ID: 1086390162

View in Genome Browser
Species Human (GRCh38)
Location 11:86355617-86355639
Sequence GCTCAAGTATGTGCACTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086390158_1086390162 7 Left 1086390158 11:86355587-86355609 CCAGTAGGATCTCAGGAGTTGGG No data
Right 1086390162 11:86355617-86355639 GCTCAAGTATGTGCACTGAGAGG No data
1086390156_1086390162 8 Left 1086390156 11:86355586-86355608 CCCAGTAGGATCTCAGGAGTTGG 0: 3
1: 21
2: 120
3: 334
4: 503
Right 1086390162 11:86355617-86355639 GCTCAAGTATGTGCACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086390162 Original CRISPR GCTCAAGTATGTGCACTGAG AGG Intergenic
No off target data available for this crispr