ID: 1086399527 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:86449040-86449062 |
| Sequence | TGCTGAAAGGAACTTAGCCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 218 | |||
| Summary | {0: 1, 1: 1, 2: 0, 3: 19, 4: 197} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1086399527_1086399535 | 24 | Left | 1086399527 | 11:86449040-86449062 | CCAAGGCTAAGTTCCTTTCAGCA | 0: 1 1: 1 2: 0 3: 19 4: 197 |
||
| Right | 1086399535 | 11:86449087-86449109 | TAGGAAGCTCAGTTCTGCTGAGG | 0: 1 1: 0 2: 3 3: 24 4: 193 |
||||
| 1086399527_1086399531 | 5 | Left | 1086399527 | 11:86449040-86449062 | CCAAGGCTAAGTTCCTTTCAGCA | 0: 1 1: 1 2: 0 3: 19 4: 197 |
||
| Right | 1086399531 | 11:86449068-86449090 | CTGGCCCCATATGGAACAATAGG | 0: 1 1: 0 2: 2 3: 7 4: 123 |
||||
| 1086399527_1086399530 | -4 | Left | 1086399527 | 11:86449040-86449062 | CCAAGGCTAAGTTCCTTTCAGCA | 0: 1 1: 1 2: 0 3: 19 4: 197 |
||
| Right | 1086399530 | 11:86449059-86449081 | AGCAGAAATCTGGCCCCATATGG | 0: 1 1: 0 2: 2 3: 9 4: 132 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1086399527 | Original CRISPR | TGCTGAAAGGAACTTAGCCT TGG (reversed) | Intronic | ||