ID: 1086386806

View in Genome Browser
Species Human (GRCh38)
Location 11:86317450-86317472
Sequence GGCTCAATGAAACCAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 426}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086386806 Original CRISPR GGCTCAATGAAACCAAAATC TGG Intronic
903137154 1:21317130-21317152 GGCTCAGTAAAACCAAACACTGG - Intronic
904728870 1:32572952-32572974 AAATCAATGAAACCAAAAGCTGG - Intronic
905288221 1:36900747-36900769 ATATCAATGAAACCAAAAGCTGG + Intronic
905491701 1:38349318-38349340 GTCTCACAGAAACCAAACTCAGG + Intergenic
906358116 1:45126227-45126249 AAATCAATGAAACAAAAATCTGG + Intronic
907004333 1:50895076-50895098 AGATCAATGAAACTAAAAGCTGG + Intronic
907696018 1:56730219-56730241 AGATCAATGAAACAAAAAGCTGG + Intronic
907887104 1:58602910-58602932 GGATAAATGAAACAAAAAGCTGG - Intergenic
908809229 1:67962359-67962381 GGCTGAATGCCACCAAAAGCTGG + Intergenic
909098573 1:71321445-71321467 AGATAAATGAAACAAAAATCTGG + Intergenic
909128315 1:71704340-71704362 AACTCAATGAAAGCAAAAGCTGG + Intronic
909380620 1:74994177-74994199 GGCTCACTGAAATCCAAAACAGG - Intergenic
909981118 1:82102512-82102534 GGATAAATGAAACAAAAAGCTGG - Intergenic
910372775 1:86535028-86535050 AAATCAATGAAACCAAAATCTGG - Intergenic
910618199 1:89223658-89223680 GGATCAATAAAACCAAAAGTTGG + Intergenic
910937784 1:92499780-92499802 GAATGAATAAAACCAAAATCTGG - Intergenic
911294459 1:96097649-96097671 CCCTCAATGTAACCAAAATAGGG - Intergenic
912161414 1:106989898-106989920 AGATAAATGAAACGAAAATCTGG + Intergenic
912608868 1:111022198-111022220 AGATCAATGAAACCAACAGCTGG + Intergenic
912611941 1:111056712-111056734 AGATAAATGAAACAAAAATCTGG - Intergenic
913028248 1:114868983-114869005 AAATCAATGAAACCAAAAGCTGG - Intronic
913316024 1:117553098-117553120 GGATCAATGAAACAAAAAGTTGG + Intergenic
913339477 1:117744315-117744337 AGCTAAATGAAACAAAAAGCTGG - Intergenic
913370249 1:118090970-118090992 TGATCAATGAAACCAAATCCTGG + Intronic
915078501 1:153333107-153333129 GGATCAATGAAACAAAAAGTTGG + Intronic
915618543 1:157062233-157062255 GAGTCAATGAAACCAAAACTTGG - Intergenic
915648415 1:157290264-157290286 GTCCCAAAGAAAACAAAATCTGG + Intergenic
916603557 1:166317972-166317994 AAATCAATGAAACCAAAAGCTGG - Intergenic
917820482 1:178758228-178758250 GAATCAATGAAACCAAAAGTTGG - Intronic
917896668 1:179496642-179496664 AAATCAATGAAAGCAAAATCTGG - Intronic
918950446 1:191129332-191129354 AGATCAATGAAACCAAAAGGTGG + Intergenic
919110733 1:193216141-193216163 AGATCAATAAAACCAAAATTTGG + Intronic
919372855 1:196752137-196752159 GGTCCAATGAAAGCAAAAGCAGG - Intergenic
919555630 1:199049112-199049134 AGATCAATGAAACCAAGAACTGG + Intergenic
920220331 1:204393700-204393722 CAATCAATGAAACCAAAAGCTGG + Intergenic
920889700 1:209972302-209972324 GAATCAATGAAACCAAAAGTTGG - Intronic
922394622 1:225183615-225183637 GGATCAATGAAACCAAAAGTTGG + Intronic
923486781 1:234440385-234440407 AAATCAATGAAACCAAAAGCTGG + Intronic
923956839 1:239031827-239031849 GAATCAATGAAACCAAAAGATGG + Intergenic
924131904 1:240918775-240918797 AATTCAACGAAACCAAAATCTGG + Intronic
1063064902 10:2598834-2598856 GGCTCCATGGAGCCAAAATCAGG + Intergenic
1063324840 10:5087768-5087790 GGATCAATGAGACAAAAATTTGG - Intronic
1063819480 10:9818724-9818746 AGATCAATGAAACCAAAAATTGG - Intergenic
1064371542 10:14756128-14756150 GGATCAATAAAATCAAAATCAGG + Intronic
1064855521 10:19763178-19763200 AACTCAATGAAACCAAAAGCTGG - Intronic
1064977250 10:21130938-21130960 ATGTCAATGAAACCAAAAACTGG + Intronic
1065381193 10:25092304-25092326 GGATCAATGGAACAAAAAGCTGG - Intergenic
1065711655 10:28523783-28523805 GGCTCAAAGAACCCTAAATAGGG - Intergenic
1067260632 10:44687261-44687283 GGCCTATTGAAACAAAAATCTGG + Intergenic
1067898088 10:50207368-50207390 AAATCAATGAAACCAAAAGCTGG + Intronic
1068221380 10:54050507-54050529 GGATCAATGAAACCAAAAGTTGG - Intronic
1068494592 10:57771073-57771095 GGATCAATGAAACAAAAAGTTGG + Intergenic
1069346808 10:67479781-67479803 GGATCAGTGAAACCAAAAGTTGG + Intronic
1070465159 10:76714525-76714547 AGATAAATGAAACAAAAATCTGG + Intergenic
1071699219 10:87911513-87911535 AAATCAATGAAACCAAAAACTGG - Intronic
1072394925 10:95029056-95029078 GAATCAATGAAACAAAAATGTGG - Intergenic
1073228844 10:101949274-101949296 AAATCAATGAAACCAAAAGCTGG + Intronic
1075261346 10:120965999-120966021 GGCCAAATGAAAAGAAAATCCGG - Intergenic
1075266626 10:121004908-121004930 GGATCAATGAAACAAAAAGTTGG - Intergenic
1075577749 10:123591436-123591458 ATATCAATGAAACCAAAATTTGG + Intergenic
1076447319 10:130525556-130525578 GGGTTGATGAAACCAAAAGCAGG - Intergenic
1078318141 11:10308517-10308539 GGCACCCTGAAATCAAAATCAGG - Intronic
1078712437 11:13807395-13807417 TGCTAAATAAAACCACAATCAGG + Intergenic
1079462568 11:20696223-20696245 GAATCAATGAAACCAAAAGTTGG - Intronic
1079557283 11:21774901-21774923 GGTTCAATGAAAAAAAAATATGG + Intergenic
1080069954 11:28070648-28070670 GTCTCAAAGAAACAAAAACCTGG + Intronic
1080085400 11:28275159-28275181 GGATCAATGAAACAAAAAGTTGG + Intronic
1080095272 11:28398244-28398266 GGATAAATGAAACAAAAATTTGG + Intergenic
1080509068 11:32948800-32948822 GGCATAATGAAACCCAATTCTGG + Intronic
1080672270 11:34391999-34392021 AGATAAATGAAACAAAAATCTGG - Intergenic
1081046903 11:38285838-38285860 GAGTCAATGAAACCAAAAGTTGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1082751147 11:57019255-57019277 AACTTAATGAAACCAAAATTTGG + Intergenic
1083009271 11:59380126-59380148 GGATAAATGAAACAAAAATTTGG - Intergenic
1083098573 11:60279582-60279604 GGATCAATGAACCCAACATTGGG - Intergenic
1084467172 11:69331489-69331511 GAATCAATGAAACCCAAAACTGG - Intronic
1084922678 11:72483801-72483823 GGCTCTATGAAAGCAAGCTCTGG - Intergenic
1086386806 11:86317450-86317472 GGCTCAATGAAACCAAAATCTGG + Intronic
1087367894 11:97244802-97244824 AGATCAATGAAACCAAAAGTTGG - Intergenic
1087637962 11:100724753-100724775 AAATCAATGAAACCAAAAGCTGG - Intronic
1087791986 11:102415869-102415891 AGATCAATGAAACCAAAAGTTGG + Intronic
1088084932 11:105966066-105966088 GCCTCAATGTCACCAAAAGCGGG + Intronic
1088826677 11:113501114-113501136 GGCTCAAGGAAATAAAAATCTGG - Intergenic
1090316552 11:125795289-125795311 AGATCAATGAAACCAAAAGTTGG - Intergenic
1091125928 11:133097562-133097584 AAATCAATGAAACCAAAAACTGG + Intronic
1092608827 12:10150959-10150981 AGATCAATGAAACCAAGAACTGG - Intergenic
1093266718 12:17012289-17012311 GGATCAATAAAACAAAAAGCTGG - Intergenic
1093355851 12:18165965-18165987 TGTTAAATGAAACTAAAATCTGG + Intronic
1093496766 12:19766596-19766618 AGATCAATGAAACCAAAAGTTGG + Intergenic
1095500781 12:42836388-42836410 AGATAAATGAAACCAAAAGCAGG - Intergenic
1095604283 12:44048295-44048317 GGATCAATGAAGCTAAAATTTGG - Intronic
1097581507 12:61463087-61463109 AGATCAATGAAACAAAAATCTGG + Intergenic
1097751942 12:63365205-63365227 GAATCAATGAAACCAAAAGTTGG - Intergenic
1097953747 12:65462145-65462167 GGATCAAAGAAACCAAAGCCTGG - Intronic
1098243274 12:68489216-68489238 AGCTCTTTGATACCAAAATCAGG + Intergenic
1098713343 12:73796646-73796668 TTCTCAAGGAAACCAAACTCAGG + Intergenic
1099163953 12:79278698-79278720 GGATCAATGAAACAAAAAGTTGG + Intronic
1099587730 12:84542670-84542692 GGATCAATGAAACAAAAAGTTGG - Intergenic
1101588442 12:106105304-106105326 GACTCAGTAAAACCAAAATTGGG + Intronic
1102735935 12:115159404-115159426 GGGTCCATGACACCAAAATTAGG - Intergenic
1103690783 12:122773034-122773056 GACTCAAAAAAACAAAAATCAGG - Intergenic
1106306100 13:28511426-28511448 AAATCAATGAAACCAAAACCTGG - Intergenic
1106358725 13:29010365-29010387 GCCTCCTTGGAACCAAAATCTGG + Intronic
1107070958 13:36268663-36268685 AGATCAATGATACAAAAATCTGG + Intronic
1107569725 13:41644116-41644138 GGCACAATTAAAAAAAAATCTGG - Intronic
1108037860 13:46310703-46310725 GGATCAACAAAACCAAAAGCTGG + Intergenic
1108229720 13:48323382-48323404 GGCTCAAATTAACCAAAATCGGG - Intronic
1108962309 13:56248935-56248957 GGATCAATGAAACAAAAAGTTGG - Intergenic
1108990472 13:56650318-56650340 AGATCAATGAAACCAAAAGTGGG + Intergenic
1109378926 13:61532785-61532807 GGCTCAATGTCACAAAAGTCTGG - Intergenic
1109567310 13:64133952-64133974 AGATAAATGAAACAAAAATCTGG - Intergenic
1109729029 13:66385825-66385847 GTTTAATTGAAACCAAAATCAGG + Intronic
1109850329 13:68055441-68055463 GGCTGAATGAAAGCAAAATTTGG - Intergenic
1109922522 13:69087564-69087586 AAATCAATGAAACCAAAAGCTGG + Intergenic
1110887980 13:80662204-80662226 AGATCAATGAAACAAAAAGCTGG - Intergenic
1111393619 13:87633379-87633401 AGATCAATGACACCAAAAGCTGG - Intergenic
1112223137 13:97512035-97512057 GGGTCAATGAAAACAAAAGTTGG - Intergenic
1113349209 13:109512111-109512133 GCCTCAATGGCACCAATATCAGG + Intergenic
1115942384 14:38623434-38623456 GGATCAATGAAACAAAAAGATGG + Intergenic
1115958951 14:38812948-38812970 GGATAAATGAAACAAAAAGCTGG + Intergenic
1115997305 14:39207742-39207764 AGCTAAATGAAACAAAAAGCTGG + Intergenic
1119001771 14:70888582-70888604 GACTCCAGGATACCAAAATCTGG - Intergenic
1119582421 14:75798404-75798426 AGATAAATGAAACAAAAATCTGG - Intronic
1122747023 14:103903874-103903896 AGATCAATGAAACCAAAAGCTGG - Intergenic
1122806300 14:104261039-104261061 AAATCAATGAAACCAAAAGCTGG + Intergenic
1123462367 15:20485019-20485041 GGTTCTAAGAGACCAAAATCTGG - Intergenic
1123655693 15:22515386-22515408 GGTTCTAAGAGACCAAAATCTGG + Intergenic
1124064300 15:26325591-26325613 GACTCAATGTGTCCAAAATCAGG + Intergenic
1124986368 15:34620005-34620027 GACTCAAAGAAATGAAAATCTGG + Intergenic
1125351592 15:38773250-38773272 GGCTTACTGAAATCATAATCTGG + Intergenic
1125569331 15:40703771-40703793 AAATCAATGAAACCAAAAGCTGG - Intronic
1126184413 15:45817460-45817482 AGATAAATGAAACAAAAATCTGG - Intergenic
1126244814 15:46492273-46492295 AGATAAATGAAACAAAAATCTGG + Intergenic
1126504338 15:49386694-49386716 AGATCAATGAAACAAAAAGCTGG + Intronic
1126526283 15:49658383-49658405 TGATCAATGAAACCAAAAGTTGG - Intergenic
1126880357 15:53088279-53088301 GGATCAATAAAACCAAAAGCTGG - Intergenic
1127150094 15:56065247-56065269 AAATCAATGAAACCAAAATCTGG + Intergenic
1127714011 15:61629923-61629945 GGCTCTTTGTAACCAAAGTCAGG + Intergenic
1127897157 15:63311422-63311444 GGAAAAATGAAACAAAAATCTGG + Intergenic
1127925456 15:63536064-63536086 GGCACAATGAAACTGAAATAAGG - Intronic
1129464246 15:75715087-75715109 TGCTCTATGAATCAAAAATCTGG + Intergenic
1130359426 15:83168349-83168371 GGATCAATGAAACCAAAAGCTGG + Intronic
1130582189 15:85147674-85147696 AAGTCAATGAAACCAAAAGCTGG + Intergenic
1130637400 15:85637576-85637598 AAATCAATGAAACCAAAAGCTGG - Intronic
1130779820 15:87024177-87024199 AGATAAATGAAACAAAAATCTGG + Intronic
1130875351 15:88009003-88009025 GGCAGAAAGAAAACAAAATCAGG - Intronic
1131414200 15:92238289-92238311 AGATCAATGAAACAAAAAGCTGG + Intergenic
1131561326 15:93444003-93444025 AACTAAATGAAACCCAAATCTGG + Intergenic
1131808708 15:96150243-96150265 GGCTCAGAGAAACCAAAAGCTGG + Intergenic
1133696669 16:8270481-8270503 AGATCAATGAAACAAAAAACTGG - Intergenic
1134019035 16:10908658-10908680 GACTTAATGAAACCAAATTAAGG - Intronic
1135597256 16:23754350-23754372 GGCTCAATTAAACAACAATAAGG + Intergenic
1136641833 16:31572032-31572054 GGATCAATGAAACAAAAAGTTGG + Intergenic
1138355610 16:56376789-56376811 AAATCAATGAAACCAAAAGCCGG + Intronic
1138662388 16:58530152-58530174 GGCTTAATAAAAACAAAATAAGG + Intronic
1138894550 16:61187826-61187848 GGCCCAATGTAATCAAAATTGGG - Intergenic
1139024146 16:62793029-62793051 AGATCAATGAAACAAAAAGCTGG - Intergenic
1139426493 16:66883430-66883452 GTCTCAAAGAAAACAAAAACAGG - Intronic
1140162741 16:72515387-72515409 AAATCAATGAAACCAAAATTTGG - Intergenic
1141029583 16:80575751-80575773 GGCACAATGGGACTAAAATCAGG + Intergenic
1141139751 16:81489656-81489678 GGCTCCATAAAACCAGAAGCAGG - Intronic
1142822483 17:2481483-2481505 GGCACAATTAAACAAAATTCAGG + Intronic
1143342490 17:6224256-6224278 AACTCAATGAAATCAAAAACAGG + Intergenic
1143459340 17:7091218-7091240 AAATCAATGAAACCAAAATCTGG + Intergenic
1144117498 17:12112619-12112641 GGCTCAATGAATAAAAAATAAGG - Intronic
1144613715 17:16749040-16749062 GGATCAGTGAAACCAAAAGTTGG - Intronic
1144899001 17:18566626-18566648 GGATCAGTGAAACCAAAAGTTGG + Intergenic
1147269886 17:39261651-39261673 GGCTCAATGAACATAAAAGCAGG + Intronic
1149929573 17:60737338-60737360 AGATCAATGAAACCAAAAGCTGG - Intronic
1150511827 17:65761188-65761210 AAATCAATGAAACCAAAAGCTGG - Intronic
1150993055 17:70283197-70283219 GTTTCAAAGAAAGCAAAATCTGG + Intergenic
1152032673 17:77853795-77853817 GGCTCAATGAAGCCAATGTGTGG + Intergenic
1153095131 18:1392290-1392312 GGCCGAATGAAACTGAAATCAGG + Intergenic
1153506567 18:5805399-5805421 AATTCAATGAAACCAAAAACTGG - Intergenic
1153562966 18:6390518-6390540 AGATCAATGAAACAAAAACCTGG + Intronic
1153792370 18:8590587-8590609 AAATCAATGAAACCAAAAGCTGG + Intergenic
1155545967 18:26915452-26915474 TGCTCAATTAAACCAGAATTAGG + Exonic
1155562692 18:27096475-27096497 GAATCAATGAAACCAAAAGTTGG + Intronic
1155592800 18:27447193-27447215 GCCCAAATGAAATCAAAATCTGG - Intergenic
1155612849 18:27686782-27686804 GGATCACTAAAACCAAATTCTGG + Intergenic
1156094980 18:33518714-33518736 GAATTAATGAAACCAAAAGCTGG + Intergenic
1156368716 18:36453541-36453563 TGCTCCATGAAAGCAAAAACTGG - Intronic
1156578137 18:38343328-38343350 AGATCAATAAAATCAAAATCTGG + Intergenic
1158086366 18:53656339-53656361 AGCTTTATGAAACCAAACTCAGG - Intergenic
1158121749 18:54056116-54056138 GGCTCACTGAAACCACCTTCTGG - Intergenic
1159104669 18:63992547-63992569 AAATCAATGAAACCAAAAGCTGG - Intronic
1160366954 18:78334748-78334770 GGGAAAATGACACCAAAATCTGG - Intergenic
1161962562 19:7530617-7530639 GACTCTATGAAACCAAAAAGAGG + Intronic
1162338549 19:10077205-10077227 GACTCAAGGAAACCAAAAGTTGG - Intergenic
1164018621 19:21275911-21275933 GGCTCATTGAAACCCGAATATGG - Intronic
1164499279 19:28801100-28801122 GGCTCAACAAAACCAAAAGCTGG + Intergenic
1166272644 19:41725766-41725788 GAATCAATGAAACCAAAAGTTGG - Intronic
1166277530 19:41764682-41764704 GAGTCAATGAAACCAAAAGTTGG - Intronic
1168591065 19:57634500-57634522 GGATCAATGACACCAAGGTCTGG + Intronic
925026674 2:613824-613846 GGCTCAATCCAACCAAAAGGAGG + Intergenic
926235272 2:11037557-11037579 AGATCAATGAAACAAAAAGCTGG - Intergenic
926501604 2:13660673-13660695 GAATCAATGAAACCCAAAGCTGG - Intergenic
927080205 2:19620217-19620239 AGATAAATGAAACAAAAATCTGG + Intergenic
927353637 2:22148456-22148478 GGATCAATGAAACAAAAAGTTGG - Intergenic
927441038 2:23118095-23118117 GGCTCCATGAGAACAATATCTGG - Intergenic
927634220 2:24800274-24800296 GTCTCAAAAAAACAAAAATCCGG + Intronic
927722351 2:25392440-25392462 GAGTGAATGAAACCAAAAGCTGG + Intronic
928899141 2:36299094-36299116 TGCTCTATGAAAGCAAATTCAGG - Intergenic
930210445 2:48631567-48631589 GAATCAATGAAACCAAACACCGG - Intronic
930628165 2:53721887-53721909 GGATCAATGAAACCAAAAGTTGG + Intronic
931533444 2:63244409-63244431 AGATCAATGAAACCAAAAGTTGG + Intronic
932470938 2:71956479-71956501 GAATCAATGAAACCAAAAGTTGG + Intergenic
932728974 2:74204285-74204307 GGTTCCATGAAACCCAAATGTGG - Intronic
933638844 2:84737776-84737798 GGATCAATGAAACAAAAAGTTGG - Intronic
934316006 2:91920947-91920969 GGATAAATGAAACTAAAAGCTGG + Intergenic
935576194 2:104713414-104713436 CGATCAATGAAACCAAAAGTTGG - Intergenic
935725763 2:106022549-106022571 GGGTGAAAGAAACCAAGATCTGG + Intergenic
936942168 2:117895398-117895420 AGACCAATGAAACCAAAAGCAGG - Intergenic
937663272 2:124455092-124455114 AGATAAATGAAACAAAAATCTGG + Intronic
937938465 2:127265737-127265759 GGATCAATGAAATAAAAAGCTGG - Intronic
939493014 2:142899336-142899358 GGCTCACTGAAACACAAATTAGG - Intronic
939769828 2:146301583-146301605 AGATAAATGAAACCAAAAGCTGG + Intergenic
940010193 2:149045365-149045387 GACAAAATTAAACCAAAATCTGG - Intronic
940058766 2:149541622-149541644 GGCACCATTAAGCCAAAATCTGG + Intergenic
940366025 2:152849965-152849987 AGCTCAATAAAACAAAAAGCTGG - Intergenic
941296371 2:163743870-163743892 GGCTCAAGTCAACCAACATCAGG - Intergenic
941560945 2:167043387-167043409 AGATCAATGAAACCAAAATTTGG + Intronic
941858879 2:170257767-170257789 GGATCAATGAAACCAAACGTTGG + Intronic
942395543 2:175543928-175543950 GAGTCAATGAAACCAAAACTTGG - Intergenic
942899598 2:181098490-181098512 AGATCAATGACACCAAAATTTGG + Intergenic
943373896 2:187051572-187051594 GGATCTATGAAACCAAAAGTTGG - Intergenic
943398610 2:187374876-187374898 GGCTTATTTAAAGCAAAATCAGG + Intronic
943664021 2:190589618-190589640 GGTTCAATTAAGCCAAAACCTGG + Intergenic
944197548 2:197071157-197071179 AATTCAATGAAACAAAAATCTGG - Intronic
944603277 2:201325353-201325375 AGATCAATGAAACAAAAAGCTGG + Intronic
944607614 2:201366797-201366819 GAATCAATGAAACCAAAAGTTGG + Intergenic
944622029 2:201525662-201525684 AGATCAATGAAACCAAAAGTTGG + Intronic
945031617 2:205669864-205669886 GGATCAATCAAACAAAAAACTGG - Intergenic
945479793 2:210331812-210331834 GGGTCAATGAAATGAAAATATGG - Intergenic
947389808 2:229627589-229627611 GCATCAATGAAACCATGATCAGG + Intronic
947473802 2:230423435-230423457 GGATCAATAAAACCAAAAGGTGG - Intronic
947878156 2:233481449-233481471 TGCTCGATGAAAACAAACTCGGG + Intronic
948746560 2:240099387-240099409 AGATCAACGAAACAAAAATCTGG + Intergenic
1168916852 20:1496200-1496222 GGATCAATGAAACAAAAAGTTGG - Intergenic
1169069869 20:2718724-2718746 AAATCAATGAAACCAAAAGCTGG - Intronic
1170272303 20:14540834-14540856 GGCTCAAGGAAAGAAAAATCAGG + Intronic
1170636719 20:18112644-18112666 AAATCAATGAAACCAAAAGCTGG - Intergenic
1172177578 20:32981676-32981698 GGCTCAGTGAAACAAAAAAGAGG + Intergenic
1173230765 20:41194990-41195012 GAATCAATGAAACCAAAAGTTGG - Intronic
1173699483 20:45055548-45055570 GGATCAACAAAACCAAAAGCTGG - Intronic
1175100084 20:56573081-56573103 GGCTCACTGAAGCCTCAATCAGG - Intergenic
1175519864 20:59594735-59594757 AAATCAATGAAACCAAAAGCTGG - Intronic
1176865120 21:14045616-14045638 AAATCAATGAAACCAAAAGCTGG + Intergenic
1177039576 21:16091281-16091303 ACATCAATGAAACTAAAATCTGG - Intergenic
1177871752 21:26581243-26581265 GAATCAATGAAACCAAAAGTTGG - Intergenic
1179024653 21:37669461-37669483 AGCTCAATGAAAACAAAACAGGG + Intronic
1179196473 21:39168509-39168531 GGGTCAATGAAACAAAAAGTTGG - Intergenic
1180089276 21:45525498-45525520 GGCTCAAGGACACCAAGTTCCGG + Intronic
1180625555 22:17191319-17191341 GGCAAATTGAAACCAAAAACGGG + Intronic
1181901130 22:26156602-26156624 GGCAAAATGCACCCAAAATCTGG + Intergenic
1182375834 22:29847203-29847225 GTCTCAAAAAAACAAAAATCAGG - Intergenic
1183832228 22:40424376-40424398 GGCCCACTGAAACCCAAAGCTGG + Exonic
1184847021 22:47094512-47094534 GGCTTGATGAGAACAAAATCTGG - Intronic
1185262473 22:49875916-49875938 AAATCAATGAAACCAAACTCTGG - Intronic
1185396161 22:50590430-50590452 TAATCAATGAAACCAAAAGCTGG - Intronic
949727465 3:7066221-7066243 GGATAAATGAAACAAAAAGCTGG + Intronic
949813930 3:8038664-8038686 AGCTCAATGCCACCAAAATGAGG + Intergenic
949845842 3:8369787-8369809 GTTCCAATGAAACCAAAACCAGG - Intergenic
950960658 3:17102802-17102824 AGATCAATGAAACAAAAAGCTGG + Intergenic
951256449 3:20455094-20455116 GGCTCATCCAAATCAAAATCAGG + Intergenic
951325693 3:21299847-21299869 GGATCAATGAAACCAAAAACTGG + Intergenic
951767102 3:26212208-26212230 AGATCAATGAAACCAAAAGTTGG - Intergenic
952097196 3:29967912-29967934 AGATAAATGAAACAAAAATCTGG - Intronic
952340937 3:32446436-32446458 AAATCAATGAAACCAAAAGCTGG - Intronic
952543477 3:34393983-34394005 GGATCAATGAAACAAAAAGTTGG - Intergenic
952906504 3:38142474-38142496 TACTCATTGAAACCAAACTCTGG + Exonic
952992148 3:38840751-38840773 GAATCAATAAAACCAAAAGCTGG - Intergenic
953560818 3:43991436-43991458 AAATCAATGAAACCAAAAGCTGG + Intergenic
953721641 3:45361054-45361076 AGATCAATGAAACCAAAAGTTGG - Intergenic
954373391 3:50182000-50182022 AGGTCACTGAAAGCAAAATCAGG - Intronic
956894311 3:73644178-73644200 GCCTCAAAGAAAAAAAAATCAGG - Intergenic
956950521 3:74276826-74276848 AGATTAATGAAACAAAAATCTGG + Intronic
958064084 3:88520371-88520393 AAATCAATGAAACCAAAAGCTGG - Intergenic
958541213 3:95476008-95476030 AACTCAGTGAAACCAAAATAAGG + Intergenic
959257596 3:104034470-104034492 GGATCAATGAAACTAAAAGTTGG + Intergenic
959825317 3:110787759-110787781 AGATTAATGAAACCAAAATTTGG - Intergenic
960212489 3:114987279-114987301 GTCTCTATGAAACAAGAATCAGG + Intronic
961367747 3:126411853-126411875 GGATAAATGAAACAAAAACCTGG - Intronic
961407436 3:126691426-126691448 AGATAAATGAAACAAAAATCTGG + Intergenic
962289116 3:134116201-134116223 TGCTCAATAAAACTAAAAACTGG + Intronic
963411600 3:144934899-144934921 GGATCAATGAAACAAAAAGTTGG + Intergenic
964252927 3:154740813-154740835 AGATAAATGAAACAAAAATCTGG - Intergenic
964882289 3:161436716-161436738 GGATCAATGAAACAAAAAGCTGG + Intergenic
965205135 3:165712700-165712722 GGCTCAAGGAACCCTAAGTCTGG + Intergenic
965415761 3:168390244-168390266 AGATCAATGAAACAAAAAACTGG + Intergenic
965573482 3:170194636-170194658 ACATCAATGAAACAAAAATCTGG + Intergenic
966340206 3:178917023-178917045 GGATCAATGAAACAAAAAGTTGG + Intergenic
966519672 3:180859404-180859426 GGATTAATGAAACAAAAAGCTGG + Intronic
967480236 3:189964076-189964098 GCCTCTATAAAACCAAAATGTGG - Exonic
969965182 4:10986718-10986740 GCCTCAATGAAAGTAAAATCTGG - Intergenic
971071568 4:23098857-23098879 GGCTTAGTGAGTCCAAAATCTGG - Intergenic
971694207 4:29877009-29877031 GGATAAATGAAACAAAAAACTGG - Intergenic
972087030 4:35230637-35230659 GGCTCAATGATAGAAAAATTGGG + Intergenic
972215073 4:36888501-36888523 AGATCAATGAAACCAAAAGCTGG - Intergenic
973853091 4:54981213-54981235 GGATCAGTGAAACAAAAAGCTGG + Intergenic
974194120 4:58549009-58549031 GGCTCAAAGAAAGGAAATTCTGG + Intergenic
974766286 4:66350618-66350640 GGATCAATGAAACTAAAAGTTGG + Intergenic
974868721 4:67612239-67612261 GGATCAACAAAACCAAAATTTGG + Intergenic
975061835 4:70012796-70012818 AGATAAATGAAACAAAAATCTGG - Intergenic
975290660 4:72674532-72674554 AGATCAATGAAACAAAAAGCTGG - Intergenic
976044948 4:80934830-80934852 AGATAAATGAAACCAAAAGCTGG - Intronic
976301824 4:83522596-83522618 GGCTAAAAGACACCAAAACCAGG + Intronic
976656512 4:87494220-87494242 GGATCAAGGAAACCAAGAGCAGG - Exonic
978152865 4:105457864-105457886 GGCATTTTGAAACCAAAATCTGG - Intronic
978163469 4:105577874-105577896 AGATCAATGAAACAAAAAGCTGG - Intronic
978213474 4:106167567-106167589 AGATCAATGACACCAAAAGCTGG + Intronic
978316679 4:107445583-107445605 AGATAAATGAAACAAAAATCTGG - Intergenic
978818906 4:112942300-112942322 GGCACAAGGAAACAAAAATCAGG - Intronic
979040754 4:115790165-115790187 AAATCAATGAAACCAAAATTTGG - Intergenic
979503373 4:121465619-121465641 GGCTCAATGGAATGCAAATCTGG - Intergenic
979737675 4:124107491-124107513 GGATCAATAAAACCAAAAAGTGG - Intergenic
980238112 4:130134735-130134757 AGATAAATGAAACAAAAATCTGG + Intergenic
980994273 4:139765446-139765468 GGCCCAGTAAAGCCAAAATCAGG - Intronic
981408403 4:144398502-144398524 AAATTAATGAAACCAAAATCTGG + Intergenic
982075554 4:151733162-151733184 AGATAAATGAAACCAAAAACTGG + Intronic
982286145 4:153737257-153737279 AACACAATGAAACCAAAAGCTGG - Intronic
983275858 4:165616480-165616502 GCCTCCAGGAAACCAAAAGCAGG + Intergenic
983869458 4:172808157-172808179 GGGTCAATGAAAACAATATTTGG - Intronic
984550672 4:181155313-181155335 GGATAATTGAAATCAAAATCTGG + Intergenic
985394472 4:189527093-189527115 AGATCAATGAAACAAAAATCTGG - Intergenic
985572309 5:654725-654747 AGCTCAATGAAACCCAAACGAGG - Intronic
985925330 5:3011574-3011596 TGCTCAAGGAAACAAAAACCTGG - Intergenic
987527663 5:19074193-19074215 AGATAAATGAAACAAAAATCGGG + Intergenic
988118808 5:26933419-26933441 GAATCAATGAAACTAAAAGCTGG + Intronic
988423720 5:31038107-31038129 GGATAAATGAAACAAAAAGCTGG + Intergenic
988637551 5:33002626-33002648 ATATCAATGAAACCAAAAGCTGG - Intergenic
989215012 5:38895291-38895313 GGCTCAATGAAACCAAACACTGG + Intronic
990472938 5:56133995-56134017 AAATCAATGAAACCAAAAGCTGG + Intronic
991924142 5:71687118-71687140 GGATAAATGAAACAAAAACCTGG + Intergenic
992126944 5:73651988-73652010 GGCCCAACGGAACCAAAATGAGG - Intronic
992705228 5:79384207-79384229 GGATCAATGAAACAAAAATTTGG + Intronic
993233867 5:85277520-85277542 AGATCAATGAAATCAAAAGCTGG + Intergenic
994708683 5:103238486-103238508 AAATCAATGAAACCAAAATCTGG + Intergenic
994872887 5:105376430-105376452 GGATCAATGAAACCAAAAGCTGG - Intergenic
995313722 5:110741641-110741663 GGCCTAATGAAACAAATATCCGG - Intronic
996011020 5:118481887-118481909 AGATAAATGAAACAAAAATCTGG + Intergenic
996123781 5:119702309-119702331 AGATAAATGAAACAAAAATCTGG - Intergenic
996697347 5:126413054-126413076 GAATCAATGAAACCAAAAGTTGG - Intronic
997388176 5:133490392-133490414 GGATCAAGAAAATCAAAATCTGG - Intronic
998855648 5:146392708-146392730 AGCTCAAAGAAATCCAAATCGGG - Intergenic
999391163 5:151192231-151192253 AAATCAATGAAACCAAAAGCTGG + Intronic
999476928 5:151908732-151908754 TGTTAAATGAAAACAAAATCAGG + Intronic
1000390282 5:160716007-160716029 GGCTTAATAAAACTAAATTCTGG - Intronic
1000699981 5:164437305-164437327 AACTCAATGAAACCAAAAGCTGG - Intergenic
1000896413 5:166860704-166860726 GGTTGAATTTAACCAAAATCAGG - Intergenic
1001346900 5:170910995-170911017 GGATCAATGTCAGCAAAATCTGG + Exonic
1001478679 5:172070658-172070680 AAATCAATGAAACCAAAAGCTGG + Intronic
1002438394 5:179249444-179249466 GACTCAATGAAACCAAAAGCTGG + Intronic
1003001530 6:2339518-2339540 AGATCAATGAAACAAAAATTTGG + Intergenic
1004910888 6:20282243-20282265 GGATCAAAGAAACCAAAAGTTGG + Intergenic
1007870568 6:45032549-45032571 TGGTCACTAAAACCAAAATCAGG + Intronic
1007954879 6:45908219-45908241 GAATCAATGAAACCAAAAGTTGG - Intronic
1008637232 6:53423103-53423125 GGCTGAATCCAACCAAAAGCTGG - Intergenic
1009360003 6:62799828-62799850 AGATCAATGAAACAAAAATCTGG - Intergenic
1010473320 6:76256384-76256406 GAATCAATGAAACCAAAAGTTGG - Intergenic
1010578999 6:77570637-77570659 AGATTAATGAAACCAAAAGCTGG + Intergenic
1010629196 6:78176645-78176667 TGATCAATGAAACAAAAATTTGG + Intergenic
1012298988 6:97560960-97560982 TGCTAAATGAAACAAAAAGCTGG - Intergenic
1012817276 6:104040048-104040070 CGATCAATGAAACCAAAAGCTGG + Intergenic
1014542125 6:122689211-122689233 GGATCAATAAAACGAAAATTCGG - Intronic
1016103438 6:140131658-140131680 GGATCAATGAAACAAAAAGTTGG + Intergenic
1016258713 6:142141904-142141926 AAATCAATTAAACCAAAATCTGG + Intergenic
1016473854 6:144404858-144404880 ACCTCAAAGAAAACAAAATCTGG + Intronic
1017612450 6:156203743-156203765 ACATCAATGAAACCAAAAGCTGG + Intergenic
1018929337 6:168229984-168230006 GGGGCACTGAAACCAAAGTCTGG - Intergenic
1021153221 7:17177229-17177251 GGCTCAATGAAATCTTAATTTGG + Intergenic
1021842332 7:24730988-24731010 GGCTCACTAAAACCAAGACCAGG + Intronic
1024235903 7:47397872-47397894 AGATCAATGAAACAAAAAGCTGG + Intronic
1024484088 7:49896583-49896605 AAATCAATGAAACCAAAAACTGG + Intronic
1024559980 7:50635582-50635604 GGATCAATGAAATCAAAAGTTGG + Intronic
1025779275 7:64585337-64585359 GGCTTAATAAAAACAAAATATGG - Intergenic
1026320447 7:69263435-69263457 GGCTCAAAGAAAATAAAATAGGG - Intergenic
1028696673 7:93721631-93721653 AAATCAATGAAACCAAAAGCTGG - Intronic
1030180353 7:106701201-106701223 AAATCAATGAAACCAAAAGCTGG - Intergenic
1030774213 7:113513638-113513660 AAGTCAATGAAACCAAAAGCTGG - Intergenic
1031466640 7:122120503-122120525 AAATCAATGAAACCAAAACCTGG - Intronic
1033501953 7:141960256-141960278 TGTTCAATGAAACCAAAACAGGG + Intronic
1034682932 7:152944254-152944276 GGATAAATGAAACAAAAAGCTGG - Intergenic
1035280405 7:157774981-157775003 GACACAATGAAAGCAAAGTCAGG + Intronic
1035397420 7:158544212-158544234 GGGCCAATGAACCCAAAAACAGG + Intronic
1035592373 8:825664-825686 AAATCAATGAGACCAAAATCTGG - Intergenic
1036155162 8:6334923-6334945 GGTTCAGTGAAACCAACAGCAGG + Intergenic
1037154346 8:15681617-15681639 GAATCAATGAAACCAAAAGTTGG - Intronic
1038512243 8:28149619-28149641 AAATCAATGAAACCAAAAACTGG - Intronic
1039083029 8:33752599-33752621 AGCTAAATGAAACAAAAAGCTGG - Intergenic
1039889786 8:41677294-41677316 AACTTAATGAAACCAAAAGCTGG - Intronic
1040812033 8:51464412-51464434 AGATCAATGAAACCAAAAGTTGG + Intronic
1040827135 8:51635421-51635443 GAGTCAATGAAACCAAAAGTTGG + Intronic
1041025692 8:53683652-53683674 GAATCAATGAAACCAAAAGTTGG + Intergenic
1041462989 8:58132144-58132166 GGCCCAATGAATCCAATATGAGG - Intronic
1041640277 8:60192208-60192230 GTTTCAATGAAATCACAATCTGG + Intronic
1042980680 8:74523815-74523837 AGATCAATGAAACAAAAAACTGG + Intergenic
1043612287 8:82079944-82079966 ATATCAATGAAACCAAAAGCTGG - Intergenic
1044615925 8:94140622-94140644 AAATCAATGAAACCAAAAGCTGG + Intronic
1044947623 8:97405303-97405325 AGATAAATGAAACAAAAATCTGG - Intergenic
1044955842 8:97479147-97479169 GAATCAATGAAACCAAAAGATGG + Intergenic
1046181775 8:110658573-110658595 GGATCAATGAAACGAAAAGTTGG + Intergenic
1046449212 8:114366344-114366366 AGATCAATGAAACAAAAATTTGG + Intergenic
1046574212 8:116005555-116005577 AAATCAATGAAACCAAAAGCTGG + Intergenic
1046825257 8:118683355-118683377 GGATCAATGAAACTGAAAACGGG - Intergenic
1048515676 8:135108145-135108167 GGATCAATGAAACAAAAACTTGG - Intergenic
1048825397 8:138420035-138420057 AGATCAACAAAACCAAAATCTGG + Intronic
1048994336 8:139783228-139783250 AAATCAATGAAACCAAAAGCTGG + Intronic
1050505458 9:6343729-6343751 GTATCAATGAAACAAAAAGCTGG + Intergenic
1050753104 9:8964503-8964525 GAATCAATGAAACCAAAAATTGG - Intronic
1052010915 9:23408070-23408092 AAATCAATGAAACCAAAAACTGG + Intergenic
1052843651 9:33315396-33315418 GGCTCAATAAAAGAAAAAACTGG - Intronic
1055080068 9:72259929-72259951 AGCTCCATGAAATGAAAATCTGG - Intergenic
1055178701 9:73354937-73354959 GGCTCAATGAATTCAATTTCTGG - Intergenic
1055546376 9:77378646-77378668 GAATCAATGAAACTAAAAACTGG - Intronic
1056087467 9:83165695-83165717 GAATCAATGAAACCAAAAGCTGG + Intergenic
1056207086 9:84330122-84330144 GAATCAATGAAACCAAAAGTTGG + Intronic
1056995850 9:91458585-91458607 GAATCAATAAAACCAAAAGCTGG - Intergenic
1057004088 9:91540741-91540763 AGATAAATGAAACCAAAAGCTGG + Intergenic
1057136831 9:92696369-92696391 AGATCAATGAAACCAAAAGTTGG - Intergenic
1057753989 9:97815803-97815825 AAATCAATGAAACCAAAAGCTGG - Intergenic
1058235952 9:102490250-102490272 AGATCAATGAAACCAAAAATTGG - Intergenic
1059674029 9:116519699-116519721 AGATAAATGAAACAAAAATCTGG + Intronic
1060700281 9:125745480-125745502 AGCTCAATGAATCTAAAATCGGG + Intergenic
1061342315 9:129992449-129992471 CACTCAATAAAAACAAAATCTGG + Intronic
1061349350 9:130052433-130052455 GTCTCAATAAAAAAAAAATCAGG - Intergenic
1187236366 X:17471180-17471202 GGCTCAACCAAACCAAAAGCTGG - Intronic
1187751940 X:22476156-22476178 AGATAAATGAAACAAAAATCTGG - Intergenic
1187784065 X:22864741-22864763 AAATCAATGAAACCAAAAACTGG + Intergenic
1188064126 X:25636669-25636691 GGATCAATGAAACAAAAACCTGG + Intergenic
1188179889 X:27041388-27041410 AAATCAATGAAACCAAAAGCTGG - Intergenic
1188210203 X:27414783-27414805 TACTCAATAAAACCAAAATTGGG - Intergenic
1188389103 X:29597975-29597997 AGATAAATGAAACAAAAATCTGG - Intronic
1189441853 X:41043745-41043767 AGATCAATGATACCAAAACCTGG + Intergenic
1189639062 X:43047971-43047993 CGATAAATGAAACCAAAAGCTGG - Intergenic
1190518715 X:51253520-51253542 GGATCAGTGAAACCAAATGCTGG - Intergenic
1190571847 X:51790702-51790724 AAATCAATGAAACCAAAAGCTGG - Intergenic
1191050254 X:56183854-56183876 GGCTCAATGGATAAAAAATCAGG + Intergenic
1191135059 X:57055232-57055254 GGCATCATGATACCAAAATCTGG - Intergenic
1191768201 X:64724596-64724618 ACATCAATGAAACCAAAAGCTGG - Intergenic
1191853107 X:65600791-65600813 GGCAAAATCAAACCATAATCAGG - Intronic
1192272226 X:69592053-69592075 AAATCAATGAAGCCAAAATCTGG + Intergenic
1192394438 X:70764522-70764544 AGTTCAATGAAACAAAAATGCGG + Intronic
1192711343 X:73593152-73593174 GGGTCAATGAAACCAAAAGTTGG - Intronic
1193098680 X:77582540-77582562 AGATCAATGAAACAAAAAACAGG + Intronic
1193444323 X:81581049-81581071 GTATGAATGAAACCAAAAGCTGG + Intergenic
1193703127 X:84788288-84788310 AGATCAATAAAACAAAAATCTGG - Intergenic
1193747071 X:85295165-85295187 AGATCAATGAAACCAAAAGTTGG - Intronic
1193864010 X:86707035-86707057 AAATCAATGAAACCAAAAGCTGG + Intronic
1194211023 X:91069132-91069154 AGATCAATGAAACCAAAAGTTGG + Intergenic
1194232215 X:91338490-91338512 AGATAAATGAAACAAAAATCTGG + Intergenic
1194493705 X:94582378-94582400 AGATCAATGAAACAAAAATTCGG + Intergenic
1194632782 X:96306621-96306643 AAATCAATGAAACCAAAAGCTGG + Intergenic
1195242934 X:102971274-102971296 AGATCAATGAAACAAAAAACAGG + Intergenic
1195826564 X:109007807-109007829 AAATCAATGAAAACAAAATCTGG + Intergenic
1196379314 X:115071452-115071474 GACTCAATGAAATGAAAATGAGG + Intergenic
1196385393 X:115143181-115143203 AGATCAATGAAACAAAAATATGG + Intronic
1196465103 X:115963822-115963844 AGATCAATGAAACAAAAAGCTGG + Intergenic
1196566591 X:117213010-117213032 GAATCAATGAAACCAAAAGTTGG + Intergenic
1196673723 X:118397185-118397207 GACTGAATGAAACCAAATTAGGG - Intronic
1196947963 X:120847223-120847245 AGATAAATGAAACAAAAATCTGG - Intergenic
1197071560 X:122304604-122304626 AAATCAATGAAACCAAAAGCTGG - Intergenic
1197126454 X:122952085-122952107 AGATCAATGAAACAAAAATTTGG - Intergenic
1197199940 X:123739946-123739968 GGATCAATAAAACCAAAACTTGG + Intergenic
1198173443 X:134130537-134130559 GGTTCTATGAACCCAAAATTAGG - Intergenic
1199316291 X:146381813-146381835 AGATCAATGAAACAAAAATCAGG + Intergenic
1199686536 X:150270177-150270199 GGCTGCATGAAAGCAAAAACAGG + Intergenic
1200328586 X:155268880-155268902 GAATCAATGAAACCAAAAGTTGG - Intergenic