ID: 1086370671

View in Genome Browser
Species Human (GRCh38)
Location 11:86152498-86152520
Sequence CAGGACTAGGGGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086370658_1086370671 17 Left 1086370658 11:86152458-86152480 CCAGTGTTTTCAGTGTGGAGAAG No data
Right 1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086370671 Original CRISPR CAGGACTAGGGGAGGGAGGC AGG Intergenic
No off target data available for this crispr