ID: 1086373105

View in Genome Browser
Species Human (GRCh38)
Location 11:86174500-86174522
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086373102_1086373105 7 Left 1086373102 11:86174470-86174492 CCTAAATTCCGGTCAGTTTAGTT No data
Right 1086373105 11:86174500-86174522 ATGATAAGACCTCAGCCACATGG No data
1086373104_1086373105 -1 Left 1086373104 11:86174478-86174500 CCGGTCAGTTTAGTTATAAGGCA No data
Right 1086373105 11:86174500-86174522 ATGATAAGACCTCAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086373105 Original CRISPR ATGATAAGACCTCAGCCACA TGG Intergenic
No off target data available for this crispr