ID: 1086399532

View in Genome Browser
Species Human (GRCh38)
Location 11:86449072-86449094
Sequence GCTTCCTATTGTTCCATATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086399532_1086399536 9 Left 1086399532 11:86449072-86449094 CCCCATATGGAACAATAGGAAGC 0: 1
1: 1
2: 1
3: 10
4: 179
Right 1086399536 11:86449104-86449126 CTGAGGATCTCTGCCATTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 192
1086399532_1086399535 -8 Left 1086399532 11:86449072-86449094 CCCCATATGGAACAATAGGAAGC 0: 1
1: 1
2: 1
3: 10
4: 179
Right 1086399535 11:86449087-86449109 TAGGAAGCTCAGTTCTGCTGAGG 0: 1
1: 0
2: 3
3: 24
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086399532 Original CRISPR GCTTCCTATTGTTCCATATG GGG (reversed) Intronic