ID: 1086385281

View in Genome Browser
Species Human (GRCh38)
Location 11:86301120-86301142
Sequence CTTTTTATTCTGAAGGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086385275_1086385281 27 Left 1086385275 11:86301070-86301092 CCAGGTAGTGTGGGTGCCTTAAT No data
Right 1086385281 11:86301120-86301142 CTTTTTATTCTGAAGGTTCTAGG No data
1086385277_1086385281 11 Left 1086385277 11:86301086-86301108 CCTTAATTTATGAAGTGGTCTTC No data
Right 1086385281 11:86301120-86301142 CTTTTTATTCTGAAGGTTCTAGG No data
1086385274_1086385281 28 Left 1086385274 11:86301069-86301091 CCCAGGTAGTGTGGGTGCCTTAA No data
Right 1086385281 11:86301120-86301142 CTTTTTATTCTGAAGGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086385281 Original CRISPR CTTTTTATTCTGAAGGTTCT AGG Intergenic
No off target data available for this crispr