ID: 1086397778

View in Genome Browser
Species Human (GRCh38)
Location 11:86433851-86433873
Sequence TCCAGCTGGCCCACAAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086397768_1086397778 3 Left 1086397768 11:86433825-86433847 CCGCCAAGCCCATGCCCACCCGG 0: 57
1: 514
2: 500
3: 384
4: 588
Right 1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG No data
1086397772_1086397778 -6 Left 1086397772 11:86433834-86433856 CCATGCCCACCCGGAACTCCAGC 0: 50
1: 510
2: 411
3: 484
4: 708
Right 1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG No data
1086397771_1086397778 -5 Left 1086397771 11:86433833-86433855 CCCATGCCCACCCGGAACTCCAG 0: 45
1: 491
2: 393
3: 450
4: 530
Right 1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG No data
1086397766_1086397778 25 Left 1086397766 11:86433803-86433825 CCGGCTGCTCTGAGTGCGTGGCC No data
Right 1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG No data
1086397770_1086397778 0 Left 1086397770 11:86433828-86433850 CCAAGCCCATGCCCACCCGGAAC 0: 72
1: 732
2: 627
3: 324
4: 330
Right 1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG No data
1086397767_1086397778 4 Left 1086397767 11:86433824-86433846 CCCGCCAAGCCCATGCCCACCCG 0: 38
1: 436
2: 510
3: 420
4: 562
Right 1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086397778 Original CRISPR TCCAGCTGGCCCACAAGCGC CGG Intergenic
No off target data available for this crispr