ID: 1086399527

View in Genome Browser
Species Human (GRCh38)
Location 11:86449040-86449062
Sequence TGCTGAAAGGAACTTAGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 0, 3: 19, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086399527_1086399535 24 Left 1086399527 11:86449040-86449062 CCAAGGCTAAGTTCCTTTCAGCA 0: 1
1: 1
2: 0
3: 19
4: 197
Right 1086399535 11:86449087-86449109 TAGGAAGCTCAGTTCTGCTGAGG 0: 1
1: 0
2: 3
3: 24
4: 193
1086399527_1086399531 5 Left 1086399527 11:86449040-86449062 CCAAGGCTAAGTTCCTTTCAGCA 0: 1
1: 1
2: 0
3: 19
4: 197
Right 1086399531 11:86449068-86449090 CTGGCCCCATATGGAACAATAGG 0: 1
1: 0
2: 2
3: 7
4: 123
1086399527_1086399530 -4 Left 1086399527 11:86449040-86449062 CCAAGGCTAAGTTCCTTTCAGCA 0: 1
1: 1
2: 0
3: 19
4: 197
Right 1086399530 11:86449059-86449081 AGCAGAAATCTGGCCCCATATGG 0: 1
1: 0
2: 2
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086399527 Original CRISPR TGCTGAAAGGAACTTAGCCT TGG (reversed) Intronic