ID: 1086399529

View in Genome Browser
Species Human (GRCh38)
Location 11:86449053-86449075
Sequence GGGGCCAGATTTCTGCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 0, 2: 8, 3: 116, 4: 509}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086399529_1086399536 28 Left 1086399529 11:86449053-86449075 CCTTTCAGCAGAAATCTGGCCCC 0: 1
1: 0
2: 8
3: 116
4: 509
Right 1086399536 11:86449104-86449126 CTGAGGATCTCTGCCATTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 192
1086399529_1086399531 -8 Left 1086399529 11:86449053-86449075 CCTTTCAGCAGAAATCTGGCCCC 0: 1
1: 0
2: 8
3: 116
4: 509
Right 1086399531 11:86449068-86449090 CTGGCCCCATATGGAACAATAGG 0: 1
1: 0
2: 2
3: 7
4: 123
1086399529_1086399535 11 Left 1086399529 11:86449053-86449075 CCTTTCAGCAGAAATCTGGCCCC 0: 1
1: 0
2: 8
3: 116
4: 509
Right 1086399535 11:86449087-86449109 TAGGAAGCTCAGTTCTGCTGAGG 0: 1
1: 0
2: 3
3: 24
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086399529 Original CRISPR GGGGCCAGATTTCTGCTGAA AGG (reversed) Intronic