ID: 1086373102

View in Genome Browser
Species Human (GRCh38)
Location 11:86174470-86174492
Sequence AACTAAACTGACCGGAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086373102_1086373105 7 Left 1086373102 11:86174470-86174492 CCTAAATTCCGGTCAGTTTAGTT No data
Right 1086373105 11:86174500-86174522 ATGATAAGACCTCAGCCACATGG No data
1086373102_1086373106 15 Left 1086373102 11:86174470-86174492 CCTAAATTCCGGTCAGTTTAGTT No data
Right 1086373106 11:86174508-86174530 ACCTCAGCCACATGGCCCATAGG No data
1086373102_1086373111 26 Left 1086373102 11:86174470-86174492 CCTAAATTCCGGTCAGTTTAGTT No data
Right 1086373111 11:86174519-86174541 ATGGCCCATAGGGAGGAAGCTGG No data
1086373102_1086373112 27 Left 1086373102 11:86174470-86174492 CCTAAATTCCGGTCAGTTTAGTT No data
Right 1086373112 11:86174520-86174542 TGGCCCATAGGGAGGAAGCTGGG No data
1086373102_1086373108 16 Left 1086373102 11:86174470-86174492 CCTAAATTCCGGTCAGTTTAGTT No data
Right 1086373108 11:86174509-86174531 CCTCAGCCACATGGCCCATAGGG No data
1086373102_1086373109 19 Left 1086373102 11:86174470-86174492 CCTAAATTCCGGTCAGTTTAGTT No data
Right 1086373109 11:86174512-86174534 CAGCCACATGGCCCATAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086373102 Original CRISPR AACTAAACTGACCGGAATTT AGG (reversed) Intergenic
No off target data available for this crispr