ID: 1086360022

View in Genome Browser
Species Human (GRCh38)
Location 11:86048958-86048980
Sequence CTTCCAATTCTGAAAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086360022 Original CRISPR CTTCCAATTCTGAAAATGGG AGG Intronic
904676268 1:32201038-32201060 CTTCGAATTCTGGGACTGGGGGG - Intronic
905508489 1:38499825-38499847 TTTACAACTTTGAAAATGGGTGG + Intergenic
905527565 1:38650604-38650626 CTTTCCCATCTGAAAATGGGGGG - Intergenic
910440104 1:87243007-87243029 CTTCCAATTCTGAAGAGGAAAGG - Intergenic
910877142 1:91887694-91887716 TCTCCAATTCTGCAATTGGGTGG - Intronic
911768627 1:101710856-101710878 CTTCAACTTATGAAACTGGGGGG - Intergenic
913011665 1:114689447-114689469 TTTCCCATTCTTAAAATGGGGGG + Intronic
916323812 1:163534851-163534873 ACTCCCATTTTGAAAATGGGAGG + Intergenic
916591926 1:166199746-166199768 GTTGCAATCCTGAAGATGGGAGG + Intergenic
918537788 1:185593478-185593500 TTTCCCATTCTGAAAATAGATGG + Intergenic
919352960 1:196483343-196483365 CATCCAATTGTGAAAAATGGTGG - Intronic
919642635 1:200060311-200060333 CCTACAAGTCTGAGAATGGGTGG + Intronic
920640762 1:207749971-207749993 CTTCCAAGCCTGAAAATGGATGG + Intergenic
920779025 1:208969899-208969921 CTTCCTATTCTGCAAGTTGGAGG + Intergenic
921606899 1:217166514-217166536 CTCCCAATGCTGAACATGGTGGG - Intergenic
923155055 1:231271165-231271187 CTTCGAATTTTGGAATTGGGAGG + Intronic
924380308 1:243457025-243457047 CTTCCAAAAAGGAAAATGGGCGG + Intronic
1063529837 10:6820554-6820576 CCTGCAATTCTGCAGATGGGTGG - Intergenic
1064799416 10:19052008-19052030 CTTACAAATCTCACAATGGGCGG - Intronic
1065263610 10:23952260-23952282 CTTCCAACTCAGAAAATGTGTGG - Intronic
1068269036 10:54695704-54695726 CTGACCATTCTGAAAATCGGAGG + Intronic
1069229522 10:65991709-65991731 CATCCAAATTGGAAAATGGGAGG - Intronic
1070590735 10:77799100-77799122 CTTACAATTCTGTAATTGTGAGG - Intronic
1071084384 10:81851050-81851072 CTGCCAATTTTATAAATGGGTGG + Intergenic
1071373923 10:84983101-84983123 CTTTCCATTCAGAAAATGAGGGG - Intergenic
1072042437 10:91621387-91621409 CTTCCACTTCTGAACGTGAGAGG + Intergenic
1072299619 10:94046483-94046505 TTTCCTATTCTGAAAATGAAGGG - Intronic
1072659414 10:97354268-97354290 TTTCCATTTCTGAGAATGAGTGG + Intergenic
1075492990 10:122890158-122890180 ATTCCAATTCTGCTACTGGGTGG + Intergenic
1078389130 11:10920527-10920549 ATTTCTATTCTGAAAATGGAGGG - Intergenic
1079526362 11:21393801-21393823 CTTCCACTTTTAAATATGGGTGG + Intronic
1080997705 11:37624236-37624258 CTTCCTATTTTCAAAATGTGGGG + Intergenic
1082806799 11:57457012-57457034 TTTCCTATTCAGAAGATGGGAGG - Intergenic
1083396066 11:62392927-62392949 CTTCCTAATCTGGAGATGGGAGG + Exonic
1084873643 11:72114841-72114863 CCTCAAATTCTGAATATTGGAGG - Intergenic
1085074401 11:73577132-73577154 CTACCAATTTTGGAAATGGAAGG + Intronic
1085347622 11:75778453-75778475 CTTCCCACTCTGGAGATGGGAGG + Intronic
1086268375 11:85028838-85028860 CCTCCAACTCTGAAAAGGGCTGG + Intronic
1086360022 11:86048958-86048980 CTTCCAATTCTGAAAATGGGAGG + Intronic
1087217014 11:95505361-95505383 CTTCAGACTCTGAAAATGAGGGG - Intergenic
1087281241 11:96213243-96213265 CTTCCTATTTTAAAAATGTGAGG + Intronic
1091073705 11:132593523-132593545 CTTTCAATGTTGAAAATGGATGG + Intronic
1092497452 12:9011208-9011230 CACCCAATTCTGACAATAGGTGG - Intergenic
1092561382 12:9617646-9617668 CTTCCAATTCTGTGGATGGAGGG + Intergenic
1093546664 12:20356738-20356760 TTTCAAATTCTGAACTTGGGTGG + Intergenic
1095950187 12:47777474-47777496 TTTCCACATCTAAAAATGGGTGG - Intronic
1097610240 12:61810795-61810817 CTTCCAACTGCCAAAATGGGAGG - Intronic
1099439282 12:82682204-82682226 CTTCCAAGTCTGAGAATGTGGGG - Intergenic
1099557464 12:84128358-84128380 CCTCCAATTCAGAAAAGGGCGGG - Intergenic
1102879799 12:116475531-116475553 CATCCAATTCTGAGAATTGTTGG - Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104415219 12:128592391-128592413 CTTGCCATTCAGAAACTGGGAGG - Intronic
1106640060 13:31574663-31574685 CTGCCAATTCCAAAAATGGAGGG - Intergenic
1107359268 13:39602373-39602395 CATCCAGAACTGAAAATGGGCGG - Intronic
1107570226 13:41649767-41649789 CTTCCAACTCTGAAATTCTGTGG - Intronic
1108496877 13:51034097-51034119 CTTTCAATTCTGAAGATGTCTGG - Intergenic
1109916594 13:68995249-68995271 CTTCAAATTCTTAAGATGGAAGG - Intergenic
1110018430 13:70438460-70438482 CTACCAACCATGAAAATGGGAGG - Intergenic
1110415835 13:75251251-75251273 ATTCCTATTCTGCAAATGCGTGG - Intergenic
1111167824 13:84485333-84485355 TTTCTCAGTCTGAAAATGGGGGG - Intergenic
1112400437 13:99072888-99072910 CTTGCAAGGCTGAAGATGGGAGG + Intronic
1112834777 13:103500927-103500949 CTTCCATTTCTGTAACTTGGAGG + Intergenic
1114985082 14:28217134-28217156 CCTCCACTTGTGAAAATTGGAGG - Intergenic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1117589881 14:57256287-57256309 CAACCAATTCTGAAAATGTATGG + Intronic
1118169915 14:63378796-63378818 ATTACAAATCTGAAAATGGTGGG - Intronic
1118492220 14:66272189-66272211 CAACCAGTTCTGCAAATGGGAGG - Intergenic
1119513112 14:75227261-75227283 CTGCCAATACTGAAAACTGGAGG + Intergenic
1119800064 14:77436184-77436206 ATTCCAACTCTCAAAATGAGAGG - Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1125550658 15:40542046-40542068 TTTCCAATTATGAAAATCTGTGG - Intronic
1131217534 15:90551535-90551557 CTCCCACTTCTCAAAATAGGGGG - Intronic
1135398490 16:22149138-22149160 CTTCCTTTTCTGAAAAATGGGGG - Intronic
1135840988 16:25876017-25876039 CTTCCAATTCTGAAATTCCTTGG - Intronic
1136075729 16:27816139-27816161 CTTCCACCTCTGGAACTGGGAGG - Intronic
1136117748 16:28105990-28106012 CTTCCCAATCTGGAGATGGGGGG + Intronic
1138111521 16:54327969-54327991 TTTCCTAATCTGTAAATGGGGGG + Intergenic
1141244390 16:82292701-82292723 TTTCCAGTTCTGAGAATGGAGGG + Intergenic
1147253567 17:39167748-39167770 CTTTCAATTCTGCAAAGAGGAGG - Intergenic
1153162419 18:2222499-2222521 GTTCCACTTCTGAGAATGGTGGG + Intergenic
1154056476 18:11017346-11017368 CTTACAATTCTGAAAATCCATGG + Intronic
1154399957 18:14027031-14027053 CTGCTAAAACTGAAAATGGGTGG - Intergenic
1156112992 18:33749958-33749980 CTTCCACTTTTGAAATTGTGCGG - Exonic
1157625961 18:49051430-49051452 CTTCCAATTCTGACTAGGTGTGG + Intronic
1158575513 18:58634130-58634152 ATTCCAATTTTGTAAATGTGAGG + Intergenic
1162610609 19:11747279-11747301 CATCCAATTTGGAAAATGTGTGG - Intergenic
1163141716 19:15353858-15353880 TTTCCAAATCTGAGAAAGGGAGG - Exonic
1163192008 19:15683938-15683960 CTGCTAATTCTGAAACTGTGAGG + Intronic
1163426199 19:17242411-17242433 TTTCCTCATCTGAAAATGGGAGG + Intronic
1166143868 19:40821371-40821393 CATCCAAAGCTGAGAATGGGTGG + Intronic
1166183741 19:41125725-41125747 CATCCAAAGCTGAGAATGGGTGG - Intronic
926586972 2:14697215-14697237 CTTCCAATTCTTCAAACTGGGGG - Intergenic
926692940 2:15749738-15749760 ATTTCACTTCTGAAAATGGCTGG + Intergenic
929707701 2:44232367-44232389 CTTTTGATTCTGAAAATTGGGGG + Intronic
930251663 2:49041636-49041658 CTTTCAATTCTGGAATTGGAAGG + Intronic
930769545 2:55117880-55117902 GTTCCATTTCTTAACATGGGTGG + Intergenic
932572110 2:72943528-72943550 CTTCCTGGTCTGCAAATGGGAGG + Exonic
933515257 2:83292258-83292280 CTTGCAAGTCTGAACATGGAGGG + Intergenic
933523826 2:83410392-83410414 CTTCTACTTGTGGAAATGGGAGG - Intergenic
934156710 2:89207767-89207789 CTTCCACTTCTGTAAAATGGTGG - Intergenic
934210606 2:89974984-89975006 CTTCCACTTCTGTAAAATGGTGG + Intergenic
937106318 2:119317554-119317576 TTTCAAATTATTAAAATGGGTGG + Intronic
938045204 2:128112536-128112558 CTACCAATTCCTAAAAGGGGAGG - Intronic
939127692 2:138196930-138196952 ATTCCAATTCTAAATATGGATGG - Intergenic
939378500 2:141402246-141402268 TTGACCATTCTGAAAATGGGAGG - Intronic
939608392 2:144280286-144280308 CTTCTATTTCTGTATATGGGTGG - Intronic
940449323 2:153818178-153818200 TTTGCAATTCTGGGAATGGGAGG + Intergenic
940540375 2:155008757-155008779 CTCCAAATTCTGAAAATGTTTGG - Intergenic
940641777 2:156352199-156352221 GTTACAATTTTGAAAATGTGGGG - Intergenic
941040843 2:160621318-160621340 CTTCCTCATCTGAAAATGAGGGG - Intergenic
941162862 2:162054726-162054748 CTCACAATTCTGGAGATGGGAGG - Intronic
941345903 2:164369241-164369263 CTTCTATTTATGAAAATAGGAGG + Intergenic
1169718509 20:8646327-8646349 CTTCCAATTCTGAACAGGGGAGG - Intronic
1170746963 20:19108147-19108169 TTTCCAATTCTGAATCTGGGTGG - Intergenic
1172579537 20:36035998-36036020 CTTCCTTTTTTGAAAATAGGTGG - Intergenic
1178820868 21:35974047-35974069 CTTCCAGGTCTGAACATGTGGGG - Intronic
1179497239 21:41780208-41780230 CGTGCAATTGTGAAAATGGGAGG + Intergenic
1179614117 21:42570744-42570766 CTTCATATTCTCAAAATGAGAGG + Intronic
1180725992 22:17946926-17946948 CTTCCAAGCCGGAAGATGGGTGG + Intronic
1181572434 22:23774873-23774895 CTTGCAATCCAGAAAATGGGAGG - Intronic
949236611 3:1816872-1816894 CTTCCATTTATGAGGATGGGAGG + Intergenic
951421007 3:22484664-22484686 CTTGCAATGCTGAAAATGAGAGG - Intergenic
952306780 3:32153845-32153867 TTTCCAGTTCTGAATAGGGGTGG - Intronic
953829943 3:46287697-46287719 CTTCAACTTCTGAGGATGGGTGG + Intergenic
954776557 3:53024220-53024242 CTTCCAAGTCTGGAGGTGGGTGG + Intronic
955472784 3:59303338-59303360 CTTTTAATTTTGAACATGGGTGG - Intergenic
958100488 3:89002808-89002830 ATTCCTACTCTGAAAATGGAAGG + Intergenic
958717562 3:97803854-97803876 CTTCCTTTTCTTTAAATGGGTGG + Intergenic
961465462 3:127078467-127078489 TTCCCCATTCTGTAAATGGGCGG - Intergenic
963231421 3:142911814-142911836 CTACCATTCCTGAAGATGGGGGG - Intergenic
963418812 3:145032954-145032976 TTCCTCATTCTGAAAATGGGAGG + Intergenic
967700596 3:192587840-192587862 CTCTCAAATCTGAAAATGTGAGG + Intronic
967960278 3:194915227-194915249 ATTCTTCTTCTGAAAATGGGAGG - Intergenic
968012742 3:195296665-195296687 CTTCCAATTCTGTATAAGGAGGG - Intronic
971709001 4:30087258-30087280 CTTCCCATTCTGAAAATTCTAGG - Intergenic
971832451 4:31713694-31713716 CTTCCAGTACTGAAAAATGGTGG + Intergenic
972229232 4:37051534-37051556 CTTACTTTTCTGAAAATGTGGGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
973974972 4:56253993-56254015 CTTCCAATTCTGAGATTCGAAGG - Intronic
975303334 4:72817816-72817838 CTTCCAATTCTGAAAGCAGATGG - Intergenic
976604039 4:86965900-86965922 TTCCCAATTCAGAAAATTGGAGG + Intronic
976934666 4:90615006-90615028 TTTCCCATTCTGAAAATTGTAGG + Intronic
977149177 4:93487876-93487898 CTTCCAATTTTGGTAATGGTTGG - Intronic
978712722 4:111804769-111804791 CTTTCCTCTCTGAAAATGGGTGG - Intergenic
981487055 4:145297849-145297871 ATTCCAATTCTGAAGACTGGAGG - Intergenic
982032583 4:151315374-151315396 TTTCCAATTTTGGAAATGGAGGG - Intronic
983711281 4:170719929-170719951 CTTCCAAATCAGAAAGTGGGAGG + Intergenic
983786974 4:171744621-171744643 CTTCCAAATCTGGAATTGGAGGG + Intergenic
983976151 4:173936725-173936747 TTTCCAGTTCTGCATATGGGAGG - Intergenic
983992287 4:174134969-174134991 CTTCCAATAATGAAGATGTGTGG + Intergenic
984583453 4:181535912-181535934 CTTCTCATTTTGAAAATGAGAGG + Intergenic
985694802 5:1334079-1334101 CTCCCAGTTCTGAAAAGGGAGGG - Intronic
988781425 5:34526026-34526048 CTTCCAGTTCTGACATTGGCAGG - Intergenic
993423541 5:87733178-87733200 TTTCCAATTCTGAAAATTAGTGG + Intergenic
994914553 5:105957122-105957144 ATTACATTTCTGAAAATAGGAGG - Intergenic
1000975327 5:167758147-167758169 CTTCCAACTCTGACACTGTGAGG - Intronic
1001777767 5:174341799-174341821 ATTCCCATTCCCAAAATGGGTGG + Intergenic
1003365253 6:5468031-5468053 CTTCCAACTCTGATATTTGGTGG - Intronic
1004066043 6:12245534-12245556 CTTCCACTTCTGCTGATGGGTGG + Intergenic
1006732805 6:36248877-36248899 CTTCATCTTCTGAAAAAGGGGGG + Intronic
1006982697 6:38158627-38158649 CTTCCAGTTCTGGAGATGGACGG - Intergenic
1007074739 6:39059253-39059275 TTTCCCCATCTGAAAATGGGAGG - Intronic
1008588042 6:52966678-52966700 CTCCTAATCCTTAAAATGGGGGG + Intergenic
1010213304 6:73379836-73379858 CTTCCAACTCTGAAAGTGCTGGG + Intronic
1011663826 6:89616695-89616717 CATCCCATTCTGGAAAGGGGTGG - Intronic
1014638465 6:123878981-123879003 TTTCCAATACTGAAAATGAGTGG + Intronic
1018722621 6:166584391-166584413 CTTCCAAATGTGAACATGGAGGG + Intronic
1021053811 7:16021879-16021901 GTTCCAATTCTGGAGGTGGGGGG + Intergenic
1021833362 7:24641206-24641228 CTTCCAATGTTGAAAATCAGTGG - Intronic
1023291874 7:38677117-38677139 CTTCAAATGCTGAGATTGGGGGG + Intergenic
1031820177 7:126490858-126490880 TTTCCAATTTTTAAAATGGGAGG - Intronic
1033857301 7:145579369-145579391 CTTCTAATTCTGAAACTGTGGGG - Intergenic
1034165502 7:149022120-149022142 ATTCCATTTCTGAAAGGGGGTGG + Intronic
1035937535 8:3858485-3858507 CTTCCATTTCTACAAATGGTTGG - Intronic
1037020587 8:13965600-13965622 CCTCTAATTCTGGAATTGGGAGG - Intergenic
1038050774 8:23808674-23808696 CTGACAAACCTGAAAATGGGTGG - Intergenic
1038181714 8:25235151-25235173 CTTCCTCCTCTGAAAAAGGGAGG - Intronic
1039558418 8:38493699-38493721 GTTCCATTTCTTAAGATGGGAGG + Intergenic
1039675563 8:39661822-39661844 CTTCCATTTGTGAAAAATGGAGG + Intronic
1039875376 8:41580120-41580142 CTTAAAATTCTGAAATTTGGTGG - Intronic
1040333898 8:46406408-46406430 CTTCCAGAAGTGAAAATGGGGGG + Intergenic
1041172032 8:55153183-55153205 CGTCCAATTTTAAAACTGGGAGG - Intronic
1042575050 8:70208638-70208660 CTTCCCATTCTGAAAATTCTAGG + Intronic
1043472297 8:80575110-80575132 CTCTAAATTCTGAAAAAGGGGGG + Intergenic
1043864133 8:85356226-85356248 CTTCCAATTGTGCAAATAGAAGG - Intronic
1044099011 8:88106606-88106628 CTTACATTTGTGAAAATGTGGGG - Intronic
1045403523 8:101842458-101842480 CTAACAAGTCTGAATATGGGTGG + Intronic
1046311898 8:112448344-112448366 CTTCCACATATGAAACTGGGTGG + Intronic
1048197243 8:132341958-132341980 TTTCCAAGTCTGAAAAGAGGAGG - Intronic
1048892942 8:138964128-138964150 GTTCCCACTCTGGAAATGGGAGG + Intergenic
1049034686 8:140065568-140065590 TTTCCCATTCTGAAAATTCGAGG + Intronic
1050296018 9:4206096-4206118 CTTCATAATTTGAAAATGGGGGG - Intronic
1051145725 9:14025393-14025415 CTTTCCATTCTGAGAATAGGAGG + Intergenic
1052490972 9:29167827-29167849 CTTGCAATTATTAAAATAGGTGG - Intergenic
1052831333 9:33218358-33218380 ATTTCAGTTCTGCAAATGGGAGG + Intronic
1054946604 9:70803073-70803095 CTTCCCCTTCAGAAAATTGGTGG - Intronic
1056514515 9:87337367-87337389 CTCGCAATTGTGCAAATGGGGGG + Intergenic
1058136146 9:101309703-101309725 CTTTCACATCTGTAAATGGGAGG - Intronic
1059033798 9:110731476-110731498 CTTTCAATACTGAAAAAAGGGGG + Intronic
1059588042 9:115627559-115627581 CTGCCTATTCTGAAGAAGGGTGG - Intergenic
1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG + Intronic
1061946105 9:133908841-133908863 CCTGCAGTTCTGAAAATGTGTGG + Intronic
1187370617 X:18702633-18702655 CTTCCAATGCTGAAAATACAAGG - Intronic
1190968720 X:55328514-55328536 CTTCCAAGTCTGAACATGAATGG - Intergenic
1190981574 X:55460796-55460818 CATCCAAGTCTTAAATTGGGAGG + Intergenic
1190987124 X:55512384-55512406 CATCCAAGTCTTAAATTGGGAGG - Intergenic
1191826869 X:65375537-65375559 CTTCCACTTGTGGAAATGAGAGG + Intronic
1193218141 X:78889043-78889065 CTTACAATTCTGAAAATCACAGG + Intergenic
1195196810 X:102505098-102505120 CTTCCAATTCTGAAAGAAGATGG - Intergenic
1196247386 X:113415698-113415720 CTTCCATTTGAGAAAATTGGAGG + Intergenic
1197070458 X:122290678-122290700 CTTCCAATTGTGAAAAAGTTTGG + Intergenic
1198459648 X:136850782-136850804 CTTCCATTTCTGGAAATGATGGG - Intronic
1199465981 X:148137704-148137726 CTTCCAATGTGGAATATGGGAGG - Intergenic
1199757020 X:150874342-150874364 CTTCCTATTCTGAGAATGATGGG - Intronic
1201252871 Y:12077134-12077156 CTTCAAACTGTGAAAATGTGTGG + Intergenic