAGGGAGAAGG - Intergenic
915128953 1:153683975-153683997 CAGAGGAGAAAGAAAGAGAAGGG + Intronic
915334568 1:155133594-155133616 CCCAGCATAGAGATGGAGGAAGG - Intronic
915480048 1:156178270-156178292 CAGAGGGTAGAGGAGGAAGGTGG - Intergenic
915656514 1:157365359-157365381 GAGAGGACAGAGAAGGAGAAAGG + Intergenic
915672772 1:157504212-157504234 GAGAGGACAGAGAAGGAGAAAGG - Intergenic
915730783 1:158052679-158052701 CAGAGGATAAGGCAGGAGAATGG + Intronic
915770972 1:158423184-158423206 AATAAGATAGAGGAGGAGGAGGG - Intergenic
915895343 1:159807576-159807598 CTGAGGGTAGAGATGGAGGCTGG + Intronic
915982360 1:160428279-160428301 CAGAGGAAAGAGAAGACAGACGG - Exonic
915985224 1:160457865-160457887 AACAGGAAAGGGAAGGAGGAAGG + Intergenic
916266346 1:162893273-162893295 CAGAGGAGAGAAAGGGATGAAGG - Intergenic
916383383 1:164238858-164238880 CAGAGTATAGCTAGGGAGGAAGG - Intergenic
916937138 1:169640786-169640808 CAGAGGCTAGAGATGTAGGGAGG + Intergenic
917041242 1:170808474-170808496 CAGAGGAGAGACAGGGAGGAGGG + Intergenic
917253072 1:173083608-173083630 CAGGGTAGAGAGTAGGAGGAGGG + Intergenic
917557087 1:176101427-176101449 GAGAGGACAGAGGAGGAGAAAGG - Intronic
917968524 1:180193377-180193399 CAGAGGAGAGAGAGAGAGGCAGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918149132 1:181783012-181783034 CGGAGGAGACAGAACGAGGAAGG - Intronic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918469983 1:184861800-184861822 AAGAAGAGAGAGAAGGAGGGAGG + Intronic
918523414 1:185439541-185439563 GAGAGGATAGAGAAGGTGGGGGG + Intergenic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
918595481 1:186287968-186287990 GAAAGGAGAGAGAGGGAGGAAGG - Intergenic
918682021 1:187367595-187367617 CAGAGGAGAGAGAGGCAGGAAGG + Intergenic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
918720147 1:187842101-187842123 TAGAGGGGAGGGAAGGAGGAGGG - Intergenic
918879723 1:190101581-190101603 GAGAGGACAGAGAAAGAGAAAGG - Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920048003 1:203146039-203146061 CAGAGGAGCTGGAAGGAGGAAGG - Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920062107 1:203234015-203234037 CAGAGGCAAGAGAATTAGGAAGG - Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
920448597 1:206039477-206039499 AAGAGGATGGAGAAGGGGGATGG + Intronic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
921095589 1:211884801-211884823 CAGCTGATGGGGAAGGAGGATGG - Intergenic
921305585 1:213793232-213793254 TGGAGGAGAGAGAAGGAGGCTGG - Intergenic
921307961 1:213816012-213816034 CAGAGGAGAGAGAAAGAGACAGG + Intergenic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921325866 1:213985839-213985861 CGGAGAGCAGAGAAGGAGGAGGG - Intronic
921582478 1:216911427-216911449 CAGAGGTTGGGCAAGGAGGAGGG + Intronic
921755029 1:218845503-218845525 CAGGGAATAGGGAAGGAGGTAGG + Intergenic
921771885 1:219050405-219050427 AAGAAGGGAGAGAAGGAGGAAGG + Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922722598 1:227906386-227906408 AGGAGGATGGAGTAGGAGGAGGG - Intergenic
922920633 1:229299880-229299902 CAGAGGATAGAGGAGGTGTCAGG + Intronic
923265600 1:232310844-232310866 CAGTGGGTAGATAAGGAGGTGGG + Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923619328 1:235565193-235565215 CAGAGGCTAAAGAAAGAGGGTGG + Intronic
923990124 1:239427003-239427025 CAGAGGTGAGTGAAGGAGGTGGG + Intronic
924043483 1:240006285-240006307 CAGAAGAAAGAGAAGAAGCATGG - Intergenic
924163704 1:241260742-241260764 TAGAGGCTAGAGCAGTAGGATGG - Intronic
924187252 1:241506326-241506348 CAAAGTATAGGGAAGGATGAGGG + Intronic
924215966 1:241822884-241822906 CATAGAATGGAGAAGAAGGATGG - Intergenic
924405376 1:243739731-243739753 CTGAGGCTGGAAAAGGAGGAGGG - Intronic
924447051 1:244142856-244142878 CAGGAGATAGGGAAAGAGGAAGG - Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063159454 10:3408756-3408778 AGGAGGAAAGAGGAGGAGGAGGG + Intergenic
1063164813 10:3451676-3451698 TAGAGGAAAGAGGAGGAGGGAGG - Intergenic
1063187342 10:3663418-3663440 AAGGGGCTAGAGATGGAGGAAGG - Intergenic
1063481772 10:6382696-6382718 CAGAGGCTGGAGCAAGAGGAGGG - Intergenic
1063588303 10:7372842-7372864 CTGAGGCCAGACAAGGAGGATGG - Intronic
1063684677 10:8225485-8225507 CAGAGGAGAGAGTAGGAGTGAGG + Intergenic
1063858604 10:10283571-10283593 CAGAGGAGGGGAAAGGAGGAGGG - Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064331848 10:14401592-14401614 CTGAGCATGGAGAGGGAGGAGGG - Intronic
1064376346 10:14799966-14799988 TAGAGGAGAAAGAAGGAGGCAGG + Intergenic
1064689964 10:17906388-17906410 AAGAGGAAAGACAAAGAGGAAGG - Intronic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1065881126 10:30038743-30038765 GAGAGAAGAGAGAAGCAGGATGG + Intronic
1066027053 10:31369359-31369381 CAGAGGCTAGGGTAGGAGGGTGG - Intronic
1066076298 10:31881044-31881066 AGGGGGATAGAGATGGAGGAGGG - Intronic
1066248008 10:33603316-33603338 GAGAGGCAGGAGAAGGAGGAAGG + Intergenic
1066280497 10:33912921-33912943 CAGTGGATTGTGCAGGAGGAGGG + Intergenic
1066334512 10:34462865-34462887 AAGAGGAAAGAGAAGGGGAAGGG + Intronic
1066562606 10:36686891-36686913 AAGAGGGAAGAGGAGGAGGAAGG + Intergenic
1066710740 10:38230877-38230899 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
1066979275 10:42396623-42396645 GAGAGGACAGAGGAGGAGAAAGG + Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1069060626 10:63891072-63891094 CAAAGGGGAAAGAAGGAGGAGGG - Intergenic
1069245719 10:66202759-66202781 GAGAGGAAAGAGAAGTAGTATGG - Intronic
1069595101 10:69665199-69665221 TAGAGGCTGGAGGAGGAGGAGGG + Intergenic
1069854375 10:71431739-71431761 GAGAGAATAGAGCAGGGGGAAGG - Intronic
1069906369 10:71734842-71734864 CAGAGGACAGAGTTGGAGGCAGG - Intronic
1070289767 10:75106573-75106595 CAGAGGATCGGGAAGGTGGGGGG - Intronic
1070307849 10:75250505-75250527 GAAAGAGTAGAGAAGGAGGAGGG + Intergenic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070711665 10:78687432-78687454 CAGAGACTGGAGATGGAGGAAGG + Intergenic
1070727014 10:78799345-78799367 CAGAGGAAAGAAAAGGTAGAAGG - Intergenic
1071114410 10:82200724-82200746 CAGAGGATAAAGAAAGAGAAAGG - Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071160687 10:82742109-82742131 CAGACGAGAGAGAGGGAGGAAGG - Intronic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071301723 10:84261236-84261258 CAGAGGAGAGGCAGGGAGGAAGG + Intergenic
1071384309 10:85104231-85104253 CAGAGGATGGAGCAGCAGGGAGG - Intergenic
1071412101 10:85407107-85407129 CAAATGAGAGAGAAGCAGGAGGG - Intergenic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1071877767 10:89861338-89861360 GAGAGGGAAGAGGAGGAGGAGGG - Intergenic
1072227459 10:93383817-93383839 CACAGGATGGAGAAGGATCATGG + Intronic
1072251474 10:93585590-93585612 AGGAGGACAGAGAAGGAGGATGG + Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072439280 10:95439409-95439431 CAAGGGCCAGAGAAGGAGGAAGG - Intronic
1072613046 10:97031681-97031703 CGGAGGAAGGAGATGGAGGAAGG + Intronic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073181192 10:101584574-101584596 CAGGGGCTAGAGTGGGAGGAGGG - Intronic
1073407337 10:103309425-103309447 CAGAAGAGAGAGAATAAGGAGGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073677941 10:105670872-105670894 CAAAGGTGAGACAAGGAGGATGG + Intergenic
1073703244 10:105954154-105954176 CAAAGGAAAGAACAGGAGGAAGG + Intergenic
1073748881 10:106501274-106501296 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
1073956021 10:108872309-108872331 GAGAGGTAAGGGAAGGAGGAGGG + Intergenic
1074487398 10:113899120-113899142 GAGAAGAGAGAGAAAGAGGAAGG - Intronic
1074512432 10:114127954-114127976 CAAAGCAGAGAGGAGGAGGAAGG + Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075121248 10:119666489-119666511 GACAGGAGAGAGAGGGAGGAAGG - Intronic
1075192782 10:120326326-120326348 CAGAGAGTAGAAAAGAAGGAAGG - Intergenic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075344495 10:121672193-121672215 AAATGGATAGAGAAGAAGGAAGG - Intergenic
1075354965 10:121763585-121763607 CAGAGGATGGAGATGCGGGAGGG + Intronic
1075661575 10:124200561-124200583 GGGAGGAAAGAGAAGGAGGTAGG + Intergenic
1075680808 10:124329952-124329974 CAGGGGATGGAGAAGAAGAATGG - Intergenic
1075852040 10:125597168-125597190 CAGTGGATAGAGAAGACAGATGG - Intronic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076448886 10:130541508-130541530 AAGAAGAGAGGGAAGGAGGAAGG - Intergenic
1076833720 10:133009573-133009595 AGGAGGAAAGAGAAGGAGGTGGG + Intergenic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1077007997 11:368254-368276 CAGAAGTTAGGGGAGGAGGATGG + Intergenic
1077332535 11:1989779-1989801 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1077345235 11:2045337-2045359 CGGAGTATAAAGAAAGAGGATGG - Intergenic
1077392564 11:2306887-2306909 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1077944530 11:6880733-6880755 CAGAGGTTAGAGAAGACAGAAGG + Intergenic
1078128137 11:8588049-8588071 GAGAGGACAGAGCAGGAAGATGG - Intronic
1078173047 11:8944419-8944441 AAGGGGTTAGAGAAGGAGGAGGG - Intergenic
1078316153 11:10294473-10294495 AACAGAATAGAGAAGGCGGAAGG - Intergenic
1078323369 11:10357345-10357367 CAGAGGAAAGAGAAGACAGAAGG + Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078749219 11:14143888-14143910 CAGAGGTCAGAGAAAGAGTATGG + Intronic
1078914296 11:15763806-15763828 AAGAAGAGAGAGAAGGAGGGAGG + Intergenic
1078941428 11:16010675-16010697 GAGAGCAGAGAGAAAGAGGAGGG + Intronic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079016201 11:16870804-16870826 CAGAAGATATAGCAGGAGAAAGG + Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1079140510 11:17806269-17806291 GCAAGGAAAGAGAAGGAGGAAGG + Intronic
1079320507 11:19447948-19447970 CAGAGGAGAGAGAGGAAGGTGGG - Intronic
1079329266 11:19520596-19520618 TAGAGGATGGGAAAGGAGGAAGG - Intronic
1079378840 11:19918903-19918925 CAGAGCATAAAGCAGAAGGAAGG - Intronic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1079666211 11:23109196-23109218 CCAAAGATAGAGAAGGAGGTTGG + Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080515310 11:33014909-33014931 GTGAGGAGAGAAAAGGAGGAAGG - Intergenic
1080597975 11:33792486-33792508 CAGAGGAAAGAGAACGTGAAAGG + Intergenic
1080806926 11:35662604-35662626 AGGAGGAGGGAGAAGGAGGATGG - Intergenic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081462105 11:43281426-43281448 CAAGGGATAGAGCAGGAGGCAGG - Intergenic
1081906622 11:46674415-46674437 GAGAGGTTGGAGGAGGAGGAGGG - Intronic
1082216986 11:49583380-49583402 GGAAGGAAAGAGAAGGAGGATGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083311930 11:61788183-61788205 CAAAGGAGAGAGAAGAAGGGAGG - Exonic
1083342614 11:61968101-61968123 CAGATGATTGGGAAGGTGGAAGG + Intergenic
1083402450 11:62433304-62433326 AAGAGGAAAGAGAAAGGGGAGGG + Intergenic
1083487130 11:62990284-62990306 AAGAGGAAAGAGAATGAGAAGGG - Intronic
1083520483 11:63306247-63306269 CAGAGGCTAGGGAAGGAAGAAGG - Intronic
1083602127 11:63955312-63955334 CAGAGGAGAAAGAACGACGAGGG - Exonic
1083630122 11:64091036-64091058 AAGAAGACAGAGGAGGAGGAGGG + Intronic
1083741783 11:64715042-64715064 AAGAGGGGAGAGAAAGAGGAAGG + Intronic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083777050 11:64899204-64899226 CATAGAATAGAGAAGGGGTAGGG - Intronic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084440198 11:69168289-69168311 GAGAGGGTAGAGAGGGAGAAGGG + Intergenic
1084588961 11:70079192-70079214 CAGAGGATAGTGAAGCAGTGGGG - Intronic
1084695036 11:70747973-70747995 AAGAGGAGAGGGAAGGAGGCAGG + Intronic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085294453 11:75423240-75423262 CAGGGGATGGAGAAGAAGGTAGG + Intronic
1085510697 11:77086704-77086726 CAGGGGATGGAGTGGGAGGAGGG - Intronic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1085763762 11:79264488-79264510 CAGAGCTTAGAGCAGGGGGACGG - Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086259073 11:84916047-84916069 CAGAGGATTAAGAAGCAGGCCGG + Intronic
1086302177 11:85438843-85438865 CAGAGGGTAGAGATAGAGGTGGG - Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086469641 11:87094514-87094536 CAGAGGAAAGACTAGGCGGAGGG - Intronic
1086497732 11:87421586-87421608 AGGAGGACAGAGAAGCAGGATGG - Intergenic
1086560580 11:88163940-88163962 CAGTGGATAAAGCAGGGGGAAGG + Intronic
1086595899 11:88570035-88570057 CAAAGGAAAGAGAAGGGGAAGGG + Intronic
1086632568 11:89040786-89040808 GGAAGGAAAGAGAAGGAGGATGG + Intronic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1087781400 11:102304660-102304682 AAGAGGATAAAAGAGGAGGAGGG + Intergenic
1087837644 11:102890897-102890919 AAGAGGCAAGAAAAGGAGGAAGG - Intergenic
1087970140 11:104470429-104470451 AAGAGGATCGAGATGGAAGAAGG + Intergenic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088422548 11:109665505-109665527 CAAAGGATATAGAAGGAGTGGGG - Intergenic
1088630774 11:111772019-111772041 CAGAGGTAGGAGATGGAGGAGGG - Intergenic
1088650078 11:111949774-111949796 CAGAGGTGATGGAAGGAGGAAGG - Intronic
1089304394 11:117517540-117517562 CAGAGGAGAGGGCAGGAGGGTGG + Intronic
1089770965 11:120802619-120802641 GGGAGGCTGGAGAAGGAGGAGGG + Intronic
1090429972 11:126637474-126637496 CAGAGGCTTGAGCAGGAGGCTGG - Intronic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1090623550 11:128584849-128584871 GGGAGGAAAGGGAAGGAGGAGGG + Intronic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1090705207 11:129329878-129329900 GAGAGGAGAGAGCAGGAAGAGGG + Intergenic
1091121082 11:133058192-133058214 CAAACCATAGAGGAGGAGGAAGG + Intronic
1202815516 11_KI270721v1_random:44955-44977 TAGAGGGAAGAGGAGGAGGACGG + Intergenic
1091386690 12:100523-100545 CAGAGGTCAGAGAAAGAGGCGGG + Intronic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1091800719 12:3323054-3323076 GAGAGGAGGGAGAAGAAGGAAGG + Intergenic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091915855 12:4271518-4271540 GAGAGGCGAGAGAAGGAGGGAGG - Intergenic
1092078555 12:5693678-5693700 CAGTGGCTGGAGAAGAAGGAAGG - Intronic
1092195882 12:6549536-6549558 CAGAGGAGAGAGAGGGGGAAGGG + Intronic
1092230033 12:6770992-6771014 AAAAGGGTAGAGAGGGAGGAGGG + Intergenic
1092291255 12:7160553-7160575 AAGAGGCCAGAGAAGGAGGAAGG - Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092623756 12:10303188-10303210 AAGAGGTCAGAGAAGCAGGACGG - Intergenic
1092880959 12:12887614-12887636 CAGAGGATAAAGATCGAGTATGG + Intergenic
1092891424 12:12972735-12972757 CAGAGAATAAAAAAGGAAGAAGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1093671159 12:21877705-21877727 AAAAGGAGAGAGAAGGAGGTGGG + Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094165111 12:27435550-27435572 GAGAGGAGAGAGATGGGGGATGG - Intergenic
1094165170 12:27436072-27436094 CACATGATAGAAAAGGAGAAAGG + Intergenic
1094488668 12:30945105-30945127 CTGAGGGCAGAAAAGGAGGAGGG - Intronic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1094742166 12:33302239-33302261 CAGAGGAATGAGAGGCAGGAAGG + Intergenic
1095055114 12:37589242-37589264 CAGAGGCTTGAGCAGAAGGAAGG - Intergenic
1095399845 12:41801408-41801430 CAGATGAAAGAGAAGAATGATGG + Intergenic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1095762247 12:45852605-45852627 CAGATGATAGGGCAGGAGAATGG - Exonic
1096016480 12:48280747-48280769 CAGATACCAGAGAAGGAGGAAGG - Intergenic
1096531957 12:52248147-52248169 CAGAGGACAGACAGTGAGGACGG - Intronic
1096665165 12:53159715-53159737 GAGAGGAATGAGAAAGAGGAAGG + Intronic
1096805912 12:54141032-54141054 CAGAGGCCAGAGCAGGAGGGAGG + Intergenic
1097155894 12:57012166-57012188 CAGAGGAAAGAGATGAAAGACGG + Exonic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1097520352 12:60661304-60661326 GAGAGGGGAGGGAAGGAGGAGGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098512896 12:71339794-71339816 GAGCGGGAAGAGAAGGAGGAGGG + Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098619544 12:72577516-72577538 CAGAGGATATAGAAGGACTGAGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098852749 12:75616962-75616984 CAGGGGAATGAGTAGGAGGAGGG + Intergenic
1099127330 12:78778915-78778937 CAAATGCTAGAGAAGCAGGAAGG - Intergenic
1099728570 12:86467216-86467238 CAGAGGAGAGAGAAAGAATAAGG - Intronic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100368617 12:93944196-93944218 CAAAGGATAGAGAAGCATGTAGG - Intergenic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1102018462 12:109664249-109664271 CAGAGGCTAGAACATGAGGAGGG + Intergenic
1102069883 12:110009671-110009693 CAGATGAGAGAGATGCAGGAAGG + Intronic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102143648 12:110637646-110637668 AAGAGGAGAGAGAAGGAGACTGG - Intronic
1102185143 12:110941826-110941848 AAGAGGAGAGAGTAGGAGGGGGG - Intergenic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102598745 12:114012888-114012910 GGGAGGAGGGAGAAGGAGGAGGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102835300 12:116052263-116052285 CACAGGATAGAGAAACAGAAAGG + Intronic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1104517771 12:129443582-129443604 GAAAGAATAGAGAAAGAGGAAGG - Intronic
1104739410 12:131162061-131162083 CAGAAGGTAGAGAAGGATAATGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105208949 13:18246723-18246745 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1105250239 13:18692658-18692680 AAGAGGATAAAGTATGAGGAAGG - Intergenic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105814106 13:24017734-24017756 TAAAGGAGAAAGAAGGAGGAAGG - Intronic
1105923371 13:24985071-24985093 CAGAAGATACAGCAGGAGAAGGG + Intergenic
1105965654 13:25382086-25382108 CGGAGGTTAGAGAGGAAGGATGG - Intronic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1106602424 13:31199725-31199747 CAGAGGAGAAAGGAAGAGGAGGG + Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106859018 13:33884853-33884875 CAGAGGAAAGAAAAAGAGAAAGG + Intronic
1106866018 13:33964903-33964925 AAGAGGACAGACAACGAGGAGGG + Intronic
1107180518 13:37453525-37453547 CAAAGGATTGACAAGGATGATGG - Intergenic
1107265279 13:38546117-38546139 CAGAGTCTGGAGAAGGAGCATGG + Intergenic
1107788483 13:43977786-43977808 GAGAGGGGAGAGAGGGAGGAAGG - Intergenic
1107879706 13:44822305-44822327 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108475270 13:50810146-50810168 GAAAGTATAGAGAATGAGGATGG - Intronic
1109014393 13:56991226-56991248 GCTAGGATAGAGAAGGAGAAAGG + Intergenic
1109239557 13:59868718-59868740 CTGAGGAGAGGGAAGAAGGAAGG - Intronic
1109702049 13:66038970-66038992 GGGAGGAAAGAAAAGGAGGAAGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1109826050 13:67723564-67723586 GAAAGGATAGAAAAGAAGGAAGG - Intergenic
1110186580 13:72682040-72682062 CACAGCATAAAGAATGAGGAAGG + Intergenic
1110240261 13:73258894-73258916 CAGAAGATAGAGGGAGAGGAGGG + Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1111182412 13:84686584-84686606 CACAGGAGAAAGAAGGAGGCTGG - Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1111861713 13:93715458-93715480 AAGAGGGGAGGGAAGGAGGAAGG + Intronic
1111986483 13:95071261-95071283 CAAAGGATGGAGGAGGAGAAAGG + Intronic
1112364689 13:98746876-98746898 CAGAGGCTTAAGAAGGAGGAAGG - Intronic
1112555351 13:100463066-100463088 CTGATGATGGAGAAAGAGGACGG + Intronic
1112584507 13:100706288-100706310 GAGAGGAAAGAAAAGAAGGAAGG - Intergenic
1113149987 13:107252481-107252503 GAGAGGAGAAGGAAGGAGGAGGG + Intronic
1113422519 13:110181600-110181622 GAAAGGAGAGAGAAAGAGGAGGG - Intronic
1113437170 13:110302165-110302187 CAGAGGATAAAGAAGAGGAAAGG + Intronic
1113933465 13:113980916-113980938 GAGAGGAGTGAGCAGGAGGATGG + Intronic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114479706 14:23025143-23025165 CAGGGGATAGAGGAGGTTGATGG - Intronic
1115378709 14:32708813-32708835 CTGAGGAAAGCTAAGGAGGAAGG - Intronic
1115620117 14:35132830-35132852 CAAAGGAAAGGGAAGGAAGAAGG + Intronic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116389945 14:44380089-44380111 GAGAGAATTGAGAAGGAGAAAGG + Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1116825356 14:49668278-49668300 GAAAGGAAAGGGAAGGAGGAAGG + Intronic
1116895430 14:50311437-50311459 CAGAGGACAGAGAAAGACAATGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117834341 14:59786624-59786646 TATAGGATAAAGAGGGAGGATGG + Intronic
1117899523 14:60517334-60517356 CAGAGGAGAGAAAAGGTGGGAGG - Intergenic
1117983279 14:61363029-61363051 CGGGTGAGAGAGAAGGAGGAAGG + Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118110756 14:62716435-62716457 CAGAGGTTAGAGAAGTAGGTAGG - Intronic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1118952283 14:70445825-70445847 CAGAGGACAGAGGAGGAAAAAGG + Intergenic
1118998016 14:70854891-70854913 ATGAGGATTGAGAAGGATGATGG + Intergenic
1119182528 14:72614432-72614454 CAGAGGGGAGAGGAGCAGGATGG + Intergenic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1119692191 14:76683178-76683200 CAGAGGATAGAAAAGCAGCAAGG - Intergenic
1120167970 14:81220675-81220697 GAGCGGAGAGAGGAGGAGGAGGG + Exonic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120625936 14:86826556-86826578 CAGAAGAAAGAGAAAGAGGAGGG + Intergenic
1120843677 14:89108238-89108260 AAGAGGATAGAGAAGCAGGAAGG - Intergenic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121029091 14:90642713-90642735 CAGAGGAAAGATAAGAAGGTAGG + Intronic
1121301252 14:92873021-92873043 CAGAGGTTTGGGCAGGAGGAAGG + Intergenic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1121748044 14:96318206-96318228 CAAAGAACAGAAAAGGAGGACGG + Intronic
1121760006 14:96436772-96436794 CAGAGAGAAGGGAAGGAGGAGGG - Intronic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1122079034 14:99254240-99254262 TAAATGATAGAGAAGTAGGAAGG - Intronic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122617344 14:103028693-103028715 CACAGAATATAGAAGGAGGCAGG - Intronic
1124872731 15:33559084-33559106 CAGAGGGTAAAGGAGGAGGTTGG + Intronic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125162774 15:36665548-36665570 GTTAGGATAGAGAAAGAGGATGG + Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125668576 15:41452627-41452649 CAGAGGCTAAAGTGGGAGGATGG + Intronic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126684208 15:51233187-51233209 AAAAGAATAGGGAAGGAGGATGG - Intronic
1126694027 15:51310813-51310835 CAGAGGAAAGAGGGGGAGAAAGG + Intronic
1126821607 15:52509868-52509890 AAGAGATTAGAGAAGGAGAATGG - Intronic
1126919712 15:53507530-53507552 CAGAGGACAGGGAAGGCAGATGG - Intergenic
1127568276 15:60214914-60214936 AAAAGGAGAGAGAAGGAGGAAGG + Intergenic
1127845974 15:62871340-62871362 AAGAGGTGAGAGAAAGAGGAAGG + Intergenic
1127967395 15:63932608-63932630 CAGTAGCTTGAGAAGGAGGAAGG + Intronic
1128145082 15:65328566-65328588 AAGAGGAGAGAGATAGAGGAAGG - Exonic
1128609128 15:69059846-69059868 AAGAGAAGAGAGAAGGAGCAAGG + Intronic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1129301056 15:74625785-74625807 CACAGGCTGGAGGAGGAGGATGG - Exonic
1129815856 15:78553127-78553149 CGGAGGACAGAGAAAGAGGAAGG + Intergenic
1129887877 15:79051369-79051391 CAAAGGATCGAAAAGGGGGAGGG - Intronic
1130042544 15:80417531-80417553 GAGAAGGAAGAGAAGGAGGAGGG - Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130398246 15:83523740-83523762 AAGAAGAGAGAGAAGGAGGGAGG - Intronic
1130894380 15:88158969-88158991 CAAGGGATAGAGAGGGAGAAGGG + Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131751027 15:95508510-95508532 GAGAGGAGAGGGGAGGAGGAGGG - Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1131802701 15:96088027-96088049 ATGAGGTTAGAGAAGGGGGAAGG - Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132447313 15:101936187-101936209 AAAAGGAAAGAAAAGGAGGAAGG + Intergenic
1132504171 16:298397-298419 CTGAGGATGGAGAGGCAGGACGG + Intronic
1133392805 16:5422947-5422969 GGGAGGAAAGAGGAGGAGGAGGG + Intergenic
1133392843 16:5423057-5423079 GGGAGGAAAGAGGAGGAGGAAGG + Intergenic
1133444870 16:5851412-5851434 CAGAGGAAAATTAAGGAGGAGGG - Intergenic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1133520183 16:6549264-6549286 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133520278 16:6549518-6549540 GAGAGGAGGGAGGAGGAGGAGGG + Intronic
1133526138 16:6607585-6607607 GAGAGGAGAGAGAGAGAGGAGGG - Intronic
1133849659 16:9490252-9490274 AGGAGGAGAGAGAAGGAGGGAGG + Intergenic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134523208 16:14927828-14927850 GAGAGGGGAGAGAAGGGGGAGGG - Intronic
1134599028 16:15518856-15518878 GGGAGGAAAGAAAAGGAGGAAGG + Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1135161589 16:20101405-20101427 GAGGTGATAGAGAAAGAGGAAGG + Intergenic
1135183081 16:20291920-20291942 CAGGGGAGAGAGGAGGGGGAGGG + Intergenic
1135282591 16:21165557-21165579 GAGAGGGAAGAGAAGGGGGAGGG - Intronic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135886529 16:26314577-26314599 GGGAGGAGAGAGGAGGAGGATGG - Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1136698206 16:32105613-32105635 AAGAGGAAAGGGAGGGAGGAAGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1137864005 16:51875198-51875220 AGGAGGAGAGAGAAGGAAGAAGG + Intergenic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1138182661 16:54952756-54952778 AAGAAGATAGAGATGGAGAAAGG - Intergenic
1138234499 16:55370558-55370580 CAGCCGCTGGAGAAGGAGGAAGG - Intergenic
1138505343 16:57475715-57475737 AGGAGGAGAGAGAAGGAGGAGGG - Intronic
1138607734 16:58099602-58099624 CAGAGGATAGAGACGGGCCAGGG - Intergenic
1138749217 16:59398631-59398653 CTGAGGATTGAGAAGGAGCCAGG - Intergenic
1138811507 16:60156114-60156136 CAGAGGTTAGAGAAGAGGGAGGG + Intergenic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1139310748 16:66026049-66026071 AGGAGGAAAGAGACGGAGGAGGG + Intergenic
1139770829 16:69274971-69274993 AAAAGGAAAGGGAAGGAGGAAGG - Intronic
1139776849 16:69321774-69321796 CAGAGGATGGAGATGGAGCAGGG + Intronic
1140212842 16:72984252-72984274 CAGTAGATAGACTAGGAGGAAGG - Intronic
1140219966 16:73036602-73036624 TAGAGGGTAGAGGAAGAGGAGGG + Intronic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140540093 16:75749102-75749124 AAAAGGAAAGGGAAGGAGGAAGG + Intronic
1140723120 16:77788722-77788744 CAAATGATCGAGAAGGAGGCAGG + Exonic
1140903612 16:79392330-79392352 GAGAGGAGAGAGAAGGAAGGAGG + Intergenic
1141034502 16:80615860-80615882 CCGAGGTGAGAGAAAGAGGATGG - Intronic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141185700 16:81785558-81785580 GACAGGATAGAGAAGGATGTTGG + Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141805684 16:86340064-86340086 CAGAGGCTGGAGAGGGAGGTGGG - Intergenic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1142225688 16:88876595-88876617 GAGAGGATAGAGAAGACAGAGGG + Exonic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1203141803 16_KI270728v1_random:1771761-1771783 GAGATGATAGAGGAGGAGGAGGG - Intergenic
1203141815 16_KI270728v1_random:1771813-1771835 GAGATGATGGAGGAGGAGGAGGG - Intergenic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1142958222 17:3535383-3535405 GAGAGGAGGGAGAGGGAGGAGGG - Intronic
1143470813 17:7174068-7174090 CTGAGGAGAGAGAAGGCGGGTGG + Intronic
1143593671 17:7901214-7901236 GGGAGGAGAGAGGAGGAGGAGGG - Intronic
1145029608 17:19494904-19494926 CAGAGGCTCTAGAAGGAGCAGGG + Intergenic
1145115210 17:20203908-20203930 CAGATGGCAGAGAAGGAAGAAGG - Intronic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1145350640 17:22079367-22079389 CAGAGAGTAAAGAAGGACGAAGG - Intergenic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1145727161 17:27140809-27140831 AAGAGGAGAAAGGAGGAGGAAGG - Intergenic
1145856087 17:28159189-28159211 AAGAGGTCAGAGAAGGAAGAAGG + Intronic
1146034281 17:29391501-29391523 TAGAGGATGGGGAAGGGGGAAGG - Intronic
1146266706 17:31457721-31457743 CAGAGGGTAGGGCAGCAGGAGGG - Intronic
1146274179 17:31504735-31504757 TTGAGGATAAACAAGGAGGATGG - Intronic
1146487821 17:33258403-33258425 TAAGGGACAGAGAAGGAGGATGG + Intronic
1146512388 17:33461332-33461354 CAGAGGATAGAGAAGGGCAATGG - Intronic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146811193 17:35904966-35904988 CAGAGGAAAGAGAATGAAGTGGG - Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1147161294 17:38570847-38570869 CAAAGGATAAAGATGGAAGAGGG + Intronic
1147320340 17:39642221-39642243 CAGAGGAGGGTTAAGGAGGAGGG - Intronic
1147440672 17:40445470-40445492 CAGAGGATTGAGGAAGTGGAGGG - Intronic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147555728 17:41477775-41477797 TAGAGGTCAGAGAAGGAGCAAGG + Intronic
1147555748 17:41477899-41477921 TAGAGGTCAGAGAAGGAGCAAGG + Intronic
1147600297 17:41740979-41741001 CAGAGGATGGAGATAAAGGAAGG + Intergenic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148282641 17:46361155-46361177 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148304859 17:46579080-46579102 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148343788 17:46890122-46890144 AAGAGGAGCGAGGAGGAGGAGGG - Intergenic
1148777041 17:50101773-50101795 CCCAGGAATGAGAAGGAGGAGGG - Intronic
1149381461 17:56098183-56098205 TAGAGCCTAGAGAAGGAGGATGG + Intergenic
1150024530 17:61658938-61658960 CAGAAGATAGGGAAGGGAGAAGG - Intergenic
1150318458 17:64189509-64189531 CAGAGGATAGGAAATGAGGATGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150637999 17:66929756-66929778 AAGAGGAGAGAGAGGAAGGAGGG + Intergenic
1151345810 17:73500549-73500571 GGGAGGATGGAGAAGGATGAAGG - Intronic
1151345819 17:73500594-73500616 TGGAGGAGATAGAAGGAGGATGG - Intronic
1151345844 17:73500702-73500724 CAGAGGATGGAGGAGACGGAAGG - Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151826594 17:76527408-76527430 CAGAAACTAGAAAAGGAGGACGG + Exonic
1151840015 17:76611011-76611033 CACAGCAAAGAGCAGGAGGATGG + Intergenic
1152031204 17:77844581-77844603 CAGGGGCTGGAGGAGGAGGAAGG + Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152291446 17:79442190-79442212 CAGAAGAGAGAGGAGGAGGGAGG + Intronic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1152598424 17:81249416-81249438 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152598447 17:81249488-81249510 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152739620 17:82013227-82013249 GAGGGGATGGAGACGGAGGAAGG - Intronic
1153022798 18:646708-646730 GAGAGGACAGAGTGGGAGGAGGG - Intronic
1153322381 18:3785829-3785851 CAGAGGATTGAAAGGGAGCAGGG + Intronic
1153857232 18:9161965-9161987 AGGAGGCTAGAGCAGGAGGATGG - Intronic
1153904660 18:9650482-9650504 GGGAGGAGAGAGGAGGAGGAAGG + Intergenic
1153987791 18:10368595-10368617 GAGAGCAGAGAGAGGGAGGAAGG + Intergenic
1154067978 18:11127055-11127077 TGGAGGAGAGAGAAGGAGGCAGG + Intronic
1155066538 18:22273768-22273790 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155066546 18:22273791-22273813 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155279848 18:24228307-24228329 CAAAGTATAGAGGAGGAGTAAGG - Intronic
1155326163 18:24666963-24666985 GAGAGGAAAGAGAAAGGGGAAGG - Intergenic
1155466482 18:26141574-26141596 GATAGGATAGGGAGGGAGGATGG + Intronic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1157523428 18:48361036-48361058 TAGAGGCTAGGGAGGGAGGAAGG + Intronic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1158391892 18:57051188-57051210 CAGGGGATAGAGAGGAGGGAGGG - Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1158624036 18:59056572-59056594 GAGAGGATCGAGAAGGAGGATGG - Intergenic
1158937011 18:62373829-62373851 CTGAGGACAGAGGAGGATGAGGG - Intronic
1159058749 18:63492732-63492754 CAGAGGAGAATGAAGGAGCAGGG - Intronic
1159183131 18:64935881-64935903 TAGAGTATAGAGAGGAAGGATGG - Intergenic
1159546505 18:69845573-69845595 GAGAGAATAGAGAGGCAGGATGG + Exonic
1159550420 18:69889769-69889791 TATAGGATTGACAAGGAGGAAGG - Intronic
1159629595 18:70734237-70734259 CAGAGGATAGAGAATCAGTTAGG + Intergenic
1159673587 18:71253367-71253389 AACAGGATAGAGAGGGAGAAAGG - Intergenic
1160201414 18:76799159-76799181 CAGAGGAAAGAGAAAGAATAAGG + Intronic
1160237670 18:77098935-77098957 AGGAGGAGTGAGAAGGAGGAGGG - Intronic
1160383654 18:78479795-78479817 CTGAGGAAAGAAAAGGAGAAAGG - Intergenic
1160448626 18:78946975-78946997 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1160570803 18:79816398-79816420 CAGAGGGCAGAGAAGGGGGAGGG - Intergenic
1160637963 19:96346-96368 AAAAGGAAAGAAAAGGAGGAAGG - Intergenic
1160665659 19:326846-326868 CAGAGGCTTGTGAAGGAGGCCGG + Intronic
1160675662 19:389974-389996 CGGAGGACAGAGAAAGAGGGAGG - Intergenic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1160705125 19:525947-525969 CAGAGGGGAGGGGAGGAGGAGGG + Intergenic
1160786331 19:901623-901645 GAGATGATAAAAAAGGAGGAAGG - Intronic
1161404052 19:4081965-4081987 AAGAGGAGAGAGGAGGAGCAGGG - Intergenic
1161414749 19:4139716-4139738 CAAGGGGGAGAGAAGGAGGAGGG + Intergenic
1161615768 19:5269417-5269439 CAGATGGCAGAGGAGGAGGAAGG + Intronic
1161957893 19:7506483-7506505 GAGAGGATGGAGAAGGGGCAGGG - Intronic
1161970658 19:7578044-7578066 AAGAGGACACCGAAGGAGGAAGG + Intergenic
1162206198 19:9058094-9058116 CAGAGGTCAGAGTAGCAGGAAGG + Intergenic
1162424775 19:10588005-10588027 CAGAGGAGAAAGAAGGTGAATGG - Intergenic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1162783122 19:13017507-13017529 CACAGGAGAGACAAGGAGCAAGG - Intronic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164521289 19:28982174-28982196 GAGAGGGAGGAGAAGGAGGAAGG + Intergenic
1164798171 19:31053385-31053407 CAGAGCATTGAGAGGGAGCATGG - Intergenic
1164859421 19:31551163-31551185 AAGAGGGGAGAGAAGGAGAAGGG - Intergenic
1164868676 19:31625758-31625780 GAGAGGGAAGAGGAGGAGGAGGG - Intergenic
1165416031 19:35694085-35694107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165788746 19:38478147-38478169 GAGATGACAGAGAAGGAGAAGGG - Intronic
1165796585 19:38523475-38523497 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165796601 19:38523551-38523573 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165828600 19:38719514-38719536 GAGTGGATAGTGAGGGAGGAAGG + Intronic
1165844277 19:38808296-38808318 GAGAGAACAGAGAAAGAGGAAGG + Intronic
1165880027 19:39035885-39035907 CAGAGGCTAAGGCAGGAGGATGG - Intergenic
1166157454 19:40924569-40924591 CAGAGCATAGTGAAGCATGATGG + Intergenic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167455284 19:49594564-49594586 GAGAGGAGAGAGGAGGCGGAGGG - Exonic
1167628400 19:50607525-50607547 CAGGGGACTGAGAAAGAGGATGG - Intergenic
1167634918 19:50648891-50648913 GAGAGGATAGAGATGGGGCAAGG + Intronic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1168357862 19:55713627-55713649 GAGAGGGGAGAGGAGGAGGAGGG - Intronic
1168433809 19:56302326-56302348 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
1168520684 19:57048084-57048106 GAGATGGTAGAGAAGGTGGAGGG - Intergenic
1202682845 1_KI270712v1_random:25116-25138 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
925188698 2:1866405-1866427 GGGAGGAGAGAGAAGGAGGCAGG + Intronic
925205547 2:2002908-2002930 CAGAAGGTAAAGAAGGAGCAAGG - Intronic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
925541440 2:4971989-4972011 GAGAGGGAGGAGAAGGAGGAAGG - Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925647033 2:6045679-6045701 CAGAGTATTGAGAGGGAGCACGG + Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925894757 2:8462832-8462854 CAGATGTCAGAGAAGGAGAAAGG + Intergenic
925974791 2:9134494-9134516 CAGAGGATTGAGAAGCGAGAGGG + Intergenic
926109499 2:10172969-10172991 GAGAGGACAGACAAGGAAGACGG - Intronic
926179473 2:10628498-10628520 CAATGGATAGAGTAGGAGAAGGG - Intronic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926592108 2:14750968-14750990 GAGAGGAAAGAAAAGGATGAGGG + Intergenic
927250262 2:20990184-20990206 AAGAGGAAAGGGAAAGAGGATGG - Intergenic
927276285 2:21265115-21265137 CAGTGGATGGAGATGAAGGAAGG - Intergenic
927282517 2:21321861-21321883 CAGAGGATGGAGAGGCAGGGTGG - Intergenic
927352491 2:22133754-22133776 CAAATGATAGAGAGGGAGGAGGG - Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927710810 2:25324740-25324762 CTGGGGATGGATAAGGAGGAGGG + Intronic
928105803 2:28469991-28470013 GAGAAGAAAGAGGAGGAGGAGGG + Intronic
928128170 2:28630270-28630292 CACAGGCTTGGGAAGGAGGAAGG + Intronic
928164191 2:28957760-28957782 CATAGGATAGGGAAGGAGTAGGG + Intronic
928738036 2:34315434-34315456 CAGAGGATTGAGAAACAGGAGGG - Intergenic
928844368 2:35651988-35652010 CAGAGGCCTGAGAAGCAGGAGGG - Intergenic
929094563 2:38251186-38251208 CAGAGCCTAGAGTTGGAGGATGG - Intergenic
929302932 2:40326559-40326581 AAGAGGATAGTTAAGAAGGAAGG - Intronic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929441030 2:41965907-41965929 CAGAGGAGAGAGAGTGGGGATGG + Intergenic
929911386 2:46092433-46092455 CAGAGGGGAGACAAGGAGAAAGG + Intronic
930037029 2:47092629-47092651 CAGAGGGGAGAGGAGGAGAAAGG + Intronic
930084071 2:47480240-47480262 AAGAGGAAAGGGAAGGAGGAAGG - Intronic
930146250 2:48008015-48008037 AAGAGGAAAGGAAAGGAGGAAGG - Intergenic
930327716 2:49941365-49941387 GAGAGGAGAGAAAAGGCGGATGG - Intronic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930919036 2:56728805-56728827 GTGAGGGGAGAGAAGGAGGAGGG - Intergenic
930984937 2:57573947-57573969 CACAGGATAGTGAGGGAGTAAGG - Intergenic
931058010 2:58494434-58494456 AACAGGATAGAGAAGGAAGCGGG + Intergenic
931077693 2:58734988-58735010 GAGAGGAGAGAGAAGGAGGGAGG - Intergenic
931137687 2:59422467-59422489 AAGAAGAGAGGGAAGGAGGAAGG - Intergenic
931341216 2:61402386-61402408 AATAGGAAAGAGAAGAAGGAAGG + Intronic
931376389 2:61712179-61712201 CAGAGGAGAGAGGATGATGATGG - Intergenic
931959179 2:67462873-67462895 CAGAGGATGGGGAAAGAAGAGGG + Intergenic
932406395 2:71515588-71515610 AGGAGGAAAGAGCAGGAGGAAGG - Intronic
932748586 2:74356187-74356209 CGGATGATAGAGATGGAGGGAGG + Intronic
932813330 2:74842629-74842651 CAGAGGACAGAGAAGTCAGAAGG + Intronic
933161119 2:79026213-79026235 CAGAGCCAAGAAAAGGAGGAAGG + Intronic
933438322 2:82277344-82277366 CAGAGCATTGAGAGGGAGCACGG - Intergenic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
933730920 2:85455805-85455827 CAGGGGACAGACAAGCAGGAAGG + Intergenic
934049965 2:88201528-88201550 AAGAGGAGAGAGAGAGAGGAAGG + Intergenic
934049997 2:88201838-88201860 AAGAGGAGAGAGAGAGAGGAAGG + Intergenic
934176108 2:89581757-89581779 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
934248955 2:90330058-90330080 AAGAGGAGGGGGAAGGAGGAAGG + Intergenic
934260624 2:91473418-91473440 AAGAGGAGGGGGAAGGAGGAAGG - Intergenic
934286418 2:91656119-91656141 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
934793009 2:97078907-97078929 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
934813178 2:97301578-97301600 CAGAGGATGGAGGGTGAGGAGGG + Intergenic
934824517 2:97406902-97406924 CAGAGGATGGAGGGTGAGGAGGG - Intergenic
934982281 2:98852931-98852953 AAAAGGAGAGAGAAGAAGGAAGG + Intronic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935144620 2:100387060-100387082 CAGAGGAAAGAAAGGGATGATGG - Intergenic
935164465 2:100558096-100558118 CAGAAGAAAGAGAGAGAGGACGG + Intergenic
935338906 2:102042373-102042395 GAAAGGAGAGGGAAGGAGGAAGG + Intergenic
935370625 2:102342878-102342900 GAGAGGACATAGAAAGAGGAAGG + Intronic
935874791 2:107494749-107494771 CAGAGGAAAGAAAGAGAGGAAGG + Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
936914148 2:117622956-117622978 GAGAGGAGAGAGAGGAAGGAAGG + Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937132761 2:119525331-119525353 AGGAGGAGAGAGAAGAAGGAAGG - Intergenic
937217299 2:120321072-120321094 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217303 2:120321085-120321107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217307 2:120321098-120321120 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217316 2:120321127-120321149 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937284450 2:120741411-120741433 CAGAAGAGAGAGAAAGGGGAAGG - Intronic
937284759 2:120743293-120743315 CAAAGGACAAAGAAGCAGGAAGG - Intronic
937718802 2:125066374-125066396 GAGAGGGGAGAGTAGGAGGAGGG - Intergenic
937814065 2:126231673-126231695 AGGAGGAAAGAGAAGGAAGAGGG - Intergenic
937814081 2:126231736-126231758 AAGAGGGGAGAGGAGGAGGAGGG - Intergenic
937901101 2:127019782-127019804 GGGAGGGAAGAGAAGGAGGAAGG + Intergenic
938129974 2:128706886-128706908 CAGAGGTAAGAGAATGAGCAGGG + Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938313282 2:130308786-130308808 AGAAGGAAAGAGAAGGAGGAGGG + Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938826819 2:135013857-135013879 CAGAGGATCAAGAGAGAGGAGGG - Intronic
938977755 2:136495559-136495581 TGGAGGATAGAGTAGGAGGGAGG - Intergenic
939041710 2:137197270-137197292 CAGCAGAGAGAGATGGAGGAAGG + Intronic
939478948 2:142723987-142724009 CAGAGGTTAGAGGTGGAAGAAGG - Intergenic
939579196 2:143928277-143928299 GAAAGGAGAGAGAAGGAGGGAGG + Intergenic
939771593 2:146326719-146326741 GAGAGGAAAGACATGGAGGAGGG + Intergenic
939844652 2:147228736-147228758 GACAGGATAGAGAAGGATGAAGG - Intergenic
940497632 2:154453545-154453567 CAGGGGATAGGGAAGGCAGATGG - Exonic
940801086 2:158133355-158133377 CAGAGTATAGGGGAGCAGGATGG + Intronic
940832874 2:158487791-158487813 GAGAAGAGAGAGAAGGGGGAGGG + Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
942117575 2:172743219-172743241 CTGAGGAAAGAGAAAGAGGATGG + Intronic
942387179 2:175454892-175454914 TAGAGGGTAGAGTAGGAAGAGGG - Intergenic
942839334 2:180340588-180340610 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
943356960 2:186867796-186867818 TAGAGGAAAGATAAAGAGGAAGG + Intergenic
943420054 2:187658658-187658680 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
943554373 2:189383912-189383934 CAGAGGATAGGAAAGGTGAATGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944440548 2:199739264-199739286 TAGAGGGTAGGGAAAGAGGAAGG - Intergenic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
945489183 2:210434775-210434797 CATAGGATGCCGAAGGAGGAGGG - Intronic
945672653 2:212820682-212820704 CAGAGGATTGAGAGACAGGAAGG - Intergenic
945743670 2:213694161-213694183 AGGAGGTAAGAGAAGGAGGAGGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946023830 2:216659975-216659997 CAAAGGAGTGAGAAGGTGGAAGG - Intronic
946143902 2:217714290-217714312 GAGAGGATGGAGAAGGGGGAAGG - Intronic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946667596 2:222067171-222067193 CAGAGGATAGAATAGAAAGATGG - Intergenic
946668768 2:222079598-222079620 TAGAGGAGGGAGAAGGAAGAAGG - Intergenic
947026069 2:225739540-225739562 TGGAGGATAGAGAATGAGAAGGG + Intergenic
947077041 2:226355916-226355938 GAGAGGAGAGAGAAAGAGAAAGG + Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947913869 2:233819526-233819548 CAGATGAGAGGGAAGGACGAGGG + Intronic
948091833 2:235301892-235301914 GAGAGGAGGGAGAAGGAGGGAGG - Intergenic
948101527 2:235377981-235378003 GAGAGAAGAGAGAAGGACGAGGG - Intergenic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
948299898 2:236897118-236897140 TAGAGGTTTGGGAAGGAGGAGGG + Intergenic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948573751 2:238936542-238936564 AAGAGCATAGAGAAGAAGCATGG - Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948870132 2:240793548-240793570 GTGAGGAGAGAGGAGGAGGACGG + Intronic
948989492 2:241545622-241545644 AGGAGGACAGAGAGGGAGGAGGG + Intergenic
1169163779 20:3406097-3406119 TAAAGGATAGAGAAGGTGGGGGG - Intronic
1169316716 20:4597896-4597918 GAGAGGAGAGAGAGGGAGGGAGG - Intergenic
1169427172 20:5505321-5505343 CACAGGCTGAAGAAGGAGGATGG - Intergenic
1169801238 20:9514729-9514751 CGGGGGACAGAGAAGGGGGAGGG - Exonic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170488408 20:16844331-16844353 CAGAAGGAAGAAAAGGAGGAGGG + Intergenic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1170994685 20:21341253-21341275 CTGAGGCAAGAGGAGGAGGATGG + Intronic
1171782701 20:29435503-29435525 CAGAGGTTAGAGATGGCAGAAGG + Intergenic
1172013638 20:31860866-31860888 GAGATGTTAGAGAAGGAGGTGGG + Intronic
1172302218 20:33858136-33858158 GGGAGGAAAGGGAAGGAGGAAGG + Intergenic
1172361626 20:34316628-34316650 AGGAGCAGAGAGAAGGAGGAGGG + Intergenic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172785468 20:37465472-37465494 GAGAGGAGAGAAGAGGAGGAAGG - Intergenic
1173029139 20:39338544-39338566 CAGAGGCTGGAGAAGCAGGCAGG + Intergenic
1173104803 20:40123741-40123763 CAGAGGATAGAGAGGAAGAAAGG - Intergenic
1173513646 20:43649732-43649754 CAGAGGACAGGGAAGAAGCATGG - Intergenic
1173899390 20:46576032-46576054 GAGAGGAAAGAAAAAGAGGAAGG + Intronic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174076132 20:47938525-47938547 AAGAGGATCAAGAAGGAGGCAGG - Intergenic
1174824459 20:53756845-53756867 CAAAGGATAGTGAAGCTGGAAGG - Intergenic
1175081856 20:56427297-56427319 GGGAAGACAGAGAAGGAGGAAGG - Intronic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175463892 20:59176304-59176326 CAGAGGCTGGAGGTGGAGGAAGG + Intergenic
1175477112 20:59284567-59284589 CACTGGCTAGAGAAGGAGGCTGG - Intergenic
1175702217 20:61147811-61147833 GAGTGGATAGAGAAGGAAGGGGG + Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175862882 20:62159562-62159584 CAGAGGATAGAGATGGGGGGAGG - Intronic
1176057120 20:63154780-63154802 AAGAGGAGAGGGGAGGAGGAGGG - Intergenic
1176415257 21:6471048-6471070 CAGAGGCTAGAAAATGATGAGGG - Intergenic
1176914433 21:14608242-14608264 CAGGAGATAGAGGAGGAGGGTGG - Intronic
1177543052 21:22520562-22520584 GAGAGGACAAAGGAGGAGGAAGG - Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1178165700 21:29973609-29973631 TAGACTATTGAGAAGGAGGAAGG - Intergenic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1178354293 21:31897755-31897777 AAGAGGACAGTGAAGGAGGTGGG + Intronic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178688283 21:34728747-34728769 GAGAGGGTGGAGAAGAAGGAAGG + Intergenic
1179026534 21:37683453-37683475 GAGAAGACAGAGGAGGAGGAGGG - Intronic
1179050488 21:37884903-37884925 CAGAAGGTTGAGAAGCAGGAGGG - Intronic
1179109457 21:38433899-38433921 CAGAGGATTAGGAAGGAGGATGG - Intronic
1179473237 21:41626043-41626065 CAGGGGAGAGAGAAGAACGAAGG + Intergenic
1179690757 21:43079381-43079403 CAGAGGCTAGAAAATGATGAGGG - Intergenic
1180169166 21:46049014-46049036 AGGAGGTTAGAAAAGGAGGAGGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180507525 22:16028209-16028231 ATGAGGGTGGAGAAGGAGGACGG - Intergenic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1180728893 22:17966419-17966441 CAGAGGAGTGAGGAGGTGGAGGG - Intronic
1180767309 22:18352575-18352597 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
1180779000 22:18509804-18509826 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1180798613 22:18620595-18620617 CAGAGAATGGAGTAGAAGGAAGG + Intergenic
1180811721 22:18767124-18767146 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1180978669 22:19868076-19868098 GAGAGGAGAGAGAATGAGGCAGG - Intergenic
1181197874 22:21201366-21201388 CAGAGGGGAGAGATGGAGGCAGG + Intergenic
1181223103 22:21374669-21374691 CAGAGAATGGAGTAGAAGGAAGG - Intergenic
1181255635 22:21560965-21560987 CAGAGAATGGAGTAGAAGGAAGG + Intronic
1181324892 22:22037107-22037129 AAGAGGGAAGAGTAGGAGGAAGG + Intergenic
1181382871 22:22520863-22520885 GAGGGGGTAGTGAAGGAGGAGGG - Intergenic
1181508449 22:23377584-23377606 GAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1181533929 22:23532171-23532193 GAGAGGAGAGGGGAGGAGGAGGG + Intergenic
1181703825 22:24635534-24635556 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
1182104228 22:27677841-27677863 CAGAGGATAGAACAACAGGATGG - Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182624928 22:31638597-31638619 CAGAGGCTAGGGAAGGATGGGGG - Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183279291 22:36923482-36923504 CAGAGGACAGAGGAGGAGGGAGG + Intronic
1183284305 22:36952775-36952797 CAGAGGACAGAGGAGGACGGAGG - Intergenic
1183387447 22:37523182-37523204 CAGAGGATTGACAGAGAGGATGG + Intergenic
1183517918 22:38278272-38278294 TGGAGGATAGAGAGGGAGGTGGG + Intergenic
1183728264 22:39601532-39601554 CAGAGGAGAGAGAAAAAGGCTGG + Intronic
1183991201 22:41598178-41598200 AAAGGGATAGGGAAGGAGGAGGG - Exonic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184257335 22:43294737-43294759 CACGGGGCAGAGAAGGAGGAGGG - Intronic
1184732560 22:46378723-46378745 GAGAGGACAGAGAAGGGGCAGGG + Intronic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1184959359 22:47917880-47917902 GGGAGGAGAGACAAGGAGGAAGG - Intergenic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
1184959375 22:47917940-47917962 GGGAGGAAAGAGAGGGAGGAGGG - Intergenic
1203228931 22_KI270731v1_random:93469-93491 CAGAGGGGAGAGATGGAGGCAGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
950342861 3:12263016-12263038 CAGAGGAGAGAGAAGGACAAAGG + Intergenic
950546574 3:13641536-13641558 CAGCAGATAGGAAAGGAGGAAGG + Intergenic
950600916 3:14035054-14035076 CAGAGCATTGAGAGGGAGCATGG - Intronic
950626380 3:14250402-14250424 GGGAGGAGAGAGGAGGAGGAGGG - Intergenic
951218264 3:20043888-20043910 GAGAGATTAGAGAATGAGGAGGG + Intronic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
951558556 3:23945012-23945034 GAGAGGAAAGAGGAGGAGGAGGG + Intronic
951741061 3:25923841-25923863 TAGAGGATGAAGAAGGACGAAGG + Intergenic
952212868 3:31247119-31247141 CTGAGGGTAGCGGAGGAGGAAGG - Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
952845040 3:37681245-37681267 CAGAGCATAGACAAGAAGGCTGG + Intronic
953135698 3:40179948-40179970 GAGAGGATAGAGATTGAGGATGG - Intronic
953525849 3:43689751-43689773 CAGAGGAGAGAAAAAGAGGGAGG + Intronic
953855603 3:46497332-46497354 GAGAGGATTGAGGAGGAAGAGGG - Intergenic
953879370 3:46683722-46683744 CAGAGGACAGGGTAGGAAGAGGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954630390 3:52044836-52044858 AAGAGGAGAGAGCAGGATGAAGG - Intergenic
954763638 3:52895837-52895859 TGGAGGACAGAGAAGTAGGAGGG + Intronic
954876420 3:53805791-53805813 GGGAAGATAGAGGAGGAGGAGGG - Intronic
955035641 3:55264571-55264593 ATGAGGAGAGAGAAGAAGGAGGG + Intergenic
955059551 3:55483680-55483702 CAGAGGAGTGAGGTGGAGGAGGG + Intronic
955083465 3:55679169-55679191 ATGAGGATGGAGAAGAAGGAAGG - Intronic
955150280 3:56360355-56360377 CAGAGTCTAGAGAAGTAGAAGGG - Intronic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955386800 3:58487090-58487112 GAGAGGAGAGGGGAGGAGGAAGG + Intergenic
955401384 3:58594075-58594097 AAGAGCATAGAGAAGGTGAAAGG - Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955703119 3:61701900-61701922 GAGAGGGAAGAGAAAGAGGAAGG + Intronic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
956265514 3:67392157-67392179 CAGGGGTCAGTGAAGGAGGAAGG - Intronic
956326216 3:68055783-68055805 CAGAGCATAGATAAAGAAGATGG - Intronic
956472656 3:69584315-69584337 GGGAGGAAAGAGAAGGAGAAGGG - Intergenic
956633243 3:71336865-71336887 CAGGAGATAGAGAAGGCAGAGGG + Intronic
956724425 3:72145492-72145514 CAGAAGGAAGAGAAGGAGGAAGG + Intergenic
957002565 3:74903080-74903102 CAGAGTATATAAAATGAGGATGG + Intergenic
957416934 3:79917461-79917483 AAGAGGGAAGAGAAGGAGGGAGG + Intergenic
958536608 3:95412012-95412034 GAGAGGACAGAGGAGGAAGAAGG - Intergenic
958870335 3:99551194-99551216 CAAAGGATAGAGAATGATGAGGG + Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959013378 3:101105159-101105181 GAGAGAATAGAGGAAGAGGATGG - Intergenic
959445732 3:106436356-106436378 AAGAAGAGAGAGAAGGAGGGAGG + Intergenic
959469057 3:106726445-106726467 CATAGGATAGAGAAAAAGGGAGG + Intergenic
959520112 3:107316146-107316168 CAGAGCATTGAGAGGGAGCATGG - Intergenic
959626315 3:108456119-108456141 AAGAGGAAAGAGAGGGAGGGAGG + Intronic
959714753 3:109420442-109420464 CTGAGGATGGAGAGAGAGGAAGG - Intergenic
959731676 3:109610935-109610957 CAGCAGCTAGAGGAGGAGGATGG + Intergenic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960223401 3:115143860-115143882 CAGAAGTTTGAGAAGGAGGAAGG - Intronic
960236030 3:115283189-115283211 TAGTGGATAGAGCAGGAGAAGGG - Intergenic
960618839 3:119620206-119620228 CATAGCATAGGGAAGGATGACGG - Intronic
960896518 3:122512150-122512172 CAAAGTATAGAGAAACAGGATGG + Intronic
961500341 3:127328036-127328058 CAGATGATAGAGATAGAGCAGGG + Intergenic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
961747877 3:129077143-129077165 GAGAGGAATGAGAAGGAAGAGGG - Intergenic
961796289 3:129411362-129411384 CAGAGGGAAGAGATGAAGGAAGG + Intronic
962022054 3:131511750-131511772 TAGATGTTAGAGAAGCAGGAGGG + Intergenic
962308763 3:134311481-134311503 CAGAGGCTGAAGCAGGAGGATGG + Intergenic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962447797 3:135483713-135483735 AAGATGATAGAGAAGGTAGATGG - Intergenic
962505246 3:136040113-136040135 CAAAGGAGAGAGAAGGAGATAGG + Intronic
962816055 3:139001849-139001871 CAGAGGCTGGAGGAGGAGGGTGG - Intergenic
962827007 3:139107654-139107676 CTGCTGATAGAGAAGGAGGTAGG + Intronic
962938777 3:140106460-140106482 CACAGGATGGAGCAGGAGGTGGG + Intronic
963508491 3:146217959-146217981 GAGAGGAGAGAGAAGGAGATGGG + Intronic
964108105 3:153060453-153060475 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
964271447 3:154960574-154960596 TATTGCATAGAGAAGGAGGAAGG + Intergenic
964304346 3:155324994-155325016 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
964577415 3:158188480-158188502 CAGATGATAGAGCAGGAAGAGGG - Intronic
964762000 3:160143026-160143048 CAGGGGCTGGAGAAGGAAGAGGG + Intergenic
964882209 3:161435590-161435612 CAGAGGATAGAGCCTGAGGCTGG + Intergenic
965513242 3:169592480-169592502 CAGAGGGTAGAGGAGAAGGCTGG - Intronic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
965631873 3:170741242-170741264 AGGAGGAGAGAGAGGGAGGAGGG + Intronic
965961746 3:174437551-174437573 GAGAGGGGAGAGAAGAAGGAGGG - Intergenic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
966731711 3:183156944-183156966 CAGAGGAGAGAGGAACAGGAGGG + Intronic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967268335 3:187711969-187711991 CAGAGGTTAGAGATGAAGGGAGG + Intronic
967853689 3:194100761-194100783 AAAAGGAGAGAGAGGGAGGAAGG + Intergenic
968038196 3:195566580-195566602 CAGAGGGGAGAGAAAGAGAAAGG - Intergenic
968262343 3:197335404-197335426 AAGAGGGAAGGGAAGGAGGAGGG + Intergenic
968298145 3:197593055-197593077 CAGAGGGCAGGGAAGGAGAAGGG + Intergenic
968339214 3:197941154-197941176 GAGAGGAGAGAGAGGAAGGAGGG - Intronic
968339260 3:197941323-197941345 CAGAGGGGAGAGAGAGAGGAAGG - Intronic
968476429 4:811770-811792 CAAAGGACAGAGAAGCAGGAAGG - Intronic
968809969 4:2795394-2795416 GAGAGGACAGAGAGTGAGGAGGG - Intronic
968942923 4:3648476-3648498 CAGAGGAAAGAGAGGCAGGGTGG - Intergenic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969201042 4:5606055-5606077 CAGAGGTTAGGAGAGGAGGACGG + Intronic
969450645 4:7271147-7271169 CAGAGGAGATAGAAGCAGCAGGG - Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970430363 4:15983512-15983534 AAGAGGAGAGAGAAAGAGAAAGG + Intronic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
970550957 4:17180631-17180653 AAGAGGGTAGAGGAGGAGGAAGG + Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
970979781 4:22082749-22082771 CAGAGGATAGGAAAGGAAGTAGG - Intergenic
971075895 4:23149048-23149070 CAGATGATATAGGTGGAGGATGG - Intergenic
971178095 4:24300952-24300974 CAGATGAGAGAGCAGAAGGATGG + Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
971394421 4:26215160-26215182 AGGAGGATAGGGAAGGAGGAAGG + Intronic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972452246 4:39213557-39213579 CAGAGGTTAGAGATGGAGCTGGG + Intronic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
972987281 4:44779993-44780015 AAGAGAATAGAGAAGGAGATGGG - Intergenic
973712859 4:53646364-53646386 TAGAGGATAGAGACTGAGAATGG - Intronic
973742074 4:53927690-53927712 CAGAGGCTGGAGAAGCAGCAGGG + Intronic
973966222 4:56164642-56164664 CAGAGGTTGGGGACGGAGGATGG + Intergenic
974247499 4:59339578-59339600 CAGAGGATAAAGAAGAGAGAAGG + Intergenic
974802489 4:66836226-66836248 AAAGGGATAGAGAAGGAGGTTGG + Intergenic
974845067 4:67342057-67342079 CAGAGGATTGAGATAGAGCAGGG + Intergenic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975794890 4:77996799-77996821 CAAGGGATGGAGAAGGAGTACGG + Intergenic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976802347 4:89006798-89006820 CAGGGGATGGTGCAGGAGGAAGG + Intronic
976919398 4:90419637-90419659 AAGAGGAGAGAGAAGCAGCAGGG + Intronic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
977255020 4:94731139-94731161 TAGAGTATAAAGAAGGAGTATGG + Intergenic
977342888 4:95782264-95782286 CAGAGGAGTGAGAAGAAAGATGG - Intergenic
977418779 4:96768990-96769012 CAGAGGATAGACAGTGAAGAAGG + Intergenic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977813043 4:101380616-101380638 CAAAGGATCGAGAAGCAGAAGGG - Intergenic
977971628 4:103219280-103219302 CAGAGCATAGAGAGGCAGCATGG + Intergenic
978001411 4:103558969-103558991 CAGAGCAAAGTGTAGGAGGACGG + Intergenic
978070339 4:104459760-104459782 TAAAGGAAAGAGAAGGAAGAGGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978328608 4:107587095-107587117 GAGGGGATAGAAAAGGAGAAAGG + Intergenic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
978503524 4:109433780-109433802 GAGAGGAGAGAGGAAGAGGAAGG - Intronic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
978872307 4:113594125-113594147 AACAAGAGAGAGAAGGAGGAAGG + Intronic
978957328 4:114630543-114630565 GAGTGGATAGAGATGTAGGAGGG + Intronic
979172075 4:117612510-117612532 CAGAGGATTGAGATTGAGAAGGG + Intergenic
979357682 4:119724645-119724667 CAGAGGATCGAGAGCCAGGAGGG + Intergenic
979416891 4:120452429-120452451 GAGAGGGAAAAGAAGGAGGAAGG + Intergenic
979552338 4:122005090-122005112 ATGAGGATCGAGATGGAGGAGGG - Intergenic
979742136 4:124165338-124165360 TAGGGGAGAGAGAAGGAAGAGGG - Intergenic
980463754 4:133149321-133149343 CAGAGGCTGAAGCAGGAGGAAGG + Exonic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981242329 4:142492708-142492730 CAAAGCATAGAAAAGGAGGAAGG + Intronic
981439195 4:144763258-144763280 AAGAGTAGAGAGAGGGAGGACGG + Intergenic
981606332 4:146545376-146545398 CAGAGAATTGAGAGGGAGCATGG - Intergenic
981863579 4:149386252-149386274 CAGTGGAGAGAGAAGAATGAGGG + Intergenic
981941497 4:150286410-150286432 CAAAGGATGAGGAAGGAGGAAGG - Intronic
981961269 4:150542183-150542205 CAGAGGATAGGGGAGGAGCAAGG - Intronic
982139217 4:152301791-152301813 CAGAGGTTAGAAAAGTGGGAAGG + Intergenic
982167522 4:152628288-152628310 CTGAGGGTGGAGAAGGAGGCGGG - Exonic
982317736 4:154048309-154048331 CAAAGGATACAGGAGGAGGGTGG + Intergenic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982392640 4:154882316-154882338 AAGGAGATAGGGAAGGAGGAAGG + Intergenic
982709333 4:158744474-158744496 GGGAGAAGAGAGAAGGAGGAAGG + Intergenic
983137944 4:164107937-164107959 AAGAGGATGGAGGAGGTGGAGGG - Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983281010 4:165680862-165680884 CAGGGGATAGTGATGAAGGACGG + Intergenic
983552558 4:169032417-169032439 AAGAAGGGAGAGAAGGAGGAAGG - Intergenic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
983658713 4:170110101-170110123 AATAGGAAAGAGTAGGAGGAAGG + Intergenic
983659288 4:170116889-170116911 CAGAACAAAGAGTAGGAGGACGG - Intergenic
983747989 4:171225254-171225276 CAGATGATAGAGTAGGAGGTAGG - Intergenic
984017530 4:174443621-174443643 GAGATGAAAGAAAAGGAGGAGGG - Intergenic
984182874 4:176506968-176506990 CAAAGGAGAGAGAGAGAGGAAGG - Intergenic
984233143 4:177124242-177124264 GAGAGGAAAGAGAGGGAGGGAGG - Intergenic
984237524 4:177178582-177178604 CAGAGAAGAGAAAAGGAGTAAGG - Intergenic
984403664 4:179299674-179299696 CACAGGAGAGAGATGTAGGATGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
985283501 4:188310454-188310476 GAGAGGCCAAAGAAGGAGGATGG - Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
985522906 5:387225-387247 CAGAGGAGAGAGCAGGAGACAGG - Intronic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986782718 5:11081816-11081838 CAGGGGCTGGAGAAGGGGGATGG + Intronic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
986875703 5:12106032-12106054 CAGAGGCTAGAGAAGAAATAAGG - Intergenic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
986986488 5:13506325-13506347 CAGAGGAGAGAGAATCAGGAGGG + Intergenic
987071739 5:14343411-14343433 CAGGGGTTAGAGATGGAGCAGGG - Intronic
987380656 5:17282896-17282918 TAGAGGAAAGAGAATAAGGAAGG - Intergenic
987842668 5:23240491-23240513 CAGAGCAGGGAGAAAGAGGAGGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988294141 5:29333020-29333042 CAGAGGGTGGAGGGGGAGGAAGG - Intergenic
988427775 5:31083596-31083618 CAAAGGAAAGGAAAGGAGGAAGG + Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
988790118 5:34600101-34600123 AAAAGCATAGAGAAGGAAGAAGG + Intergenic
988873539 5:35417977-35417999 CAGAGGGAAGAGGAGGAGAATGG - Intergenic
988895410 5:35667289-35667311 GACACGATAGAGAATGAGGAAGG + Intronic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989783115 5:45293934-45293956 AAGAGGATAACGAATGAGGAAGG + Intronic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990528443 5:56651220-56651242 CAAAGGCTAGAGAACCAGGAGGG - Intergenic
990535309 5:56715877-56715899 AAGAGGAGAGAAAGGGAGGAAGG + Intergenic
990799238 5:59581198-59581220 AAGAGGAGAGAAAAGGATGAGGG + Intronic
991014350 5:61915355-61915377 GAGAGGACAGAGGAGGAGAAAGG - Intergenic
991615165 5:68489461-68489483 AGGAGGAGATAGAAGGAGGAAGG + Intergenic
991692383 5:69237501-69237523 CAAAGCATAGGGAAGGAGGGAGG - Intronic
992002647 5:72450868-72450890 GAGAGGCCAGAGAAAGAGGATGG + Intronic
992247105 5:74837124-74837146 TAAAGGATGGAGAAGGAGAAGGG - Intronic
992457908 5:76933137-76933159 CAAAGGAGAGAGAAAGAGGAAGG + Intergenic
993160730 5:84287807-84287829 GAATGGCTAGAGAAGGAGGAGGG - Intronic
993413570 5:87600354-87600376 CAGAGCATTGAGAAGGAGCATGG - Intergenic
993996146 5:94725618-94725640 GAGAGTTTAGAGAAGGAGGTGGG + Intronic
994560077 5:101357849-101357871 ATGAGGATAGAGAAGATGGATGG - Intergenic
994651485 5:102534593-102534615 CAGAGGTTTGGGCAGGAGGAAGG + Intergenic
994831727 5:104792234-104792256 CATAGGAGAAAGAAGGAGGGGGG + Intergenic
995008960 5:107236239-107236261 CAGAGTATAGAGCAAGAAGAGGG - Intergenic
995095440 5:108230565-108230587 CAGAGGAAAGGGTAGGAGGGGGG + Intronic
995154809 5:108898491-108898513 GAAAGGAGAGAGAAAGAGGAAGG - Intronic
995184636 5:109259119-109259141 TAGAGGAGTGAGAAGGAAGAGGG + Intergenic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
996074528 5:119174781-119174803 TAGAGGAAAGAGAAAGAGAAAGG - Intronic
996134143 5:119818100-119818122 CACAGCATAGAGAATGTGGAAGG - Intergenic
996262240 5:121486363-121486385 GAGAGGAGAGAGTGGGAGGAGGG + Intergenic
996440600 5:123486011-123486033 CAGATGTAAGAGGAGGAGGAGGG - Intergenic
996502789 5:124235489-124235511 AGGAGGAGAGGGAAGGAGGAAGG + Intergenic
996926862 5:128837700-128837722 AAGGGATTAGAGAAGGAGGAAGG + Intronic
996991086 5:129632977-129632999 GAGAGGATGGAGAGGTAGGAAGG - Intronic
997183262 5:131855522-131855544 CAAAAGAGAGAGAGGGAGGAAGG + Intronic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997999766 5:138615694-138615716 AGGAGGATAGAGAGGGAGGCTGG + Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998878003 5:146619752-146619774 GAGAGGTTAGGGAAGGAGCATGG - Intronic
998894505 5:146785188-146785210 AAGAGTATAGAAAAGGAGGAAGG + Intronic
999121528 5:149213245-149213267 CAGAGGAAAGAGAGCAAGGAAGG + Intronic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
999524162 5:152384154-152384176 GAAAGGAAAGAGAAGAAGGAAGG - Intergenic
1000175231 5:158745717-158745739 TAGAGGATAAAGAGGGAGGGTGG + Intronic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000731399 5:164838651-164838673 AATAGGAAAGAAAAGGAGGAAGG - Intergenic
1000734781 5:164885695-164885717 TAGAGGGTGGAGAAAGAGGAGGG + Intergenic
1000992186 5:167922702-167922724 CACAGGATAATTAAGGAGGAGGG - Intronic
1001220459 5:169895905-169895927 CAGAAAATAGGGAAGAAGGAAGG - Intronic
1001241944 5:170077891-170077913 GAGAAGAGAGAGAAGGAGGGGGG - Intronic
1001256661 5:170188639-170188661 ATGAGGATAGAGAAGAAGGAGGG + Intergenic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1002286128 5:178163946-178163968 GAGAGGACAGAAAAGAAGGAAGG + Intergenic
1002390984 5:178911476-178911498 CAGACGGCAGAGGAGGAGGAAGG - Intronic
1002592580 5:180301033-180301055 GAGAGGAAAGAAAAGGAGAAAGG + Exonic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003491943 6:6630438-6630460 CAGAGGAGACAGAAGGACCAAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003516050 6:6819550-6819572 CAGGGGTTAGATATGGAGGAGGG + Intergenic
1003674244 6:8188453-8188475 CAGAGGAGTGGGAAGGAGAATGG + Intergenic
1003744895 6:8989725-8989747 AAGAAGAGAGTGAAGGAGGAGGG + Intergenic
1003754390 6:9100461-9100483 GAGAGGAAGGAGAGGGAGGAAGG - Intergenic
1003850658 6:10219129-10219151 GAGAGGAAAGAGGAGAAGGAGGG - Intergenic
1004925706 6:20413262-20413284 CAGAGGATAGGGATGGAGCCTGG - Intronic
1005039531 6:21588499-21588521 CAGGGGATGGGGTAGGAGGACGG + Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005309397 6:24544942-24544964 CCAAGGACAGAAAAGGAGGAGGG + Exonic
1005803372 6:29449035-29449057 CAGAGGTTACAGCAGGAGTATGG + Intronic
1006061260 6:31421657-31421679 CAGAGGGTAGAGATTGAGGGAGG - Intergenic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006809228 6:36809207-36809229 GAGAGGAGAGAGAGAGAGGAAGG + Intronic
1006823378 6:36916085-36916107 GGGAGAAGAGAGAAGGAGGAAGG - Intronic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1006933799 6:37703621-37703643 AAGAGGATGGAGAACTAGGAAGG + Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007236293 6:40393122-40393144 CAGAGGAGAGGGGAGGAGGGAGG + Intronic
1007620799 6:43213386-43213408 CAAAGGAAAGAAAAGGAAGAGGG - Intronic
1007941378 6:45784834-45784856 GATAGGAGAAAGAAGGAGGAAGG - Intergenic
1007941982 6:45789898-45789920 AAGAGGAGAGAACAGGAGGAAGG + Intergenic
1008300444 6:49831487-49831509 CAGAGGACGTAGATGGAGGAGGG + Intergenic
1008779781 6:55089650-55089672 AAGAGGATGGAGGAGGAAGAAGG - Intergenic
1008947990 6:57120082-57120104 GACAGGATAGTCAAGGAGGAGGG - Intronic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009484476 6:64202752-64202774 AAGAGGAAAGAGAAGGGGAAAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1010977523 6:82332543-82332565 GAGGGGATAGAGAAGAAGAAGGG - Intergenic
1011000544 6:82583519-82583541 CAGAGGAGAGTGAAGGAACAGGG + Intergenic
1011051024 6:83149761-83149783 AACAGGATAAAGAAGGAGAAGGG + Intronic
1011247875 6:85338984-85339006 CAGAGGATAGAGGTGGAGGTGGG + Intergenic
1011325158 6:86142647-86142669 CAGAGGTTGGAGAAAGAGGGAGG + Intergenic
1011740095 6:90350867-90350889 CAGAGGAGAGGGAGGGAGGGAGG - Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012460894 6:99458785-99458807 CAGAGGCTACAGGAGGAGAATGG + Intronic
1012788530 6:103661567-103661589 CAGCAGAAAGAAAAGGAGGAAGG - Intergenic
1012811079 6:103959059-103959081 CACAGCAGAGAGAAAGAGGAAGG + Intergenic
1013036771 6:106392538-106392560 CACAGGAAAGAGATGGTGGAGGG + Intergenic
1013291337 6:108721283-108721305 AAGATGATTGAGAGGGAGGATGG - Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1013817514 6:114116672-114116694 AAGAGGATGGGGAAGGAGGTGGG - Intronic
1013837047 6:114345010-114345032 AAGATGACTGAGAAGGAGGATGG + Intergenic
1013853472 6:114543079-114543101 CAGGGGCTGGAGAAGGGGGATGG - Intergenic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014294914 6:119606219-119606241 CATGGGACAGAGAAGTAGGAGGG - Intergenic
1014489491 6:122044679-122044701 CAGAGGAAAAAAAAGGGGGAGGG - Intergenic
1014562227 6:122905218-122905240 TAGAGGATAGAGAAAGGGAAGGG - Intergenic
1014629109 6:123767526-123767548 GAGAGGTCAAAGAAGGAGGATGG + Intergenic
1014758805 6:125331841-125331863 AAGAAGAAAGAAAAGGAGGAGGG - Intergenic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1015506874 6:133997647-133997669 GAGAGGAGAGAGATGGAGGTGGG + Intronic
1015547470 6:134376196-134376218 CATAGCATAGAGAAGGAGCATGG - Intergenic
1015577806 6:134691180-134691202 AAGAGGAGAAAGAAGGAGGGAGG + Intergenic
1016142844 6:140634344-140634366 AAGAGGAAAGAGAGGAAGGAAGG - Intergenic
1016154269 6:140784175-140784197 CAGGGGGTGGAGAAGGAGCATGG + Intergenic
1016277320 6:142370019-142370041 CAGAGGATAGATGAGTAAGAGGG + Intronic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016634820 6:146275971-146275993 GAGAAGAAAGAGGAGGAGGAAGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017022275 6:150149915-150149937 CAAAACATAGAGAATGAGGAAGG - Intronic
1017067966 6:150547717-150547739 AAGAGGAAAGGGAGGGAGGAGGG + Intergenic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1018082387 6:160269794-160269816 CACAGGGTAGAGCATGAGGATGG - Intronic
1018167375 6:161110897-161110919 CAGTGGACAGAGACTGAGGATGG - Intronic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG + Intronic
1019272207 7:156638-156660 CAGAGGGTACAGATGGAGCAGGG - Intergenic
1019332352 7:466662-466684 GGGAGGAGAGTGAAGGAGGAGGG - Intergenic
1019351811 7:557552-557574 CAGAGGAGGGAGAAACAGGATGG + Intronic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1019805098 7:3117756-3117778 GAGAGGAGAGAGAAAGAGGGAGG + Intergenic
1019964136 7:4484941-4484963 GAGAAGAGAGAGAAAGAGGAGGG + Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021313246 7:19117433-19117455 CGGAGGAGAGAGCAGGAGGACGG + Exonic
1021536412 7:21709619-21709641 GAGAGGATAGAGAATGATGAAGG - Intronic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1021600974 7:22362829-22362851 CAGGGGATAGAGGAGTAGCAGGG + Intergenic
1022095337 7:27137246-27137268 CAGGGGAAAGAGCAGGAGAAAGG + Intronic
1022100031 7:27164067-27164089 AAGAGGACAGAGTAGGAGAAAGG - Intronic
1022228379 7:28387630-28387652 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022340109 7:29459885-29459907 AAGAGGAAAGAGGAGCAGGACGG + Intronic
1022420459 7:30216160-30216182 GAGAGGAAAGAAAAGAAGGAAGG + Intergenic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1022466102 7:30654049-30654071 CAGGAGGTAGAGAAGGTGGAGGG - Intronic
1022594021 7:31694713-31694735 CAAAGGATAGAGGAGTAAGAGGG + Intronic
1023188993 7:37559153-37559175 AAAAAGAAAGAGAAGGAGGAGGG - Intergenic
1023457142 7:40352453-40352475 GAGAGTAGAGGGAAGGAGGAGGG - Intronic
1023718826 7:43072288-43072310 AAGAGGACAGAGGAGGAGAAAGG + Intergenic
1023768139 7:43531055-43531077 TAGAGCATACAGAATGAGGAAGG - Intronic
1023811697 7:43916970-43916992 GAGAGGACAGAGGAGGAGAAAGG - Intronic
1023911998 7:44562912-44562934 CAAAGGATACAGAAGATGGAGGG - Intergenic
1024168259 7:46756739-46756761 GAGAAGGGAGAGAAGGAGGAAGG + Intronic
1024204032 7:47138727-47138749 CGGACGCTAGAGGAGGAGGAGGG - Intergenic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024471360 7:49771011-49771033 AAAAGGAGAGAGACGGAGGAGGG + Intergenic
1024564992 7:50673573-50673595 CTGAGGATGAAGAAGGAGGGGGG - Intronic
1024626923 7:51215801-51215823 CACAGGACAGAGAGGGATGAGGG + Intronic
1024912580 7:54463092-54463114 CAGAGGATGGAGAGACAGGAGGG - Intergenic
1024920069 7:54545975-54545997 GAGAGGAGAGAGAATGAGGGGGG + Intronic
1024966331 7:55025280-55025302 CAGAGGATGAAGCAGGAGCAAGG + Intronic
1026154977 7:67818839-67818861 GAAAGGAAAGGGAAGGAGGAGGG - Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1027121406 7:75524844-75524866 CAGAGGAGAAGGAAGAAGGAGGG - Intergenic
1027448615 7:78303407-78303429 CAGATGATTCAGGAGGAGGAGGG - Intronic
1027512403 7:79098830-79098852 GAGAGGAGAGAGAAAGGGGAGGG + Intronic
1027689352 7:81322754-81322776 AAGAAGATAGAAAAGAAGGAGGG - Intergenic
1027965435 7:84999675-84999697 CAGAGGGCAGAGCATGAGGAGGG - Exonic
1028154196 7:87410797-87410819 CAGAGGATAGGGAGGCTGGAAGG + Intronic
1028203666 7:87992226-87992248 CAGAGGAAAGAGATGGAACAAGG + Intronic
1028308683 7:89300853-89300875 CAGTGGATAGAAGTGGAGGAGGG + Intronic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1029137825 7:98387148-98387170 CAGAGGGTAGGGAAGGAGCAAGG + Intronic
1029180492 7:98697903-98697925 CAAAGGTTAGGGAAGGAGAAAGG - Intergenic
1029308780 7:99641862-99641884 CAGAGGAAAGAGTAGAAGCAGGG - Intergenic
1029412834 7:100426826-100426848 GGGAGGAAAGGGAAGGAGGAGGG - Intronic
1030011572 7:105173728-105173750 CAGAGAACAGAAAAGGAGTATGG + Intronic
1030172393 7:106616486-106616508 AAGAGGAGGGAGGAGGAGGAGGG + Intergenic
1030235354 7:107253932-107253954 TAAAGGATAGAGAATGGGGATGG - Intronic
1030583093 7:111384289-111384311 GAGAGGAGAAAGGAGGAGGAGGG + Intronic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1030969196 7:116033546-116033568 GAGTGGATAGACATGGAGGATGG - Intronic
1031185228 7:118471330-118471352 CAGAGGATGTAGAAGAAAGAAGG + Intergenic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1032089131 7:128902520-128902542 CACAGGCTAGAGAAGGAGACCGG - Intronic
1032702497 7:134394914-134394936 CAAAGGATTGAGGAGGAGGAAGG + Intergenic
1032746304 7:134790110-134790132 GAGAGGACAGAGAGGGAGGAAGG + Intronic
1033150864 7:138913962-138913984 GAGGGGACAGAAAAGGAGGAGGG + Intronic
1033238319 7:139656084-139656106 AAGAGGAGAGAGAAGAATGATGG - Intronic
1033445200 7:141415218-141415240 CGGAGGAGAGAGAATGAGGTTGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1034143635 7:148848585-148848607 CAGATGACAGAGAAGGCAGATGG + Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034261787 7:149761438-149761460 TGGAGATTAGAGAAGGAGGAGGG + Intergenic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1035259347 7:157651892-157651914 CAGAGGAGGGAGAGGCAGGAAGG - Intronic
1035413977 7:158667921-158667943 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035414046 7:158668123-158668145 CAGAGGGTAGGTAAGGAGGGCGG - Intronic
1035479208 7:159168658-159168680 CAGGGGCTGGGGAAGGAGGAAGG + Intergenic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036931984 8:12965351-12965373 CAGAGCATAGAGATGGTGGCAGG + Intronic
1037288337 8:17324478-17324500 CAGAGGCTAGAGGAAGAGCATGG - Intronic
1037526486 8:19729735-19729757 CAGAGGATAAATGAGGGGGAAGG - Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1037682213 8:21106859-21106881 CAGAGGGCTGAGAAGGAGCAGGG + Intergenic
1037692457 8:21193762-21193784 GAGCTGAAAGAGAAGGAGGAAGG + Intergenic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038324658 8:26563643-26563665 CAGAGGATAGAGAGGTGGAAAGG - Intronic
1038423753 8:27451482-27451504 CAGACGCCAGAGAAGGAGGTCGG + Exonic
1038433920 8:27521472-27521494 TGGAGGACAGAGAAGGATGATGG + Intronic
1038461358 8:27720062-27720084 CAGAGGATGGGGAGGGATGAGGG + Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038544354 8:28413627-28413649 AAGAAGAGAGAGAAGGAGAAAGG - Intronic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1039087635 8:33795747-33795769 GAGAGGGTAGTGAAGGAGGGAGG - Intergenic
1039370726 8:36981575-36981597 CAGAGGAGAGGACAGGAGGAAGG - Intergenic
1039988597 8:42468601-42468623 CAGAGGAAAGAGATGAAGCATGG + Intronic
1040564804 8:48555894-48555916 CAAAAGAAAGAGAAAGAGGAGGG - Intergenic
1041190546 8:55349473-55349495 CAGAGGATGCAGAAGCTGGAGGG - Intronic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1041268334 8:56086099-56086121 AGGAGGATAGAGAAGGCAGAAGG - Intergenic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041342570 8:56861431-56861453 AAGAGGATGGAGAAGGACTATGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041496474 8:58491072-58491094 GAGAGGCCAAAGAAGGAGGATGG - Exonic
1041512401 8:58666434-58666456 CTGAGGAGAAATAAGGAGGAAGG + Intergenic
1041748491 8:61234200-61234222 CAGGGGGTAGAGAATGAGGGTGG + Intronic
1042226310 8:66517482-66517504 CAGAACATAGAGAAGGACCAAGG + Exonic
1042298621 8:67250771-67250793 GAAAGGATAGAGAATGAAGAAGG + Intronic
1042335599 8:67627093-67627115 CAAAGGACAGAGAATAAGGAAGG + Intronic
1042437827 8:68788443-68788465 CTCAGGTTAGAGGAGGAGGATGG + Intronic
1042648262 8:71011149-71011171 CAGACGAGAGAGAAGGAGAGGGG - Intergenic
1042810722 8:72822768-72822790 CAGAGGTCAGAGAACTAGGAAGG - Intronic
1043075256 8:75690744-75690766 GAGAGTACAGAGATGGAGGAGGG - Intergenic
1043526062 8:81097539-81097561 CAGAGGCTGGAGGAGGAGGTGGG + Intronic
1044211762 8:89558969-89558991 GAGTGGATAGAGAAGGAAGTGGG - Intergenic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1044605877 8:94046863-94046885 CAGAGGTTAGAGAGGAAGAAGGG - Intergenic
1044749910 8:95406263-95406285 GATAGGATAGAGGAGAAGGAAGG + Intergenic
1045048055 8:98297674-98297696 GAGAGGGGAGGGAAGGAGGAGGG - Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045791867 8:105993031-105993053 GAGAGGAGAAAGCAGGAGGAAGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046299542 8:112269222-112269244 CAGAGGACAGATCAGGAAGATGG - Intronic
1046520676 8:115321060-115321082 AAGAGAATAGAGCAGGAAGAAGG - Intergenic
1046890516 8:119416588-119416610 CAGGAGATGGAGAAGCAGGAAGG - Exonic
1047520168 8:125589956-125589978 CGGAGGCTAGAAAAGCAGGAAGG - Intergenic
1047618438 8:126582187-126582209 GAGCTGATAGAGAAGGAGGAAGG - Intergenic
1047691341 8:127357862-127357884 CAAAGGATAGAAAAGGGGAAAGG - Intergenic
1047742019 8:127814199-127814221 AAGGGGCTGGAGAAGGAGGATGG - Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1048211850 8:132460883-132460905 TAGAAGATAGGGAAGGAGGGTGG - Intronic
1048233751 8:132669624-132669646 CAGAGGACAGAGAAAGCTGAGGG + Intronic
1048520677 8:135151471-135151493 TAAAGGAAAGAGAAGGAGGGAGG + Intergenic
1048586173 8:135776157-135776179 CAGAGGCCAGAGGAGGGGGAGGG + Intergenic
1048608827 8:135999800-135999822 CAGCAGATAGAGAAGGAAGTAGG - Intergenic
1048680979 8:136841777-136841799 GAGAGTATAGAGGAGGGGGAGGG - Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1049188554 8:141272670-141272692 CAGAGGGTATAGCAGGAGTAGGG - Intronic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049397039 8:142405695-142405717 CAGAGGGTAGAGAGGAAGGGTGG - Intergenic
1049543853 8:143220603-143220625 CAGAGGGGAGAGAAGGGGAAGGG - Intergenic
1049674019 8:143881826-143881848 TAGAAGACAGAGGAGGAGGAGGG + Intergenic
1049702232 8:144020544-144020566 GAGAGGATACTGAAGGAAGAGGG - Intronic
1049702394 8:144021141-144021163 GAGAGGATACTGAAGGAAGAGGG - Intronic
1050175841 9:2868629-2868651 CAGAGGAGAGAGAAGGTCAAAGG - Intergenic
1050194288 9:3064457-3064479 CAGAGGTTACAGAAGTAGGGTGG - Intergenic
1050503103 9:6319079-6319101 CACAAGATAGAGAAACAGGAAGG + Intergenic
1050610438 9:7346871-7346893 TGGAGGATGGAGGAGGAGGATGG - Intergenic
1050730539 9:8704238-8704260 CAGAGGATGGAGTGGGAGGGGGG - Intronic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1050766491 9:9141212-9141234 GGGAGGAGAGAGAAGGGGGAGGG - Intronic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1051072405 9:13187562-13187584 AAAAAGAAAGAGAAGGAGGAGGG - Intronic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051251435 9:15162651-15162673 CAAAGGAAAGACAAGCAGGAAGG + Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051823562 9:21194090-21194112 CATAGCATTGAGAAGGAGCACGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1051923106 9:22290967-22290989 ATGAAGATAGAGAAGGAAGAAGG + Intergenic
1052809810 9:33047511-33047533 CATAGGAGAAAGATGGAGGAGGG + Intronic
1054810765 9:69432300-69432322 CAGATGAAAGAGAAGGCTGAGGG + Intronic
1054877011 9:70107457-70107479 GTGAGGATAGAGGAGAAGGAAGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055203489 9:73696940-73696962 AAGAGGAGAGAAAAAGAGGAAGG + Intergenic
1055281143 9:74676015-74676037 CAGAGGGTAGAGGATAAGGAAGG + Intronic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055373261 9:75623716-75623738 CAGAGCATTGAGAGGGAGCATGG - Intergenic
1055505818 9:76948051-76948073 CAGAGGCTGGGGAAGGAGGGTGG - Intergenic
1055542164 9:77321947-77321969 CAGAGGATAAAGAAAGAGTTTGG - Intronic
1055738879 9:79363969-79363991 CAGAAGAAAGAGTAGGAAGAAGG - Intergenic
1055758754 9:79583565-79583587 GAGAGGTTGGGGAAGGAGGAGGG + Intronic
1055954231 9:81759222-81759244 CAGAGGAAAGAAAAGGGGAAAGG - Intergenic
1056236095 9:84596201-84596223 GAGAGGAGAGAGGAGGAAGATGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056344144 9:85673232-85673254 AGGGGGATAGGGAAGGAGGATGG + Intronic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056672248 9:88640185-88640207 TGGAGGAGAGAGGAGGAGGAAGG + Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057106266 9:92420542-92420564 TAGAAGAGAGGGAAGGAGGATGG - Intronic
1057226518 9:93296060-93296082 GGGAGGATAGAGGGGGAGGAAGG - Intronic
1057226528 9:93296087-93296109 GGGAGGATAGAGGGGGAGGAAGG - Intronic
1057226654 9:93296431-93296453 GGGAGGATGGAGAAGGAGGAAGG - Intronic
1057226742 9:93296706-93296728 GGGAGGATAGAGAGGGAGGAAGG - Intronic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057516607 9:95727274-95727296 AAGAGGAAAGAGAAGGGGGGTGG - Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057873122 9:98732964-98732986 CAGAGGAGAGAGATGGAGTGGGG - Exonic
1057980880 9:99661996-99662018 CAGATGGTAGAAATGGAGGAAGG + Intergenic
1058386698 9:104444809-104444831 CATAGGAGAGAGATGGAGGCTGG - Intergenic
1058637324 9:107049285-107049307 CAGTGGACAGTGCAGGAGGAGGG - Intergenic
1058674433 9:107388401-107388423 AAGAGGGTAGAGAAGAAGGTTGG + Intergenic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1058852056 9:109022021-109022043 GAGAGGAGAGAAAAGGAGTAAGG - Intronic
1058969470 9:110067052-110067074 GGGAAGATAGAGAATGAGGAAGG + Intronic
1059174404 9:112155926-112155948 AAGAAGGAAGAGAAGGAGGAAGG + Intronic
1059286287 9:113174624-113174646 CAGAGAATAAAGAGGGATGATGG + Intronic
1059410085 9:114126436-114126458 AAGAGGAGAGGGAGGGAGGAAGG - Intergenic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1059873416 9:118603502-118603524 CAGAAGATAAAGACAGAGGATGG - Intergenic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060496536 9:124123384-124123406 CAGAGGCCAGAGAAGGCAGATGG + Intergenic
1060741729 9:126103201-126103223 CAGAGGAGAGAGCAGGTGGAAGG - Intergenic
1060821994 9:126666462-126666484 AAGAGGAAAGGGAAGCAGGAAGG + Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061022175 9:128023058-128023080 CAGAGGGTAGAGGAGGAAGTGGG - Intergenic
1061185820 9:129052597-129052619 CAGCGGAGGTAGAAGGAGGAGGG + Intronic
1061246307 9:129402743-129402765 GAGAGGAGAGAAAAGGGGGAGGG - Intergenic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638417 9:137503611-137503633 AGGAGGAGGGAGAAGGAGGAGGG + Intronic
1062675359 9:137740072-137740094 CAGAGGGCAGACAAGGTGGATGG - Intronic
1185449551 X:275204-275226 GAGAGGATGGAGAAGGAGCAGGG + Intergenic
1185485831 X:481466-481488 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485896 X:481690-481712 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485972 X:481949-481971 CGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185661999 X:1735474-1735496 AAGAGGAGGGAGAAAGAGGAGGG - Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1185966470 X:4610683-4610705 GAAAGGAAAAAGAAGGAGGAAGG + Intergenic
1186228734 X:7429562-7429584 AAAAGGATAAAGAAGGTGGAGGG + Intergenic
1186473955 X:9842819-9842841 AAGAGGGGAGGGAAGGAGGAGGG - Intronic
1186534797 X:10335483-10335505 CAGAGGTTAGGAAAGGAAGAGGG + Intergenic
1186646893 X:11516846-11516868 GAGATGACAGAGAAGGAGGCTGG - Intronic
1186833536 X:13415080-13415102 CAGAAGATAACGAAGGAGGCTGG - Intergenic
1186940605 X:14503234-14503256 CAGAGGACAGAGCAGTAGGGTGG + Intergenic
1187323011 X:18257952-18257974 GAGAGGAAAGGGAAGGGGGAAGG + Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187470715 X:19567097-19567119 CAGAGGTTAGGGAAGGGGGTGGG + Intronic
1187675937 X:21716636-21716658 TGGAAGATAGAAAAGGAGGAAGG - Intronic
1187794790 X:22991853-22991875 CAGAAGATAGAAAAGGAGGAGGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1188522439 X:31053746-31053768 CTGAGGAGAGAGAGGGAGGGAGG - Intergenic
1188791839 X:34414625-34414647 CAGAGCATTGAGAGGGAGCAAGG + Intergenic
1188862423 X:35272855-35272877 GAGAGGACAGAGGAGGAGAAAGG + Intergenic
1188878180 X:35458630-35458652 GAGAGGATAGAAAAGGAGTGGGG + Intergenic
1188896277 X:35672278-35672300 AAGAAGATAAAGAAGAAGGAAGG - Intergenic
1189034337 X:37480112-37480134 GAGAGGAGAGAGACAGAGGAGGG + Intronic
1189068166 X:37834083-37834105 CAGAGGACAGAGATGGTGAAGGG - Intronic
1189512204 X:41674071-41674093 CAGAGGAGGAAGAAAGAGGAAGG + Intronic
1189571415 X:42301924-42301946 GAGAGGAGAAAGAGGGAGGAGGG - Intergenic
1189898617 X:45682607-45682629 CTGAGGATAGAGGTGGAGGATGG - Intergenic
1190053470 X:47169039-47169061 CAAAGAATAGAGTAGGGGGAGGG + Intronic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190656554 X:52617870-52617892 CAGAGGGCAGAGAAAGAGGTAGG - Intergenic
1190885760 X:54530034-54530056 CGGAGGAGGGAGAAGGAGGACGG - Intergenic
1190942975 X:55061386-55061408 GAGAGTAGAGAGCAGGAGGAGGG - Intergenic
1191223772 X:58017899-58017921 CAGAGCATAGAGAGGGAGCATGG + Intergenic
1191872301 X:65758460-65758482 CAGAGGATGGGGAATGTGGATGG + Intergenic
1191940433 X:66474485-66474507 CAGAGGAGAGAGAAAGAGAGAGG + Intergenic
1192137757 X:68620341-68620363 GAGAGGAGAGAAAAGAAGGAAGG - Intergenic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1192656061 X:72996238-72996260 AAGAGGATATAGAAAGAGGGAGG + Intergenic
1192666059 X:73086763-73086785 AAGAGGATATAGAAAGAGGGAGG - Intergenic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193742982 X:85241274-85241296 GAGAGGAGAGAGAAGGAGGGCGG + Intergenic
1194079404 X:89439932-89439954 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1194643892 X:96434699-96434721 CAGAGGAAAGATAATGATGAGGG + Intergenic
1195318214 X:103699376-103699398 GGGAGTATAGAGAAGGAGGCAGG + Intergenic
1195363160 X:104104562-104104584 CAGAGGATACAGAACTAGGCAGG + Exonic
1195824030 X:108977796-108977818 CTGAAGATAGAGTAGAAGGATGG + Intergenic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1196193304 X:112815801-112815823 CAGAGGTCAGAGAAGAAGTAGGG + Exonic
1196310097 X:114153803-114153825 CAGAGAAAAGAGAGGGAGAATGG + Intergenic
1196999401 X:121422028-121422050 CATAGGATACTGAAGTAGGAAGG - Intergenic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197436510 X:126434845-126434867 TAGAGGAGGGGGAAGGAGGAAGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1197868373 X:131042439-131042461 CAGAGTCTGGAGAAAGAGGATGG + Intergenic
1198428407 X:136542142-136542164 GAGGGGAGAGAGAAGGAGGCTGG - Intronic
1198802217 X:140459567-140459589 TGGAGAATAGAGGAGGAGGAGGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199303547 X:146240744-146240766 AAGGGGATAGGGAGGGAGGAGGG - Intergenic
1199541850 X:148966445-148966467 GAGAGGAGAGAGGAGGAGGGAGG - Intronic
1199612941 X:149633103-149633125 CAGAGGATGGGAAAGGAAGATGG - Intergenic
1199637531 X:149827236-149827258 GAGAGGAAAGAGAGGGAGGGGGG + Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1200100182 X:153686285-153686307 CAGAGGCTCGAGAAGGATGTAGG - Intronic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1200137806 X:153883425-153883447 CAGAGGAGAGAGCAGGGGGGCGG + Intronic
1200326434 X:155245176-155245198 CATTGGATACATAAGGAGGAGGG - Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200382917 X:155858573-155858595 GAGAGGAGAGAGAATGAGCATGG - Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200432022 Y:3095237-3095259 AAGAAGGAAGAGAAGGAGGAGGG + Intergenic
1201304631 Y:12540247-12540269 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201471155 Y:14336290-14336312 CAGAGGACAAAGGAGGAGAAAGG - Intergenic
1201509591 Y:14744245-14744267 CAGAAGATAAAGAGTGAGGATGG + Intronic
1201897451 Y:19007293-19007315 CAGAGGATAAAGAAGAGGCATGG + Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic