ID: 1086373115

View in Genome Browser
Species Human (GRCh38)
Location 11:86174530-86174552
Sequence GGAGGAAGCTGGGAATGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086373107_1086373115 -2 Left 1086373107 11:86174509-86174531 CCTCAGCCACATGGCCCATAGGG No data
Right 1086373115 11:86174530-86174552 GGAGGAAGCTGGGAATGAGCAGG No data
1086373110_1086373115 -8 Left 1086373110 11:86174515-86174537 CCACATGGCCCATAGGGAGGAAG No data
Right 1086373115 11:86174530-86174552 GGAGGAAGCTGGGAATGAGCAGG No data
1086373104_1086373115 29 Left 1086373104 11:86174478-86174500 CCGGTCAGTTTAGTTATAAGGCA No data
Right 1086373115 11:86174530-86174552 GGAGGAAGCTGGGAATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086373115 Original CRISPR GGAGGAAGCTGGGAATGAGC AGG Intergenic
No off target data available for this crispr