ID: 1086374488

View in Genome Browser
Species Human (GRCh38)
Location 11:86186418-86186440
Sequence CTCAGTCCCACCACGGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086374488_1086374492 2 Left 1086374488 11:86186418-86186440 CCTGACTCCGTGGTGGGACTGAG No data
Right 1086374492 11:86186443-86186465 CCTGGCTCCTGAGTCGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086374488 Original CRISPR CTCAGTCCCACCACGGAGTC AGG (reversed) Intergenic
No off target data available for this crispr