ID: 1086367070

View in Genome Browser
Species Human (GRCh38)
Location 11:86118017-86118039
Sequence CAGCTTTTCTATAGGTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086367064_1086367070 16 Left 1086367064 11:86117978-86118000 CCATGTGACCTTGGAATAGTCGA No data
Right 1086367070 11:86118017-86118039 CAGCTTTTCTATAGGTAAAATGG No data
1086367065_1086367070 8 Left 1086367065 11:86117986-86118008 CCTTGGAATAGTCGATTGATCTC No data
Right 1086367070 11:86118017-86118039 CAGCTTTTCTATAGGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086367070 Original CRISPR CAGCTTTTCTATAGGTAAAA TGG Intergenic
No off target data available for this crispr